Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2008 Aug 1;74(18):5769–5775. doi: 10.1128/AEM.00468-08

Engineering of an Escherichia coli Strain for the Production of 3-Methyl-1-Butanol▿

Michael R Connor 1, James C Liao 1,*
PMCID: PMC2547049  PMID: 18676713

Abstract

3-Methyl-1-butanol is a potential fuel additive or substitute. Previously this compound was identified in small quantities in yeast fermentation as one of the fusel alcohols. In this work, we engineered an Escherichia coli strain to produce 3-methyl-1-butanol from glucose via the host's amino acid biosynthetic pathways. Strain improvement with the removal of feedback inhibition and competing pathways increased the selectivity and productivity of 3-methyl-1-butanol. This work demonstrates the feasibility of production of 3-methyl-1-butanol as a biofuel and shows promise in using E. coli as a host for production.


Energy and environmental concerns have resulted in an increased interest in the production of alternative fuels from renewable sources. The primary focus of such research thus far has been on the production of bioethanol, with more than 4.8 billion gallons being produced in the United States in 2006 (22). Ethanol, however, cannot completely replace existing petroleum-based fuels, since the high vapor pressure and water content may present problems in engine performance and the supply infrastructure of the current fuel economy. The use of longer-chain alcohols can compensate for some of these issues. Five-carbon alcohols, such as 3-methyl-1-butanol, possess properties that can increase the potential for a biomass-derived replacement for gasoline. With a vapor pressure more than 20-fold lower than that of ethanol and an energy density calculated from the heat of combustion (16) that is more than 80% (28.2 MJ/liter) of that of gasoline (34.8 MJ/liter) (10), 3-methyl-1-butanol can offer advantages over ethanol as a supplement to or replacement for gasoline.

3-Methyl-1-butanol is a natural, although minor, product in fungus and yeast fermentation. Recent work with yeast has focused on identifying gene targets, mutations, and pathways for increased 3-methyl-1-butanol production (1, 11, 21). 3-Methyl-1-butanol is also used as a precursor for synthesis of various chemicals, such as isoamyl acetate, which has been successfully produced from 3-methyl-1-butanol in Escherichia coli (15, 23). Fusel oil, a by-product of ethanol distillation which contains a fraction of 3-methyl-1-butanol, has also been shown to be an effective substrate for the biocatalysis of triolein to biodiesel (20). With a wide variety of uses and its potential role as a fuel, the development of a process for the production of 3-methyl-1-butanol is desirable. Here we demonstrate the first design for the production of 3-methyl-1-butanol in Escherichia coli from glucose.

Our laboratory has previously shown that 2-keto acids generated from amino acid biosynthesis can serve as precursors for the Ehrlich degradation pathway to alcohols (4). In order to produce 3-methyl-1-butanol, the valine and leucine biosynthesis pathways can be used to generate 2-ketoisocaproate (KIC), the precursor to leucine. KIC can then be converted to 3-methyl-1-butanol via a decarboxylation and reduction step. The entire pathway to 3-methyl-1-butanol from glucose is diagrammed in Fig. 1.

FIG. 1.

FIG. 1.

Metabolic pathway from glucose to 3-methyl-1-butanol. All genes are from E. coli unless otherwise noted. BS, B. subtilis; LL, L. lactis; SC, S. cerevisiae.

MATERIALS AND METHODS

Bacterial strains, media, and growth conditions.

JCL16 (rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78/F′ [traD36 proAB+ lacIqZΔM15]) was used as the wild type (WT) (3). XL-1 Blue (Stratagene, La Jolla, CA) was used to propagate all plasmids.

For initial production experiments, strains were grown in a modified M9 medium (6 g Na2HPO4, 3 g KH2PO4, 1 g NH4Cl, 0.5 g NaCl, 1 mM MgSO4, 1 mM CaCl2, 10 mg vitamin B1 per liter of water) containing 20 g/liter of glucose, 5 g/liter of yeast extract, and 1,000× Trace Metals Mix A5 (2.86 g H3BO3, 1.81 g MnCl2 · 4H2O, 0.222 g ZnSO4 · 7H2O, 0.39 g Na2MoO4 · 2H2O, 0.079 g CuSO4 · 5H2O, 49.4 mg Co(NO3)2 · 6H2O per liter water), inoculated at 1% from 3 ml overnight cultures in LB into 10 ml of fresh medium in 125-ml screw-cap flasks, and grown at 37°C in a rotary shaker for 4 h. The culture was then induced with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) and grown at 30°C for 18 h. Antibiotics were added as needed (ampicillin, 100 μg/ml; chloroamphenicol, 35 μg/ml; kanamycin, 50 μg/ml).

For 2-keto acid experiments, 10-ml cultures in 250-ml baffled shake flasks were inoculated at 1% from 3-ml overnight cultures in LB. All cultures were grown at 37°C for 4 h, induced with 1 mM IPTG, and harvested after 18 h of growth at 30°C.

Time course production experiments were conducted as previously described, except that 20 ml modified M9 medium containing 5 g/liter of glucose and 5 g/liter of yeast extract was used in a 250-ml screw-cap flask. The final production experiment (see Fig. 5) was conducted as were the previous experiments except that the medium contained 10 g/liter of glucose at the start. To quantify the 3-methyl-1-butanol produced from yeast extract alone, cultures were induced with 1 mM IPTG and grown at 30°C for 24 h after 4 h of growth at 37°C in modified M9 medium containing 5 g/liter of yeast extract with and without 10 g/liter of glucose.

FIG. 5.

FIG. 5.

Increased production of 3-methyl-1-butanol. Growth and alcohol production were quantified for JCL260 ΔilvE ΔtyrB/pIAA11/pIAA13/pIAA16 after 24 h of induction at 30°C. OD600, optical density at 600 nm.

Reagents.

All restriction enzymes and Antarctic phosphatase were purchased from New England Biolabs (Ipswich, MA). The Rapid DNA ligation kit was supplied by Roche (Manheim, Germany). KOD DNA polymerase was purchased from EMD Chemicals (San Diego, CA). Oligonucleotides were ordered from Invitrogen (Carlsbad, CA).

DNA techniques.

E. coli strain JCL260 was constructed as described previously (3). Branched-chain-amino-acid aminotransferase (encoded by ilvE) and tyrosine aminotransferase (encoded by tyrB) were deleted by P1 transduction from strains JW5606 and JW4014 (5), respectively. All strains and plasmids are listed in Table 1. Oligonucleotides are listed in Table 2.

TABLE 1.

Strains and plasmids used in this work

Strain or plasmid Relevant genotypea Reference or source
Strains
    XL-1 Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB laclqZΔM15 Tn10 (Tetr)] Stratagene
    JCL16 BW25113/F′ [traD36 proAB+laclqZΔM15] 3
    JCL260 As JCL16, but ΔadhE ΔldhA ΔfrdBC Δfnr Δpta ΔpflB 3
    IAA6 As JCL260, but ΔilvE This study
    IAA10 As JCL16, with PlacO-1 integrated upstream of leuABCD This study
    IAA69 As JCL260, but ΔilvE ΔtyrB This study
Plasmids
    pZS24-MCS1 pSC101 ori; Kanr; Plac-ara-1:MCS1 17
    pSA54 p15A ori; Kanr; PLlacO-1:ilvIHCD (EC) 4
    pSA55 ColE1 ori; Ampr; PLlacO-1:kivd (LL)-ADH2 (SC) 4
    pSA69 p15A ori; Kanr; PLlacO-1:alsS (BS)-ilvCD (EC) 4
    pIAA1 pSC101 ori; Kanr; PLlacO-1:ilvIHCD (EC) This study
    pIAA2 p15A ori; Cmr; PLlacO-1:leuABCD (EC) This study
    pIAA11 pSC101 ori; Kanr; PLlacO-1:alsS (BS)-ilvCD (EC) This study
    pIAA12 ColE1 ori; Ampr; PLlacO-1:kivd (LL)-ADH2 (SC); PAmp:bla-lacl (EC) This study
    pIAA13 p15A ori; Ampr; PLlacO-1:kivd (LL)-ADH2 (SC) This study
    pIAA15 ColE1 ori; Cmr; PLlacO-1:leuABCD (EC); PCm:cat-lacl (EC) This study
    pIAA16 ColE1 ori; Cmr; PLlacO-1:leuA(syn RBS)-leuBCD (EC); PCm:cat-lacl (EC) This study
    pIAA17 ColE1 ori; Cmr; PLlacO-1:leuA (G462D)-leuBCD (EC); PCm:cat-lacl (EC) This study
a

EC, E. coli; SC, S. cerevisiae; BS, Bacillus subtilis; LL, Lactococcus lactis.

TABLE 2.

Primers used in this work

Name Sequence (5′→3′)
KanLeuO1f TTCCATCCACTGATGGCCTTTATCGCGCCCTGTAGGCTGGAGCTGCTTCG
KanLeuO2f TTAGCGTTTGCAAATTGAGACTAATTGCTCTTCCATCCACTGATGGCCTTTA
KanlacO1SOEr GGCCTCGTGATACGCCTATTATTCCGGGGATCCGTCGACC
lacO1KanSOEf GGTCGACGGATCCCCGGAATAATAGGCGTATCACGAGGCCCT
lacO1LeuA1r GCTGGCTCATGGTTTGGGTCCTTGTCTCTTGGTCAGTGCGTCCTGCTGATGT
lacO1LeuA2r CGCGCAATGTGGTATCGAAAATAATGACTTGCTGGCTCATGGTTTGGGTCCT
leuKOv1 GCAATGTGGTATCGAAAATAATGAC
leuKOv2 CCAGACATTCATGTCTGACCTATTC
laclSaclf CTAGAGCTCGAAGGAGATATACCATGAAACCAGTAACGTTATACGATG
laclSaclr CTAGAGCTCTCACTGCCCGCTTTCCAGTC

To clone the valine biosynthesis genes ilvIHCD (E. coli) and alsS (Bacillus subtilis), along with ilvCD (E. coli), the low-copy-number origin of replication (ori) from pZS24-MCS1 (17) was removed by digestion with SacI and AvrII and then ligated into the corresponding sites of pSA54 and pSA69 to create plasmids pIAA1 and pIAA11, respectively.

To clone kivd from Lactococcus lactis and ADH2 from Saccharomyces cerevisiae, the ColE1 ori of pSA55 was removed by digestion with SacI and AvrII and replaced with the p15A ori of pSA54 digested with the same restriction enzymes to create pIAA13. To better control the expression of these genes, lacI was amplified from E. coli MG1655 genomic DNA with KOD polymerase using the primers lacISacIf and lacISacIr and ligated into the SacI site of pSA55 to be expressed along with the ampicillin resistance gene, bla, creating plasmid pIAA12.

In order to overexpress the leuABCD operon in JCL16 from the chromosome, the native promoter and leader sequence was replaced with the PLlacO-1 promoter (17). The PLlacO-1 promoter was amplified from pZE12-luc (17) with KOD polymerase using the primers lacO1KanSOEf and lacO1LeuA1r. The gene encoding resistance to kanamycin, aph, was amplified from pKD13 (9) using the primers KanLeuO1f and KanlacO1SOEr. One microliter of product from each reaction was added as a template, along with primers KanLeuO2f and lacO1LeuA2r, and was amplified with KOD polymerase using SOE. The PCR product was electroporated and integrated into the chromosome using the phage λ Red recombinase as described previously (9). The new construct was amplified from the genomic DNA of kanamycin-resistant clones using the primers leuKOv1 and leuKOv2 and sent out for sequence verification to confirm the accuracy of cloning.

To overexpress the leuABCD operon from a plasmid, the p15A ori from pSA54 was removed with SacI and AvrII and ligated into the corresponding sites of pCS22 (ColE1, Cmr, PLlacO-1: leuABCD) to create plasmid pIAA2. In order for tighter expression, lacI was amplified and ligated, as described previously for pIAA12, into pCS22 to be expressed along with the chloroamphenicol resistance gene, cat, creating plasmid pIAA15. Plasmid pIAA16, containing leuAFBR [leuA(G1385A)] encoding IPMS(G462D), was created by ligating the 5.5-kb fragment of pIAA15 digested with XhoI and NdeI and ligating it with the 2.3-kb fragment of pZE12-leuABCD [ColE1, Ampr, PLlacO-1: leuA(G1385A)BCD] cut with the same restriction enzymes. To control for the expression level, the ribosome binding site (RBS) was replaced in pIAA15 to match that of pIAA16. To do this, the 5.6-kb fragment of pIAA16 from digestion with HindIII and NdeI was ligated with the 2.2-kb fragment of pIAA15 digested with the same enzymes to create pIAA17.

Detection of metabolites.

The produced alcohol compounds were quantified by a gas chromatograph (GC) equipped with a flame ionization detector. The system consisted of model 5890A GC (Hewlett-Packard, Avondale, PA) and a model 7673A automatic injector, sampler, and controller (Hewlett-Packard). The separation of alcohol compounds was carried out using a DB-WAX capillary column (30 m, 0.32 mm-inside diameter, 0.50-μm film thickness) purchased from Agilent Technologies (Santa Clara, CA). The GC oven temperature was initially held at 40°C for 5 min and raised with a gradient of 15°C/min until reaching 120°C. It was then raised with a gradient of 50°C/min until 230°C and held for 4 min. Helium was used as the carrier gas, with 9.3-lb/in2 inlet pressure. The injector and detector were maintained at 225°C. Supernatant of culture broth (0.5 μl) was injected in split injection mode with a 1:15 split ratio. Methanol or butanol was used as the internal standard.

For other secreted metabolites, filtered supernatant was applied (20 μl) to an Agilent 1100 high-performance liquid chromatography system equipped with an auto-sampler and a Bio-Rad (Hercules, CA) Aminex HPX87 column (5 mM H2SO4, 0.6 ml/min; column temperature at 65°C). Glucose was detected with a refractive index detector, while organic acids were detected using a photodiode array detector at 210 nm. Concentrations were determined by extrapolation from standard curves.

RESULTS

Expression of valine and leucine biosynthesis pathway genes leads to 3-methyl-1-butanol production.

To produce 3-methyl-1-butanol in E. coli, the entire pathway from pyruvate to 3-methyl-1-butanol was overexpressed. ilvIHCD (E. coli), kivd (L. lactis), and ADH2 (S. cerevisiae) were all expressed from plasmids (pIAA1 and pIAA12) under the control of the PLlacO-1 promoter (17). The leuABCD operon was overexpressed by replacing the upstream noncoding region of leuA with the PLlacO-1 promoter in JCL16 (WT) (See Materials and Methods). This strain was able to produce 56 mg/liter of 3-methyl-1-butanol after 18 h of induction with IPTG (Fig. 2A). In order to increase production of 3-methyl-1-butanol, ilvIH was replaced with alsS (pIAA11) from B. subtilis. Acetolactate synthase from B. subtilis, encoded by alsS, has previously been shown to increase isobutanol production (4), which uses the valine synthesis pathway. The replacement of ilvIH with alsS showed a minimal increase in 3-methyl-1-butanol production (67 mg/liter) (Fig. 2A). To increase the production of 3-methyl-1-butanol, leuABCD was cloned into a p15A-derived plasmid and expressed under the control of the PLlacO-1 promoter. Plasmid-based expression of the leucine biosynthesis genes increased 3-methyl-1-butanol production for strains containing either ilvIH or alsS (Fig. 2A), although overexpression of alsS lead to a dramatic increase in isobutanol production.

FIG. 2.

FIG. 2.

Initial production of 3-methyl-1-butanol. Checkered columns indicate isobutanol; solid columns are for 3-methyl-1-butanol. “OE” indicates overexpression. (A) 3-Methyl-1-butanol production in JCL16. Strains carrying either ilvIH (pIAA1) or alsS (pIAA11) along with kivd and ADH2 (pIAA12) with chromosomal or plasmid-based expression of leuABCD (IAA10 and pIAA2, respectively) were assayed for alcohol production. (B) 3-Methyl-1-butanol production in JCL260. Strains carrying either ilvIH (JCL260/pIAA1/pIAA2/pIAA12) or alsS (JCL260/pIAA2/pIAA11/pIAA12) were tested for alcohol production.

Deletion of native competing pathways to increase 3-methyl-1-butanol production.

Similar to strategies employed previously for fuel production (3, 4), host pathways competing for carbon and reducing power were deleted. Our laboratory has shown previously that deletion of adhE, frdBC, ldhA, pta, fnr, and pflB significantly increased production of isobutanol in E. coli relative to a WT background (4). When the 3-methyl-1-butanol pathway was transformed into this strain, the final titer of 3-methyl-1-butanol was 76 mg/liter for the strain expressing alsS (Fig. 2B). Since the isobutanol titer was greater than 10 times that of the target product, the process and metabolic pathway were examined to improve the production of 3-methyl-1-butanol.

Production of 2-keto acid precursors to determine pathway bottleneck.

We hypothesized that isobutanol production was much higher than 3-methyl-1-butanol production due to competition of the substrate 2-ketoisovalerate (KIV) between the gene products of kivd and leuA. In order to investigate this hypothesis, the production of the 2-keto acid precursors was examined. To achieve this, leuABCD was expressed on a ColE1-derived plasmid along with alsS-ilvCD under the control of PLlacO-1. When this strain was tested, the isobutanol precursor and leuA substrate, KIV, was the main product (Fig. 3A). KIV was produced to a final concentration of 0.29 g/liter, while the 3-methyl-1-butanol precursor, KIC, was not detected (<5 mg/liter). In hopes of increasing the KIC pool, the RBS of the leuA gene was changed from its native sequence to more of a consensus sequence (see Materials and Methods). The use of the synthetic RBS increased the KIC concentration to 0.19 g/liter, although KIV was still the main product (0.37 g/liter) (Fig. 3A). This result suggests that the decreased 3-methyl-1-butanol production was not due completely to competition for KIV but rather was related to the low activity of the leuA gene product (2-isopropylmalate synthase [IPMS]).

FIG. 3.

FIG. 3.

Investigation of 2-keto acid production. Checkered columns indicate KIV; solid columns are for KIC. “OE” indicates overexpression. (A) Production of 2-keto acids in JCL260 background. Strains were tested for production of KIV (isobutanol) and KIC (3-methyl-1-butanol) using alsS-ilvCD (pIAA11) and WT leuABCD with a natural (pIAA15) or synthetic (pIAA17) RBS or leuAFBRBCD (pIAA16). The RBS change is for the leuA gene only. OD600, optical density at 600 nm. (B) Production of 2-keto acids in leucine synthesis knockout backgrounds. The “Δ” symbol indicates deletion. ilvE encodes branched-chain-amino-acid aminotransferase, and tyrB encodes tyrosine aminotransferase.

IPMS catalyzes the condensation of KIV with acetyl-coenzyme A. The accumulation of KIV could be due to feedback inhibition of IPMS by free leucine synthesized from KIC. To relieve the feedback inhibition of IPMS, two strategies were investigated. First, we employed a feedback-insensitive mutant of IPMS [IPMS(G462D)] (13), encoded by leuAFBR. Second, the final step in the leucine synthesis pathway was inactivated by deleting ilvE (branched-chain-amino-acid transferase) and tyrB (tyrosine aminotransferase), two isozymes responsible for converting KIC into leucine.

When leuAFBR was expressed, the product distribution dramatically shifted toward KIC, with a final concentration of 1.61 g/liter, while KIV accumulation decreased to 0.17 g/liter (Fig. 3A). Inactivation of ilvE increased production of KIC in the strain expressing WT leuA with the synthetic RBS, while deletion of ilvE and tyrB further increased accumulation of KIC to 1.23 g/liter (Fig. 3B). The production of KIV in the JCL260 ΔilvE and JCL260 ΔilvE ΔtyrB backgrounds remained similar to that of the JCL260 ilvE+ tyrB+ strain, with final concentrations of 0.40 g/liter and 0.37 g/liter, respectively. When the ΔilvE and ΔilvE ΔtyrB host strains were combined with the expression of leuAFBR, KIC increased to 2.31 g/liter and 1.95 g/liter, respectively (Fig. 3B).

Production of 3-methyl-1-butanol.

With an increased production of KIC, the entire pathway for 3-methyl-1-butanol production from pyruvate was transformed using either WT leuA or leuAFBR. Similar to the results seen for keto-acid production, the strain expressing WT leuA still produced a significant amount of isobutanol (168 mg/liter) in a JCL260 ilvE+ tyrB+ background, although 3-methyl-1-butanol was the main product (286 mg/liter) (Fig. 4). As expected, when leuAFBR was expressed in the JCL260 ilvE+ tyrB+ background, 3-methyl-1-butanol was the main product, with a final titer of 425 mg/liter, with isobutanol accumulating to only 15 mg/liter (Fig. 4). The removal of feedback inhibition of IPMS by mutation changed the product distribution from 1.7:1 (3-methyl-1-butanol:isobutanol) using WT leuA to greater than 28:1. Accumulation of other common metabolic by-products including acetate and succinate is shown in Table 3.

FIG. 4.

FIG. 4.

3-Methyl-1-butanol production with removal of feedback inhibition. Growth and alcohol production were compared for strains overexpressing WT leuA and leuAFBR in JCL260 and JCL260 ΔilvE ΔtyrB backgrounds after 12 h of induction at 30°C. OD600, optical density at 600 nm.

TABLE 3.

Metabolic by-products of 3-methyl-1-butanol-producing strains

Host strain Plasmids Fermentation time (h) Yielda (g/g) Final metabolite concn (g/liter)b
Glucosec Acetate Succinate
JCL260 pIAA11, pIAA13, pIAA17 16 0.03 5.49 0.30 0.14
JCL260 pIAA11, pIAA13, pIAA16 16 0.05 5.48 0.22 0.13
JCL260 ΔilvE ΔtyrB pIAA11, pIAA13, pIAA17 16 0.06 5.62 0.65 0.16
JCL260 ΔilvE ΔtyrB pIAA11, pIAA13, pIAA16 16 0.13 5.06 0.13 0.05
JCL260 ΔilvE ΔtyrB pIAA11, pIAA13, pIAA16 28 0.11 10.57 0.24 0.34
a

Estimated by subtracting 3-methyl-1-butanol produced solely from yeast extract from the total and dividing by the total glucose consumed.

b

Pyruvate, formate, lactate, and fumarate were not detected.

c

Glucose consumed.

When the JCL260 ΔilvE ΔtyrB strain expressing the WT leuA gene product was examined for 3-methyl-1-butanol production, the results mimicked those of the strain containing the mutant IPMS. 3-Methyl-1-butanol accumulated to a final concentration of 512 mg/liter, while isobutanol was present at only 42 mg/liter (Fig. 4). This corresponds to a product distribution ratio of 3-methyl-1-butanol to isobutanol of greater than 12:1. When the leuAFBR gene was expressed in place of WT leuA, 3-methyl-1-butanol increased further, to 806 mg/liter, while isobutanol production was minimal (Fig. 4). The yield for this experiment was estimated to be 0.13 g/g from glucose by subtracting the 3-methyl-1-butanol produced from yeast extract alone (see Fig. 6). Increasing the glucose concentration (10 g/liter) and fermentation time (28 h) in this strain led to a final titer of 1.28 g/liter for 3-methyl-1-butanol (Fig. 5 and 6), the highest production of 3-methyl-1-butanol reported to our knowledge. The estimated yield was calculated to be 0.11 g/g. Isobutanol accumulated to less than 0.2 g/liter.

FIG. 6.

FIG. 6.

Production of 3-methyl-1-butanol from yeast extract. Growth and alcohol production were quantified for JCL260 ΔilvE ΔtyrB/pIAA11/pIAA13/pIAA16 after 24 h of induction at 30°C with and without glucose added to the medium. OD600, optical density at 600 nm.

DISCUSSION

Previously our laboratory reported success in producing isobutanol and 1-butanol in E. coli by using the native amino acid biosynthesis pathways to generate precursors for alcohol production (4, 21a). Here we demonstrated the first E. coli strain developed to produce 3-methyl-1-butanol using the valine and leucine biosynthesis pathways. This is also the first microorganism designed for the hyperproduction of 3-methyl-1-butanol. The maximum production achieved was 1.28 g/liter after 28 h for strain JCL260 ΔilvE ΔtyrB containing pIAA11, pIAA13, and pIAA16. The overall yield from this experiment was estimated to be 0.11 g/g, with a maximum productivity of 0.12 g/liter/h between 8 and 12 h. Also, the accumulation of undesirable metabolic by-products was minimized and kept under 0.6 g/liter total.

This work demonstrates that the main bottleneck to 3-methyl-1-butanol production in E. coli is due to feedback inhibition of the leuA gene product by free leucine. The elimination of the leucine synthesis genes ilvE and tyrB led to an increased production of KIC using WT leuA with a synthetic RBS. Expression of leuAFBR resulted in a further increase in the production of KIC and 3-methyl-1-butanol in the JCL260 ΔilvE ΔtyrB background. Production of KIC was not detected in any strains expressing WT leuABCD with its natural RBS. This is most likely due to the low expression level of leuA, which may lead to inhibition of IPMS by low levels of free leucine contained in the yeast extract. All strains expressing WT leuABCD with the synthetic RBS were able to synthesize KIC, suggesting that the increased expression level of leuA was sufficient to overcome complete inhibition of IPMS by leucine contained in the yeast extract.

Further improvement in the production of 3-methyl-1-butanol can be achieved by increasing the glucose concentration and fermentation time to allow extended production, although 3-methyl-1-butanol production slowed after 20 h to a rate similar to that of isobutanol production. This may be due to several reasons, such as a depleted glucose concentration or precursor availability, since no acetyl-coenzyme A is required for isobutanol synthesis as in 3-methyl-1-butanol production. These late-stage production rates (6 to 7 mg/liter/h), however, are minor compared to the average 3-methyl-1-butanol production rate between 4 and 20 h (>75 mg/liter/h). Culture conditions may also need to be investigated due to an unfavorable redox balance in the absence of oxygen, since the production of 3-methyl-1-butanol from glucose creates a surplus of NADH. Isobutanol production, however, is electronically balanced and may also help to explain the increased rate of isobutanol production during the later stages of fermentation.

Our success in engineering E. coli to produce 3-methyl-1-butanol using conserved and native amino acid biosynthesis pathways opens the possibility of using a variety of nonnative hosts for 3-methyl-1-butanol production. Existing amino acid production technology can also be applied to increase productivity and yield (8, 19). E. coli, however, is still an advantageous host due to its well-known physiology and metabolism and easily manipulated genetics and has already been shown to be a suitable host for the production of many valuable metabolites (7, 12, 14, 18). Also, a variety of methods have been developed to increase tolerance to alcohol stress in various organisms (2, 6, 24), which may be applied to E. coli to improve its tolerance to 3-methyl-1-butanol, which will become important as production titers increase.

Acknowledgments

This work was supported in part by the UCLA-DOE Institute for Genomics and Proteomics.

Footnotes

▿

Published ahead of print on 1 August 2008.

REFERENCES

  • 1.Abe, F., and K. Horikoshi. 2005. Enhanced production of isoamyl alcohol and isoamyl acetate by ubiquitination-deficient Saccharomyces cerevisiae mutants. Cell. Mol. Biol. Lett. 10:383-388. [PubMed] [Google Scholar]
  • 2.Alper, H., J. Moxley, E. Nevoigt, G. R. Fink, and G. Stephanopoulos. 2006. Engineering yeast transcription machinery for improved ethanol tolerance and production. Science 314:1565-1568. [DOI] [PubMed] [Google Scholar]
  • 3.Atsumi, S., A. F. Cann, M. R. Connor, C. R. Shen, K. M. Smith, M. P. Brynildsen, K. J. Chou, T. Hanai, and J. C. Liao. 2007. Metabolic engineering of Escherichia coli for 1-butanol production. Metab. Eng. doi: 10.1016/j.ymben.2007.08.003. [DOI] [PubMed]
  • 4.Atsumi, S., T. Hanai, and J. C. Liao. 2008. Engineering synthetic non-fermentative pathways for production of branched-chain higher alcohols as biofuels. Nature 451:86-89. [DOI] [PubMed] [Google Scholar]
  • 5.Baba, T., T. Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K. A. Datsenko, M. Tomita, B. L. Wanner, and H. Mori. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knock-out mutants—the Keio collection. Mol. Syst. Biol. 2:2006.0008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Borden, J. R., and E. T. Papoutsakis. 2007. Dynamics of a genomic-library enrichment and identification of solvent tolerance genes for Clostridium acetobutylicum. Appl. Environ. Microbiol. 73:3061-3068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Causey, T. B., K. T. Shanmugam, L. P. Yomano, and L. O. Ingram. 2004. Engineering Escherichia coli for efficient conversion of glucose to pyruvate. Proc. Natl. Acad. Sci. USA 101:2235-2240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cusyatiner, M. M., E. B. Voroshilova, Y. G. Rostova, L. V. Ivanovskaya, M. G. Lunts, and E. M. Khourges. June 2003. Method for producing L-leucine. U.S. patent 7,220,572.
  • 9.Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Davis, S. C., and S. W. Diegel (ed.). 2007. Transportation energy data book, 26th ed. Oak Ridge National Laboratory, Oak Ridge, TN.
  • 11.Dickinson, J. R., M. M. Lanterman, D. J. Danner, B. M. Pearson, P. Sanz, S. J. Harrison, and M. J. Hewlins. 1997. A 13C nuclear magnetic resonance investigation of the metabolism of leucine to isoamyl alcohol in Saccharomyces cerevisiae. J. Biol. Chem. 272:26871-26878. [DOI] [PubMed] [Google Scholar]
  • 12.Farmer, W. R., and J. C. Liao. 2000. Improving lycopene production in Escherichia coli by engineering metabolic control. Nat. Biotechnol. 18:533-537. [DOI] [PubMed] [Google Scholar]
  • 13.Gusyatiner, M. M., M. G. Lunts, Y. I. Koslov, L. V. Ivanovskaya, and E. B. Voroshilova. July 2002. DNA coding for mutant isopropylmalate synthase L-leucine producing microorganism and method for producing L-leucine. U.S. patent 6,403,342.
  • 14.Hanai, T., S. Atsumi, and J. C. Liao. 2007. Engineered synthetic pathway for isopropanol production in Escherichia coli. Appl. Environ. Microbiol. 73:7814-7818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Horton, C. E., K. X. Huang, G. N. Bennett, and F. B. Rudolph. 2003. Heterologous expression of the Saccharomyces cerevisiae alcohol acetyltransferase genes in Clostridium acetobutylicum and Escherichia coli for the production of isoamyl acetate. J. Ind. Microbiol. Biotechnol. 30:427-432. [DOI] [PubMed] [Google Scholar]
  • 16.Lide, D. R. (ed.). 2007. CRC handbook of chemistry and physics, Internet version 2007, 87th ed. Taylor and Francis, Boca Raton, FL. http://www.hbcpnetbase.com.
  • 17.Lutz, R., and H. Bujard. 1997. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 25:1203-1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Martin, V. J., D. J. Pitera, S. T. Withers, J. D. Newman, and J. D. Keasling. 2003. Engineering a mevalonate pathway in Escherichia coli for the production of terpenoids. Nat. Biotechnol. 21:796-802. [DOI] [PubMed] [Google Scholar]
  • 19.Nakano, T., M. Ikeda, K. Kino, and S. Furukawa. June 1995. Process for producing L-leucine. U.S. patent 5,744,331.
  • 20.Salis, A., M. Pinna, M. Monduzzi, and V. Solinas. 2005. Biodiesel production from triolein and short chain alcohols through biocatalysis. J. Biotechnol. 119:291-299. [DOI] [PubMed] [Google Scholar]
  • 21.Schoondermark-Stolk, S. A., M. Jansen, J. H. Veurink, A. J. Verkleij, C. T. Verrips, G. J. Euverink, J. Boonstra, and L. Dijkhuizen. 2006. Rapid identification of target genes for 3-methyl-1-butanol production in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 70:237-246. [DOI] [PubMed] [Google Scholar]
  • 21a.Shen, C. R., and J. C. Liao. Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways. Metab. Eng., in press. [DOI] [PubMed]
  • 22.Society of Chemistry and Industry. 12 March 2007. US bioethanol production topped 4.86 bn gallons in 2006. (Biofuel briefs.) Chem. Ind. 5:7. [Google Scholar]
  • 23.Vadali, R. V., C. E. Horton, F. B. Rudolph, G. N. Bennett, and K. Y. San. 2004. Production of isoamyl acetate in ackA-pta and/or ldh mutants of Escherichia coli with overexpression of yeast ATF2. Appl. Microbiol. Biotechnol. 63:698-704. [DOI] [PubMed] [Google Scholar]
  • 24.Yomano, L. P., S. W. York, and L. O. Ingram. 1998. Isolation and characterization of ethanol tolerant mutants of Escherichia coli KO11 for fuel ethanol production. J. Ind. Microbiol. Biotechnol. 20:132-138. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES