Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2008 Jul 11;190(18):6188–6196. doi: 10.1128/JB.00300-08

Characterization of the Accessory Sec System of Staphylococcus aureus▿

Ian R Siboo 1, Donald O Chaffin 2, Craig E Rubens 2, Paul M Sullam 1,*
PMCID: PMC2546797  PMID: 18621893

Abstract

The SraP adhesin of Staphylococcus aureus is a member of a highly conserved family of serine-rich surface glycoproteins of gram-positive bacteria. For streptococci, export of the SraP homologs requires a specialized transport pathway (the accessory Sec system). Compared to streptococci, however, SraP is predicted to differ in its signal peptide and glycosylation, which may affect its dependence on a specialized system for transport. In addition, two genes (asp4 and asp5) essential for export in Streptococcus gordonii are missing in S. aureus. Thus, the selectivity of the accessory Sec system in S. aureus may also differ compared to streptococci. To address these issues, the five genes encoding the putative accessory Sec system (secY2, secA2, and asp1-3) were disrupted individually in S. aureus ISP479C, and the resultant mutants were examined for SraP export. Disruption of secA2 resulted in the near complete loss of SraP surface expression. Similar results were seen with disruption of secY2 and asp1, asp2, or asp3. To assess whether the accessory Sec system transported other substrates, we compared secreted proteomes of ISP479C and a secA2 isogenic mutant, by two-dimensional fluorescence difference gel electrophoresis. Although two consistent differences in proteome content were noted between the strains, neither protein appeared to be a likely substrate for accessory Sec export. Thus, the accessory Sec system of S. aureus is required for the export of SraP, and it appears to be dedicated to the transport of this substrate exclusively.


The binding of bacteria to platelets is a postulated central event in the pathogenesis of infective endocarditis (23). Initial colonization of damaged endothelium on the valve surface may be mediated by the attachment of blood-borne bacteria to platelets bound at the site of injury (9, 24, 31). Platelets may subsequently be recruited to the site of infection through direct adhesion to immobilized bacteria (6). These events, in combination with bacterial proliferation, are thought to produce the hallmark lesion of infective endocarditis, the macroscopic vegetation.

Staphylococcus aureus has been shown to bind to human platelets through a variety of adhesins. Many of these surface components bind platelets through their interaction with bridging molecules, such as fibrinogen or fibronectin (7, 13, 15, 17, 22). In addition, our laboratory has identified a large surface glycoprotein of S. aureus, the serine-rich adhesin for platelets (SraP) (Fig. 1) that also mediates binding to human platelets (21). Although the receptor for SraP binding has not been identified, it appears that SraP can bind directly to the platelet surface (21). Loss of SraP expression is associated with reduced virulence in an animal model of endocarditis, indicating that this interaction is important for the pathogenesis of endovascular infection (21).

FIG. 1.

FIG. 1.

Schematic diagram of the accessory Sec loci of S.aureus and S. gordonii. (A) The export pathways include two sets of common genes: (a) the export-related genes secY2, asp1, asp2, asp3, and secA2 and (b) the glycosyltransferase genes gtfA and gtfB that are predicted to modify the adhesins. Note that the streptococcal accessory secretion system includes two additional secretory components encoded by the genes asp4 and asp5 and two additional glycosylating enzymes that are encoded by the gly and nss. (B) Domain structure of the two adhesins, SraP and GspB. SP, atypically long signal sequence; SRR1 and SRR2, serine-rich domains; BR and AR, putative N-terminal binding regions.

SraP shares similarity with a group of cell wall-associated glycoproteins found in a number of organisms including, Streptococcus sanguinis, Streptococcus pneumoniae, and Streptococcus agalactiae (4, 12, 16, 19, 20, 25, 30). Among the best-characterized members of the family is GspB of Streptococcus gordonii. This large, extensively glycosylated surface protein has a multidomain structure that includes two serine-rich domains, an N-terminal receptor binding domain, and an atypically long signal peptide (Fig. 1). Export of GspB occurs exclusively through an accessory Sec system, whose sole function appears to be the transport of this substrate to the bacterial surface. This pathway is comprised of SecY2 and SecA2 (homologs of SecY and SecA, respectively, of the general Sec system) and five accessory Sec proteins (Asp1 to Asp5) that lack homology to any proteins of known function (4, 28).

The components for GspB glycosylation and export are encoded in a locus located immediately downstream of the gene encoding the adhesin (Fig. 1). Although the organization of this locus is well conserved across species, the SraP accessory Sec locus of S. aureus has a number of distinctive features. First, it contains only two glycosylation-related genes (gtfA and gtfB) compared to four such genes in S. gordonii (gly, nss, gtfA, and gtfB) (Fig. 1) (26), suggesting that SraP may be less extensively glycosylated compared to GspB. Since glycosylation is a major structural feature of GspB that precludes its export by the canonical Sec system, these findings suggest that SraP may be less stringent in its export requirements. In addition, the signal peptide of SraP differs from that of GspB in that its signal peptide contains fewer glycine residues in the hydrophobic region, which block the entry of the protein into the canonical Sec pathway (3). Third, two essential components of the accessory Sec system in S. gordonii (asp4 and asp5) (28) are absent in S. aureus (Fig. 1). The lack of Asp4 and Asp5 in S. aureus indicates that the accessory Sec system of S. aureus may function differently from its ortholog in S. gordonii. Taken together, these differences in the export substrate and sec locus indicate that the accessory Sec system in S. aureus may have altered substrate specificity compared to S. gordonii. To address these issues, we examined the effects of disrupting the accessory Sec system on SraP-specific and general protein transport by S. aureus.

MATERIALS AND METHODS

Bacterial strains, plasmids, and primers.

The bacterial strains, plasmids, and primers used in the present study are described in Table 1. S. aureus ISP479C is a commonly used laboratory strain (18). PS767 is an isogenic variant of ISP479C, in which sraP has been disrupted by the insertion of ermB (21).

TABLE 1.

Strains, plasmids, and primers

Bacterial strain, plasmid, or primer Genotype, sequence (5′→3′), or descriptiona Source or referenceb
Strains
    S. aureus
        ISP479C 8325-4 pig-131 18
        RN4220 Restriction-deficient strain that can be transformed with DNA from E. coli 14
        PS767 ISP479C sraP::ermB 21
        PS1166 ISP479C secA2::spec This study
        PS1167 ISP479C secY2::spec This study
        PS1257 ISP479C asp1::spec This study
        PS1280 ISP479C asp2::spec This study
        PS1249 ISP479C asp3::spec This study
    E. coli DH5α F− φ80dlacZΔM15 Δ(lacZYA-argF)U169 endA1 recA1 hsdR17(rK− mK+) deoR thi-1 supE44 λ−gyrA96 relA1 11
Plasmids
    pS326 High-copy E. coli vector with MCS-Specr 27
    pTSermC PTV1ts derivative with MCS and Ermr 8, 10
Primers
    SY2LU AGTCTCTCGAGATTAGTGATGAACCCTTAGTC -secY2 left flank For
    SY2LD AGTCTAAGCTTGCGGAAACGAACATTAAATCG -secY2 left flank Rev
    SY2RU AGTCTGAATTCTAAATTATCAAGCACGACGCG -secY2 right flank For
    SY2RD AGTCTGGATCCTTTTCTTCAATTAGTTGAGCC -secY2 right flank Rev
    A1LU AGTCTCTCGAGGGAACGATGTTATTAGTTTGG -asp1 left flank For
    A1LD AGTCTAAGCTTTCATTTTCAAGGTGCATTCCC -asp1 left flank Rev
    A1RU AGTCTGAATTCAGGCACAATCGACAAATAGCC -asp1 right flank For
    A1RD AGTCTGGATCCAGGTTCTAAATCGTCTCCTCC -asp1 right flank Rev
    A2LU AGTCTCTCGAGAATTGGAATTATGCGTACGCC -asp2 left flank For
    A2LD AGTCTAAGCTTCCATCGTTTGTGTATAGGTCC -asp2 left flank Rev
    A2RU AGTCTGAATTCTATGGGTCAATTTTTACTCGG -asp2 right flank For
    A2RD AGTCTGGATCCTGAAAATGATACTTTAGAGCC -asp2 right flank Rev
    A3LU AGTCTCTCGAGAGTGATGAATCGCAGTATTCC -asp3 left flank For
    A3LD AGTCTAAGCTTACAGTTCAAAAAATCATTCG -asp3 left flank Rev
    A3RU AGTCTGAATTCGGATGGAAGACGATATCAAGG -asp3 right flank For
    A3RD AGTCTGGATCCCGTTGCTGTTAATGTTTTACC -asp3 right flank Rev
    SA2LU AGTCTCTCGAGATATCCTGATGAAGCCTATGC -secA2 left flank For
    SA2LD TGCATAAGCTTCAGGTAACAATGTATCTAGTG -secA2 left flank Rev
    SA2RU AGTCTGAATTCGATTATTTAGTTAAGCGATGG -secA2 right flank For
    SA2RD AGTCTGGATCCATATTCAACACCGCTACTCGC -secA2 right flank Rev
a

Ermr, erythromycin resistance; Specr, spectinomycin resistance. Restriction sites are indicated by underscoring in the sequences.

b

For the primers, the position and orientation (forward [For] or reverse [Rev]) are specified.

Media and antibiotics.

Tryptic soy broth (TSB) and tryptic soy agar, blood agar, and RPMI were used as culture media for S. aureus. Escherichia coli was grown in Luria-Bertani (LB) broth or on LB agar. Erythromycin was used at a concentration of 15 μg/ml for selection of S. aureus and at 400 μg/ml for selection of E. coli. Spectinomycin was used at a concentration of 50 μg/ml for selection of E. coli and 1 mg/ml for selection of S. aureus.

Mutagenesis of accessory sec genes by allelic replacement.

Recombinant plasmids were constructed to partially disrupt by allelic replacement the genes encoding members of the putative accessory Sec pathway. Two specific flanking regions of each gene were amplified by PCR. The primer pairs (Table 1) were designed to encode unique restriction sites at the ends of the amplification products. The products were digested with the appropriate enzymes and purified after agarose gel electrophoresis. The knockout vectors were then constructed in a multistep process. The purified PCR products were ligated on either side of the spec gene in the E. coli vector pS326. To generate a vector suitable for replication in S. aureus, the pS326-based constructs were linearized and then ligated to temperature-sensitive staphylococcal vector pTSermC (8). The ligation product was electroporated into E. coli DH5α, and transformants were selected on LB agar supplemented with erythromycin. The newly generated shuttle vectors were used for transformation of S. aureus RN4220 by electroporation. The plasmids were then transferred to S. aureus ISP479C by transduction using phage 80α. Transductants were cultured sequentially at nonpermissive and permissive temperatures in the presence of spectinomycin. Spectinomycin-resistant, erythromycin-sensitive colonies were selected for testing by PCR and Southern blotting to confirm that the targeted genes had been disrupted. Selected mutations were then transduced back into WT ISP479C, which had not undergone growth at high temperature, by phage 80α.

Microarray analysis.

Portions (1 ml) of the overnight cultures, grown in LB, were diluted into 100 ml, and the cultures were grown at 37°C with shaking at 200 rpm to an optical density at 600 nm of 0.7. A 2-ml portion of each culture (109 CFU) was transferred to 4 ml of RNA Protect (Qiagen, Germantown, MD) and mixed, and the cells were pelleted by centrifugation for 4 min at 10,000 × g at 25°C, resuspended in 1 ml of RNA Protect, and then frozen at −80°C.

Total RNA was isolated from the cell pellets by using the Fastprep cell homogenizer (Qbiogene, Irvine, CA) and the RNeasy system (Qiagen, Valencia, CA), with on-column DNase digestion, according the manufacturer's instructions, with the exception of an additional wash with 350 μl of RW1 prior to DNase digestion. RNA was eluted in 40 μl of RNase free distilled H2O and quantified by UV spectroscopy, and the quality of the sample was assessed by capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent Biosystems, Santa Clara, CA).

RNA from three independent isolations was pooled and labeled with biotin-16-UTP (Roche Applied Science, Indianapolis, IN) representing 40% of the total UTP in each reaction, using the MessageAmp II bacterial aRNA amplification kit (Ambion, Austin TX) according to the manufacturer's instructions. After labeling, the aRNA was fragmented (5× fragmentation buffer, product 9003371; Affymetrix, Santa Clara, CA) and hybridized to wyeSaur2a microarrays (Wyeth, King of Prussia, PA, and Affymetrix) (5). Six genomes are represented on the chip: N315, Mu50, MRSA252, MSSA476, NCTC 8325, and COL. Microarray probe intensities were analyzed by using GeneSpring GX 7.3.1 (Agilent Biosystems). Only probes flagged “present” by the Affymetrix microarray processing software (3,017 of 7,792 total probes) were used in the analysis. Significance differences between probe intensities for strains ISP479C and ISP479C sec2A::spec were evaluated by using analysis of variance with a cross-gene error model, parametric test with all available error estimates selected, and the Benjamini and Hochberg false discovery rate correction for multiple comparisons.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting, and glycan detection.

Proteins from the culture media and cellular compartments were isolated and prepared for electrophoresis as described previously (1, 21). In brief, overnight cultures of S. aureus were diluted 1:50 in TSB and grown for 3 h at 37°C with shaking at 270 rpm. The optical density at 600 nm of the cultures was adjusted to 1, and equal volumes of each sample were centrifuged (3,200 × g) to pellet the cells. The media were filtered using nonsterile 0.22 μM Millex-GV polyvinylidene difluoride filters (Millipore). Proteins in the filtered media were precipitated with trichloroacetic acid (1), and the pellets were washed with acetone and then dried. The washed proteins were prepared for electrophoresis by suspension in 1× loading buffer. Cell wall proteins were isolated from whole bacteria by treatment with lysostaphin (21). The pelleted cells were washed three times with phosphate-buffered saline (PBS) and then suspended in protoplasting buffer (10 mM Tris-HCl [pH 7.5], 10 mM MgCl2, 30% raffinose, EDTA-free Complete protease inhibitors [Roche]) supplemented with 50 μg of lysostaphin/ml. The suspension was incubated for 30 min at 37°C and then centrifuged (16,000 × g) to pellet the protoplasts. The supernatant was removed, filtered as described above, and then prepared for electrophoresis by the addition of the appropriate volume of loading buffer. The protoplasts were washed in protoplasting buffer and then suspended in molecular-grade water supplemented with DNase (500 U/ml). The protoplast suspension was incubated for 15 min at 37°C and then centrifuged (16,000 × g) to separate the cytoplasmic fraction from the membrane-enriched insoluble material. The soluble cytoplasmic material was diluted 1:2 and prepared for electrophoresis by the addition of the appropriate volume of loading buffer. The membrane-enriched pellet was washed with molecular-grade water and then suspended in 1× loading buffer. Each of the subcellular protein fractions was separated by electrophoresis, using 4 to 12% gradient polyacrylamide gels and the Novex Tris-acetate gel system (Invitrogen) according to the manufacturer's instructions. One gel of each set was stained with GelCode (Pierce), and the proteins in the other gels were then transferred electrophoretically to BioTrace NT membranes (Pall Corp.) in Towbin buffer. The membranes were treated overnight with 1× blocking reagent (Roche) and then incubated with polyclonal rabbit anti-SraP serum (diluted 1:1,000 in block solution) (21), polyclonal rabbit anti-SecA serum (S. gordonii), or polyclonal rabbit anti-alpha-toxin serum (diluted 1:10,000 in block solution) (Sigma). Goat anti-rabbit immunoglobulin G (IgG) coupled to horseradish peroxidase and SuperSignal PicoWest (Pierce) was then used to detect SraP and alpha-toxin. When Western blotting was performed to quantify SraP transport, all membrane-blocking steps were performed with 3% gelatin in PBS. In addition, Cy5-coupled goat anti-rabbit IgG was used as a secondary antibody. Fluorescent signals were detected by using a Typhoon scanner (GE Healthcare) and quantified by using ImageQuant (version 5.2; GE Healthcare).

Glycosylation of SraP was assessed by lectin blotting with succinyl wheat germ agglutinin (sWGA). This lectin is able to detect glycosylated SraP with approximately an eightfold-greater sensitivity than anti-SraP serum as assessed by dot blot analysis (data not shown). Protein extracts were prepared as described above, separated by electrophoresis, transferred to membranes, and blocked for 2 h with 1% gelatin in PBS. The membranes were then incubated with biotinylated sWGA, washed, and probed with streptavidin-horseradish peroxidase to detect glycoproteins by chemiluminescence.

Two-dimensional fluorescence difference gel electrophoresis (2D-DIGE). (i) Sample preparation and labeling.

Overnight cultures of bacteria were diluted 1:100 in TSB or RPMI and grown in a rotary shaker (270 rpm) at 37°C for 3 h. The cultures were centrifuged to pellet the bacteria, and the supernatants were clarified with a 0.45-μm-pore-size filter and supplemented with Complete protease inhibitors (Roche). The media were then concentrated by ultrafiltration (≥10-kDa retention cutoff; Millipore), and the protein concentration was determined. The proteins were then precipitated with trichloroacetic acid and suspended at a concentration of 3 mg/ml in 30 mM Tris-HCl (pH 8.8), 7 M urea, 2 M thiourea, and 4% CHAPS {3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}. A total of 30 μg of each sample preparation was labeled with 1.0 μl of 20 μM CyDye, incubated in the dark on ice for 30 min, and then quenched by adding 1.0 μl of 10 mM lysine. The Cy3- and Cy5-labeled samples were diluted to 250 μl by the addition of 2× 2D sample buffer (8 M urea, 4% CHAPS, 20 mg of dithiothreitol/ml, 2% pharmalytes, and a trace amount of bromophenol blue), 100 μl of destreak solution, and rehydration buffer (GE Biosciences).

(ii) Isoelectric focusing and SDS-PAGE.

Labeled samples were loaded into an immobilized pH gradient strip (pH range 3 to 10), and isoelectric focusing was performed in three steps (1 h at 500 V, followed by 1 h at 1,000 V and 2 h at 8,000 V) at 20°C in the dark. After focusing, the immobilized pH gradient strip was equilibrated according to the manufacturer's instructions, transferred onto an SDS gel (10.5% SDS gel prepared using low-fluorescence glass plates), and sealed with 0.5% (wt/vol) agarose solution (in SDS gel running buffer). The gel was run at 10 mA for 30 min, followed by 40 mA for 2.5 h.

(iii) Spot detection and analysis.

The gels were scanned analyzed by ImageQuant software (version 5.0; GE Healthcare), and the images were then subjected to in-gel analysis using DeCyder software (version 6.0; GE Healthcare). Protein spots of interest were chosen based on the intensity of the individual CyDye signals and the quality of the three-dimensional peak image. A 1.5-fold difference in normalized fluorescence intensity was considered significant and was the minimum intensity difference for spot selection. The selected protein spots were subjected to in-gel trypsin digestion, peptide extraction, and desalting, followed by MALDI-ToF/ToF analysis (Applied Biosystems). Peptides were analyzed by using MASCOT and the NCBInr database to identify the selected protein spots. 2D-DIGE and mass spectrometry identification of proteins of interest were performed by Applied Biomics, Inc. (Fremont, CA).

RESULTS

Mutagenesis of the accessory sec locus.

Isogenic variants of ISP479C containing disruptions in the secA2, secY2, or asp genes were generated by allelic replacement. As shown in Fig. 2, disruption of the accessory Sec pathway had no effect on growth of the mutants in vitro compared to the parent strain. To ensure that disruptions of the accessory Sec pathway did not alter secretion via the canonical Sec pathway, culture supernatants of the parent and mutant strains were compared by Western blotting for the levels of alpha-toxin secreted into the growth media. This protein was chosen because it has a typical signal sequence, indicating that it is exported via the canonical Sec system, and because it is predominantly secreted into the culture medium, making it a convenient indicator of Sec function. As shown in Fig. 3C, culture media from ISP479C and its isogenic mutants contained equivalent amounts of the toxin, indicating that these mutations do not affect export by the canonical Sec system. To ensure that there was no contamination of the culture media due to cellular leakage, the cytoplasm, membrane, and media from the wild type and mutants were tested for the presence of SecA. As shown in Fig. 3B, SecA was present in the cytoplasm and membrane fraction of all samples. However, it is completely absent from the medium fractions, indicating that the cells were not releasing cytoplasmic proteins due to leakage or cellular breakdown.

FIG. 2.

FIG. 2.

Growth of S. aureus ISP479C and isogenic mutants of the accessory Sec system. Overnight cultures of S. aureus were subcultured in TSB (top panel) or RPMI (bottom panel), and the growth of the organisms was monitored by determining the optical density.

FIG. 3.

FIG. 3.

Characterization of culture medium, membrane-associated, and cytoplasmic fractions. Lane 1, ISP479C; lane 2, PS767 (SraP−); lane 3, PS1167 (SecY2−); lane 4, PS1166 (SecA2−); lane 5, PS1257 (Asp1−), lane 6, PS1280 (Asp2−); lane 7, PS1249 (Asp3−). (A) GelCode stained SDS-PAGE; (B) Western blotting with anti-SecA sera; (C) Western blotting with anti-Hla sera. Arrows indicate the position of SecA in on the blots. Note that equivalent amounts of alpha-toxin are present in all culture samples.

Effects of accessory sec locus mutations on transcription in S. aureus.

To determine whether disruption of the accessory Sec pathway resulted in pleiotropic effects on S. aureus transcription, microarray analysis was performed on RNA extracted from ISP479C and the SecA2− variant (PS1166) during mid-logarithmic growth. Changes that might occur as a result of disrupting the Sec system include alteration of regulatory pathways (e.g., Agr and Sar), induction of stress responses, or other effects related to the normal physiological state (such as metabolic or uptake pathways) of the organism. Changes in transcription of ≥2-fold and an intensity level greater than 1 were considered relevant. Only 12 genes met these criteria (Table 2). Eight of the twelve were genes whose transcription was greater in the wild type relative to the SecA2 mutant PS1116, while four genes were transcribed preferentially in the mutant. Of note, no significant changes were seen in expression of genes encoding components of the Agr or Sar pathways, indicating that no major regulatory systems were perturbed by disruption of secA2 (Fig. 4). Moreover, no significant changes in transcription were observed that would indicate that mutation of the accessory Sec pathway adversely affects the cellular physiological state. Specifically, no stress responses (including DnaK related pathways) were observed, nor were any metabolic pathways (glycolytic, etc.) affected. However, disruption of secA2 was associated with a significant reduction (>2-fold) in the expression of two Ser-tRNAs.

TABLE 2.

Genes with differential expression in S. aureus wild type versus ΔsecA2 mutant

Open reading frame Fold changea Description of putative gene product function
N315-tRNA 6.081 tRNA
SAtRNA16 2.997 tRNA-Ser
SAtRNA19 2.993 tRNA-Ser
SAtRNA27 2.345 tRNA-Leu
COL-SA0178 2.089 Sucrose-specific PTS transporter protein
COL-SA0179 2.255 Transcriptional regulator (RpiR family)
COL-SA0651 3.090 Conserved hypothetical
COL-SA0930 2.652 Conserved hypothetical
COL-SA2173 2.397 Alkaline shock protein
COL-SA2323 2.043 Imidazolonepropionase
COL-SA2324 2.395 Urocanate hydratase
COL-SA2694 2.133 Lipase
COL-SA0205 -2.04 Pyruvate-formate lyase-activating enzyme
COL-SA1840 -2.19 Conserved hypothetical
COL-SA2039 -2.01 Putative acetyltransferase
COL-SA2655 -2.28 Arginine/ornithine antiporter
a

Wild type versus ΔsecA2 mutant.

FIG. 4.

FIG. 4.

Microarray analysis of ISP479C and an isogenic secA2 mutant. Scatter plot of probe intensities from Affymetrics wyeSaur2a microarrays for wild-type strain ISP479C and sec2A mutant PS1166. Points outside of the two outer diagonal lines represent a >2-fold difference in the probe intensities between the two strains. The identities of selected probes are indicated by their respective S. aureus COL gene designations and common names if applicable. No significant differences (P < 0.05) in gene expression were found between strains by analysis of variance using the Benjamini and Hochberg false discovery rate correction for multiple comparisons.

Secretion of SraP through the accessory Sec pathway.

To examine the role of the accessory Sec system in the transport of SraP, we examined the impact of individually disrupting the genes encoding this pathway on the presence of SraP in the cell wall. As shown in Fig. 5B (lanes 3 to 7), disruption of secA2, secY2 asp1, asp2, or asp3 resulted in a >90% decrease in SraP expression on the cell wall, as measured by quantitative Western blotting. To confirm that disruption of these genes nearly abolished SraP export and to assess the impact of these mutations on the glycosylation of SraP, we analyzed the cell wall extracts by lectin blotting with sWGA. Our previous studies have shown that this lectin can detect N-acetylglucosamine on members of this family of glycoproteins with high sensitivity (2). Dot blot analysis of cell wall extract from ISP479C showed that sWGA was eightfold more sensitive in detecting SraP than was anti-SraP serum (data not shown). When assessed by this method, disruption of secA2, secY2, or asp1-3 was again found to markedly reduce (but not abolish) SraP export (Fig. 5C). Of note, exported SraP still bound sWGA, and was unchanged in its apparent molecular weight, indicating that glycosylation of the preprotein was unaltered in the isogenic strains (and that these mutations were not polar). We also tested the other cellular fractions from the wild type and mutants for the presence of SraP, by blotting with either anti-SraP serum or sWGA (Fig. 6) . As expected, no SraP was detected in the SraP− mutant (PS767). In all of the accessory Sec mutants, SraP was present in the cytoplasmic and membrane fractions. Small amounts of SraP could also be detected in the culture medium, presumably reflecting cell wall turnover. Thus, it appears that components of the accessory Sec system are essential for the efficient transport of glycosylated SraP from the cytoplasm to the bacterial cell surface.

FIG. 5.

FIG. 5.

SraP from wild-type S. aureus ISP479C and isogenic accessory Sec pathway mutants. Lane 1, ISP479C; lane 2, PS767 (SraP−); lane 3, PS1167 (SecY2−); lane 4, PS1166 (SecA2−); lane 5, PS1257 (Asp1−); lane 6, PS1280 (Asp2−); lane 7, PS1249 (Asp3−). GelCode-stained SDS-polyacrylamide gel. (B) Western blot analysis of S. aureus cell wall and cytoplasmic protein extracts. SraP was detected using anti-SraP sera. (C) Lectin blot analysis of S. aureus cell wall and cytoplasmic protein extracts. Carbohydrate residues on SraP were detected using sWGA. Arrows indicate the position of SraP in on the blots.

FIG. 6.

FIG. 6.

SraP from wild-type S. aureus ISP479C and isogenic accessory Sec pathway mutants. Lane 1, ISP479C; lane 2, PS767 (SraP−); lane 3, PS1167 (SecY2−); lane 4, PS1166 (SecA2−); lane 5, PS1257 (Asp1−); lane 6, PS1280 (Asp2−); lane 7, PS1249 (Asp3−). GelCode-stained polyacrylamide gel. (B) Western blot analysis of proteins from the spent media and membrane fraction of S. aureus. SraP was detected using anti-SraP sera. (C) Lectin blot analysis of S. aureus media and membrane protein extracts. Carbohydrate residues on SraP were detected using sWGA. Arrows indicate the position of SraP in the blots.

Secretion of extracellular proteins through the accessory Sec pathway.

To assess whether the accessory Sec system of S. aureus has broad substrate specificity, we examined the secreted proteome of ISP479C and its SecA2− variant, PS1166, using 2D-DIGE. This method is able to reveal differences in complex protein mixtures with a high degree of sensitivity based on separation of differentially labeled protein sample on a single 2D gel (29). The supernatants from three independent log-phase cultures of each strain were evaluated in parallel. Two were prepared from culture media of bacteria grown in TSB (Fig. 7A, panels 1 and 2). Since samples generated from cultures grown in TSB can have high background fluorescence (P. Dunman, unpublished data), a third pair of samples was obtained from bacteria grown in RPMI (Fig. 7A, panel 3). In all, 41 proteins in at least one of the three replicate samples showed detectable differences in levels of expression (1.5-fold change in normalized fluorescence intensity), when media from ISP479C and PS1166 were compared. However, only nine of these proteins were detected in more than one sample pair. Of the nine proteins that were identified in multiple samples, only two proteins consistently differed in their levels of expression. Supernatants from ISP479C contained higher levels of a predicted lipase (accession gi 49245892) compared to PS1166 (Fig. 7B, row a). Interestingly, microarray analysis showed a 2.13-fold greater transcription of the gene encoding the lipase in the wild type relative to the secA2 mutant. The second protein that consistently demonstrated differential expression was an N-acetylmuramoyl-l-alanine amidase domain protein (accession gi 57652384). It was enriched in the SecA2 mutant cultures (Fig. 7B, row b), and thus it is unlikely to be a direct substrate for the accessory Sec system. Thus, it appears that the accessory Sec pathway in S. aureus is dedicated to the transport of SraP exclusively.

FIG. 7.

FIG. 7.

Secreted proteins from S. aureus culture. (A) Wild-type S. aureus ISP479C and PS1166, an isogenic secA2 mutant, were grown for 3 h in either TSB (panels 1 and 2) or RPMI (panel 3), and the culture media were analyzed by 2D-DIGE. Proteins from the wild-type culture media were labeled with Cy3 (green), while proteins from the mutant were labeled with Cy5 (red). Boxes indicate protein spots that are consistently enriched in one of the samples. (B) The boxed areas described in panel A are magnified, and the individual fluorescent channels are displayed. (Row a) A lipase was enriched in culture medium samples from wild-type S. aureus. (Row b) An N-acetylmuramoyl-l-alanine amidase domain protein was enriched in culture medium from the secA2 mutant. Arrowheads indicate the relevant protein spots for comparison.

DISCUSSION

Although the accessory Sec locus of S. aureus resembles that of S. gordonii, there are a number of key differences that may affect the function of this export pathway. First, the signal peptide of GspB contains three glycine residues in the hydrophobic region that impede the recognition of the protein by the canonical Sec pathway (3). The SraP signal peptide contains only two glycines, and their position is also changed relative to that of GspB, which could render SraP more amenable to export by the canonic pathway. Second, SraP has a pI that is acidic, while GspB is more basic in nature. The overall difference in charge may affect how the proteins interact with the accessory Sec system. Third, the staphylococcal locus lacks two genes, gly and nss, that are important for the glycosylation of GspB (27). When gly or nss were deleted in S. gordonii, GspB was shown to be differentially glycosylated by high-pH anion-exchange chromatography combined with pulsed amperometric detection. Since S. aureus lacks these two enzymes, it is likely that SraP is glycosylated differently or less extensively than GspB. Since glycosylation is one of the main barriers for GspB export by the canonical pathway, altered or reduced glycosylation of SraP may also render it a more suitable substrate for canonical transport. Finally, S. aureus also lacks Asp4 and Asp5, which may be integral membrane proteins and thus part of the accessory Sec translocon of S. gordonii. The absence of these proteins in S. aureus suggests that its accessory Sec translocon could have a different, and perhaps more permissive, substrate specificity compared to S. gordonii. For these reasons, we examined whether the key features of the accessory Sec system in S. gordonii were conserved in S. aureus.

Mutagenesis of any of the accessory sec genes generated strains that had no apparent growth defects, indicating that these genes were not essential for viability. The individual mutants also displayed an export defect that resulted in a loss of SraP expression on the cell surface when assessed by Western blotting. Of note, when export was assessed by lectin blotting, a small amount of SraP was present on the cell surface. Thus, it would appear that the accessory Sec system is largely essential for the export of SraP. However, since small quantities of the SraP can still be exported in the absence of a functional accessory Sec system, the glycoprotein may be transported with very poor efficiency by the canonical Sec system. Alternatively, some components of the canonical system may be able to substitute functionally for missing members of the accessory Sec system, thereby permitting limited secretion through the accessory Sec pathway. However, the minimal amount of SraP that is present on the surface of S. aureus in the accessory Sec mutants would indicate that such substitution is at best very inefficient.

As discussed above, the accessory Sec locus of S. aureus lacks four genes found in S. gordonii, suggesting that the staphylococcal accessory Sec system could be less restrictive in its substrate specificity. In fact, the accessory Sec-related secretomes in most gram-positive organisms have yet to be studied extensively. To assess this issue more definitely, we used 2D-DIGE to identify substrates of the accessory Sec system. This method is able to reveal differences in complex protein mixtures with a high degree of sensitivity based on separation of differentially labeled protein samples on a single 2D gel. When the secreted proteome of wild-type S. aureus was compared to that of its isogenic SecA2 mutant, only two changes in the protein content were detected after repeated testing. The samples differed in the amount of a lipase and an amidase that were secreted by the two strains. However, the lipase also showed differential expression when assessed by microarray analysis, and thus various amounts in the secreted samples may be due to differences in transcription rather than transport. The amidase was enriched in the SecA2 mutant samples for unknown reasons, but it is unlikely to be a substrate for the accessory Sec system. Thus, it appears that this pathway is dedicated to a single substrate, SraP.

Since all of the conserved components of the accessory Sec system are essential for the efficient export of SraP, the differences between the SraP and GspB loci may provide a clearer explanation as to why small amounts of SraP are secreted when individual components of the accessory Sec locus are disrupted. As mentioned earlier, the absence of Gly and Nss in S. aureus may render SraP less extensively or differentially glycosylated than GspB. Since glycosylation is the key structural feature of mature GspB that hinders its export by the canonical Sec system, the less extensive glycosylation of SraP may make it more amenable to export by this pathway. These differences in glycosylation may also explain why Asp4 and Asp5 are not required for SraP export by the accessory Sec system. It is possible that SecY2 alone or in concert with the canonical SecE and SecG may be sufficient for the formation of the translocation channel. Thus, a combination of differential glycosylation and a distinct conformation of the translocon may define the selectivity of the accessory Sec pathway in S. aureus. Future studies assessing the importance of glycosylation and translocon structure in S. aureus may reveal how the SraP substrate is adapted for export by its accessory Sec system and provide further insight into the nature of secretion in bacteria.

Acknowledgments

This study was supported by the Department of Veterans Affairs and by grants R01 AI041513 and R01 AI057433 (to P.M.S.) and HL073996 (to C.E.R.) from the National Institutes of Health.

We thank Barbara Bensing, Ravin Seepersaud, and Jennifer Mitchell for their helpful scientific and editorial suggestions.

Footnotes

▿

Published ahead of print on 11 July 2008.

REFERENCES

  • 1.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1997. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, NY.
  • 2.Bensing, B. A., B. W. Gibson, and P. M. Sullam. 2004. The Streptococcus gordonii platelet binding protein GspB undergoes glycosylation independently of export. J. Bacteriol. 186638-645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bensing, B. A., I. R. Siboo, and P. M. Sullam. 2007. Glycine residues in the hydrophobic core of the GspB signal sequence route export toward the accessory Sec pathway. J. Bacteriol. 1893846-3854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bensing, B. A., and P. M. Sullam. 2002. An accessory sec locus of Streptococcus gordonii is required for export of the surface protein GspB and for normal levels of binding to human platelets. Mol. Microbiol. 441081-1094. [DOI] [PubMed] [Google Scholar]
  • 5.Dunman, P. M., W. Mounts, F. McAleese, F. Immermann, D. Macapagal, E. Marsilio, L. McDougal, F. C. Tenover, P. A. Bradford, P. J. Petersen, S. J. Projan, and E. Murphy. 2004. Uses of Staphylococcus aureus GeneChips in genotyping and genetic composition analysis. J. Clin. Microbiol. 424275-4283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Durack, D. T. 1975. Experimental bacterial endocarditis. IV. Structure and evolution of very early lesions. J. Pathol. 11581-89. [DOI] [PubMed] [Google Scholar]
  • 7.Fitzgerald, J. R., T. J. Foster, and D. Cox. 2006. The interaction of bacterial pathogens with platelets. Nat. Rev. Microbiol. 4445-457. [DOI] [PubMed] [Google Scholar]
  • 8.Fitzgerald, J. R., A. Loughman, F. Keane, M. Brennan, M. Knobel, J. Higgins, L. Visai, P. Speziale, D. Cox, and T. J. Foster. 2006. Fibronectin-binding proteins of Staphylococcus aureus mediate activation of human platelets via fibrinogen and fibronectin bridges to integrin GPIIb/IIIa and IgG binding to the FcγRIIa receptor. Mol. Microbiol. 59212-230. [DOI] [PubMed] [Google Scholar]
  • 9.Gong, K., D. Y. Wen, T. Ouyang, A. T. Rao, and M. C. Herzberg. 1995. Platelet receptors for the Streptococcus sanguis adhesin and aggregation-associated antigens are distinguished by anti-idiotypical monoclonal antibodies. Infect. Immun. 633628-3633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Greene, C., D. McDevitt, P. Francois, P. E. Vaudaux, D. P. Lew, and T. J. Foster. 1995. Adhesion properties of mutants of Staphylococcus aureus defective in fibronectin-binding proteins and studies on the expression of fnb genes. Mol. Microbiol. 171143-1152. [DOI] [PubMed] [Google Scholar]
  • 11.Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166557-580. [DOI] [PubMed] [Google Scholar]
  • 12.Handley, P. S., F. F. Correia, K. Russell, B. Rosan, and J. M. DiRienzo. 2005. Association of a novel high molecular weight, serine-rich protein (SrpA) with fibril-mediated adhesion of the oral biofilm bacterium Streptococcus cristatus. Oral Microbiol. Immunol. 20131-140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Heilmann, C., S. Niemann, B. Sinha, M. Herrmann, B. E. Kehrel, and G. Peters. 2004. Staphylococcus aureus fibronectin-binding protein (FnBP)-mediated adherence to platelets, and aggregation of platelets induced by FnBPA but not by FnBPB. J. Infect. Dis. 190321-329. [DOI] [PubMed] [Google Scholar]
  • 14.Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O'Reilly, P. M. Schlievert, M. S. Bergdoll, and R. P. Novick. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305709-712. [DOI] [PubMed] [Google Scholar]
  • 15.Nguyen, T., B. Ghebrehiwet, and E. I. Peerschke. 2000. Staphylococcus aureus protein A recognizes platelet gC1qR/p33: a novel mechanism for staphylococcal interactions with platelets. Infect. Immun. 682061-2068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Obert, C., J. Sublett, D. Kaushal, E. Hinojosa, T. Barton, E. I. Tuomanen, and C. J. Orihuela. 2006. Identification of a candidate Streptococcus pneumoniae core genome and regions of diversity correlated with invasive pneumococcal disease. Infect. Immun. 744766-4777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.O'Brien, L., S. W. Kerrigan, G. Kaw, M. Hogan, J. Penades, D. Litt, D. J. Fitzgerald, T. J. Foster, and D. Cox. 2002. Multiple mechanisms for the activation of human platelet aggregation by Staphylococcus aureus: roles for the clumping factors ClfA and ClfB, the serine-aspartate repeat protein SdrE and protein A. Mol. Microbiol. 441033-1044. [DOI] [PubMed] [Google Scholar]
  • 18.Pattee, P. A. 1981. Distribution of Tn551 insertion sites responsible for auxotrophy on the Staphylococcus aureus chromosome. J. Bacteriol. 145479-488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Plummer, C., H. Wu, S. W. Kerrigan, G. Meade, D. Cox, and C. W. Ian Douglas. 2005. A serine-rich glycoprotein of Streptococcus sanguis mediates adhesion to platelets via GPIb. Br. J. Hematol 129101-109. [DOI] [PubMed] [Google Scholar]
  • 20.Seifert, K. N., E. E. Adderson, A. A. Whiting, J. F. Bohnsack, P. J. Crowley, and L. J. Brady. 2006. A unique serine-rich repeat protein (Srr-2) and novel surface antigen (epsilon) associated with a virulent lineage of serotype III Streptococcus agalactiae. Microbiology 1521029-1040. [DOI] [PubMed] [Google Scholar]
  • 21.Siboo, I. R., H. F. Chambers, and P. M. Sullam. 2005. Role of SraP, a serine-rich surface protein of Staphylococcus aureus, in binding to human platelets. Infect. Immun. 732273-2280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Siboo, I. R., A. L. Cheung, A. S. Bayer, and P. M. Sullam. 2001. Clumping factor A mediates binding of Staphylococcus aureus to human platelets. Infect. Immun. 693120-3127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sullam, P. M. 1994. Host-pathogen interactions in the development of bacterial endocarditis. Curr. Opin. Infect. Dis. 4304-309. [Google Scholar]
  • 24.Sullam, P. M., D. G. Payan, P. F. Dazin, and F. H. Valone. 1990. Binding of viridans group streptococci to human platelets: a quantitative analysis. Infect. Immun. 583802-3806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Takahashi, Y., K. Konishi, J. O. Cisar, and M. Yoshikawa. 2002. Identification and characterization of hsa, the gene encoding the sialic acid-binding adhesin of Streptococcus gordonii DL1. Infect. Immun. 701209-1218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Takamatsu, D., B. A. Bensing, and P. M. Sullam. 2004. Four proteins encoded in the gspB-secY2A2 operon of Streptococcus gordonii mediate the intracellular glycosylation of the platelet-binding protein GspB. J. Bacteriol. 1867100-7111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Takamatsu, D., B. A. Bensing, and P. M. Sullam. 2004. Genes in the accessory sec locus of Streptococcus gordonii have three functionally distinct effects on the expression of the platelet-binding protein GspB. Mol. Microbiol. 52189-203. [DOI] [PubMed] [Google Scholar]
  • 28.Takamatsu, D., B. A. Bensing, and P. M. Sullam. 2005. Two additional components of the accessory sec system mediating export of the Streptococcus gordonii platelet-binding protein GspB. J. Bacteriol. 1873878-3883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Unlu, M., M. E. Morgan, and J. S. Minden. 1997. Difference gel electrophoresis: a single gel method for detecting changes in protein extracts. Electrophoresis 182071-2077. [DOI] [PubMed] [Google Scholar]
  • 30.Wu, H., and P. M. Fives-Taylor. 1999. Identification of dipeptide repeats and a cell wall sorting signal in the fimbriae-associated adhesin, Fap1, of Streptococcus parasanguis. Mol. Microbiol. 341070-1081. [DOI] [PubMed] [Google Scholar]
  • 31.Yeaman, M. R., P. M. Sullam, P. F. Dazin, D. C. Norman, and A. S. Bayer. 1992. Characterization of Staphylococcus aureus-platelet binding by quantitative flow cytometric analysis. J. Infect. Dis. 16665-73. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES