Skip to main content
PMC home page
Journal of Virology logoLink to Journal of Virology
. 1985 May;54(2):639–642. doi: 10.1128/jvi.54.2.639-642.1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

T A Casey, W T Ruyechan, M N Flora, W Reinhold, S E Straus, J Hay
PMCID: PMC254841  PMID: 2985828

Abstract

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

Full text

PDF
639

Images in this article

640Image
on p.640
641Image
on p.641

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Allen G. P., Yeargan M. R., Bryans J. T. Alterations in the equine herpesvirus 1 genome after in vitro and in vivo virus passage. Infect Immun. 1983 Apr;40(1):436–439. doi: 10.1128/iai.40.1.436-439.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ben-Porat T., Deatly A., Veach R. A., Blankenship M. L. Equalization of the inverted repeat sequences of the pseudorabies virus genome by intermolecular recombination. Virology. 1984 Jan 30;132(2):303–314. doi: 10.1016/0042-6822(84)90037-0. [DOI] [PubMed] [Google Scholar]
  3. Buchman T. G., Roizman B., Adams G., Stover B. H. Restriction endonuclease fingerprinting of herpes simplex virus DNA: a novel epidemiological tool applied to a nosocomial outbreak. J Infect Dis. 1978 Oct;138(4):488–498. doi: 10.1093/infdis/138.4.488. [DOI] [PubMed] [Google Scholar]
  4. Davison A. J., Wilkie N. M. Nucleotide sequences of the joint between the L and S segments of herpes simplex virus types 1 and 2. J Gen Virol. 1981 Aug;55(Pt 2):315–331. doi: 10.1099/0022-1317-55-2-315. [DOI] [PubMed] [Google Scholar]
  5. Desrosiers R. C., Falk L. A. Herpesvirus saimiri strain variability. J Virol. 1982 Jul;43(1):352–356. doi: 10.1128/jvi.43.1.352-356.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dumas A. M., Geelen J. L., Weststrate M. W., Wertheim P., van der Noordaa J. XbaI, PstI, and BglII restriction enzyme maps of the two orientations of the varicella-zoster virus genome. J Virol. 1981 Aug;39(2):390–400. doi: 10.1128/jvi.39.2.390-400.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ecker J. R., Hyman R. W. Varicella zoster virus DNA exists as two isomers. Proc Natl Acad Sci U S A. 1982 Jan;79(1):156–160. doi: 10.1073/pnas.79.1.156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Langridge J., Langridge P., Bergquist P. L. Extraction of nucleic acids from agarose gels. Anal Biochem. 1980 Apr;103(2):264–271. doi: 10.1016/0003-2697(80)90266-3. [DOI] [PubMed] [Google Scholar]
  9. Locker H., Frenkel N. BamI, KpnI, and SalI restriction enzyme maps of the DNAs of herpes simplex virus strains Justin and F: occurrence of heterogeneities in defined regions of the viral DNA. J Virol. 1979 Nov;32(2):429–441. doi: 10.1128/jvi.32.2.429-441.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Maxam A. M., Gilbert W. A new method for sequencing DNA. Proc Natl Acad Sci U S A. 1977 Feb;74(2):560–564. doi: 10.1073/pnas.74.2.560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Mocarski E. S., Roizman B. Structure and role of the herpes simplex virus DNA termini in inversion, circularization and generation of virion DNA. Cell. 1982 Nov;31(1):89–97. doi: 10.1016/0092-8674(82)90408-1. [DOI] [PubMed] [Google Scholar]
  12. Murchie M. J., McGeoch D. J. DNA sequence analysis of an immediate-early gene region of the herpes simplex virus type 1 genome (map coordinates 0.950 to 0.978). J Gen Virol. 1982 Sep;62(Pt 1):1–15. doi: 10.1099/0022-1317-62-1-1. [DOI] [PubMed] [Google Scholar]
  13. Raab-Traub N., Pritchett R., Kieff E. DNA of Epstein-Barr virus. III. Identification of restriction enzyme fragments that contain DNA sequences which differ among strains of Epstein-Barr virus. J Virol. 1978 Aug;27(2):388–398. doi: 10.1128/jvi.27.2.388-398.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ruyechan W. T., Casey T. A., Reinhold W., Weir A. C., Wellman M., Straus S. E., Hay J. Distribution of G + C-rich regions in varicella-zoster virus DNA. J Gen Virol. 1985 Jan;66(Pt 1):43–54. doi: 10.1099/0022-1317-66-1-43. [DOI] [PubMed] [Google Scholar]
  15. Straus S. E., Hay J., Smith H., Owens J. Genome differences among varicella-zoster virus isolates. J Gen Virol. 1983 May;64(Pt 5):1031–1041. doi: 10.1099/0022-1317-64-5-1031. [DOI] [PubMed] [Google Scholar]
  16. Straus S. E., Owens J., Ruyechan W. T., Takiff H. E., Casey T. A., Vande Woude G. F., Hay J. Molecular cloning and physical mapping of varicella-zoster virus DNA. Proc Natl Acad Sci U S A. 1982 Feb;79(4):993–997. doi: 10.1073/pnas.79.4.993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Straus S. E., Reinhold W., Smith H. A., Ruyechan W. T., Henderson D. K., Blaese R. M., Hay J. Endonuclease analysis of viral DNA from varicella and subsequent zoster infections in the same patient. N Engl J Med. 1984 Nov 22;311(21):1362–1364. doi: 10.1056/NEJM198411223112107. [DOI] [PubMed] [Google Scholar]
  18. Warren K. G., Koprowski H., Lonsdale D. M., Brown S. M., Subak-Sharpe J. H. The polypeptide and the DNA restriction enzyme profiles of spontaneous isolates of herpes simplex virus type 1 from explants of human trigeminal, superior cervical and vagus ganglia. J Gen Virol. 1979 Apr;43(1):151–171. doi: 10.1099/0022-1317-43-1-151. [DOI] [PubMed] [Google Scholar]
  19. Zweerink H. J., Morton D. H., Stanton L. W., Neff B. J. Restriction endonuclease analysis of the DNA from varicella-zoster virus: stability of the DNA after passage in vitro. J Gen Virol. 1981 Jul;55(Pt 1):207–211. doi: 10.1099/0022-1317-55-1-207. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES