Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 1985 Aug;55(2):431–441. doi: 10.1128/jvi.55.2.431-441.1985

Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

M F Stinski, T J Roehr
PMCID: PMC254951  PMID: 2991567

Abstract

Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.

Full text

PDF
431

Images in this article

435Image
on p.435
436Image
on p.436
436Image
on p.436
438Image
on p.438
439Image
on p.439

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Batterson W., Roizman B. Characterization of the herpes simplex virion-associated factor responsible for the induction of alpha genes. J Virol. 1983 May;46(2):371–377. doi: 10.1128/jvi.46.2.371-377.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Benoist C., O'Hare K., Breathnach R., Chambon P. The ovalbumin gene-sequence of putative control regions. Nucleic Acids Res. 1980 Jan 11;8(1):127–142. doi: 10.1093/nar/8.1.127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blanton R. A., Tevethia M. J. Immunoprecipitation of virus-specific immediate-early and early polypeptides from cells lytically infected with human cytomegalovirus strain AD 169. Virology. 1981 Jul 15;112(1):262–273. doi: 10.1016/0042-6822(81)90631-0. [DOI] [PubMed] [Google Scholar]
  4. Campbell M. E., Palfreyman J. W., Preston C. M. Identification of herpes simplex virus DNA sequences which encode a trans-acting polypeptide responsible for stimulation of immediate early transcription. J Mol Biol. 1984 Nov 25;180(1):1–19. doi: 10.1016/0022-2836(84)90427-3. [DOI] [PubMed] [Google Scholar]
  5. Campione-Piccardo J., Rawls W. E., Bacchetti S. Selective assay for herpes simplex viruses expressing thymidine kinase. J Virol. 1979 Aug;31(2):281–287. doi: 10.1128/jvi.31.2.281-287.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cohen G. H., Vaughan R. K., Lawrence W. C. Deoxyribonucleic acid synthesis in synchronized mammalian KB cells infected with herpes simplex virus. J Virol. 1971 Jun;7(6):783–791. doi: 10.1128/jvi.7.6.783-791.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Demarchi J. M. Human cytomegalovirus DNA: restriction enzyme cleavage maps and map locations for immediate-early, early, and late RNAs. Virology. 1981 Oct 15;114(1):23–38. doi: 10.1016/0042-6822(81)90249-x. [DOI] [PubMed] [Google Scholar]
  8. Furukawa T., Fioretti A., Plotkin S. Growth characteristics of cytomegalovirus in human fibroblasts with demonstration of protein synthesis early in viral replication. J Virol. 1973 Jun;11(6):991–997. doi: 10.1128/jvi.11.6.991-997.1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gaynor R. B., Berk A. J. Cis-acting induction of adenovirus transcription. Cell. 1983 Jul;33(3):683–693. doi: 10.1016/0092-8674(83)90011-9. [DOI] [PubMed] [Google Scholar]
  10. Gibson W. Immediate-early proteins of human cytomegalovirus strains AD 169, Davis, and Towne differ in electrophoretic mobility. Virology. 1981 Jul 15;112(1):350–354. doi: 10.1016/0042-6822(81)90641-3. [DOI] [PubMed] [Google Scholar]
  11. Gorman C. M., Merlino G. T., Willingham M. C., Pastan I., Howard B. H. The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNA-mediated transfection. Proc Natl Acad Sci U S A. 1982 Nov;79(22):6777–6781. doi: 10.1073/pnas.79.22.6777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gorman C. M., Moffat L. F., Howard B. H. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol. 1982 Sep;2(9):1044–1051. doi: 10.1128/mcb.2.9.1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Graham F. L., van der Eb A. J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 1973 Apr;52(2):456–467. doi: 10.1016/0042-6822(73)90341-3. [DOI] [PubMed] [Google Scholar]
  14. Green M. R., Treisman R., Maniatis T. Transcriptional activation of cloned human beta-globin genes by viral immediate-early gene products. Cell. 1983 Nov;35(1):137–148. doi: 10.1016/0092-8674(83)90216-7. [DOI] [PubMed] [Google Scholar]
  15. Guggenheimer R. A., Stillman B. W., Nagata K., Tamanoi F., Hurwitz J. DNA sequences required for the in vitro replication of adenovirus DNA. Proc Natl Acad Sci U S A. 1984 May;81(10):3069–3073. doi: 10.1073/pnas.81.10.3069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Herz C., Roizman B. The alpha promoter regulator-ovalbumin chimeric gene resident in human cells is regulated like the authentic alpha 4 gene after infection with herpes simplex virus 1 mutants in alpha 4 gene. Cell. 1983 May;33(1):145–151. doi: 10.1016/0092-8674(83)90343-4. [DOI] [PubMed] [Google Scholar]
  17. Imperiale M. J., Feldman L. T., Nevins J. R. Activation of gene expression by adenovirus and herpesvirus regulatory genes acting in trans and by a cis-acting adenovirus enhancer element. Cell. 1983 Nov;35(1):127–136. doi: 10.1016/0092-8674(83)90215-5. [DOI] [PubMed] [Google Scholar]
  18. Lang J. C., Spandidos D. A., Wilkie N. M. Transcriptional regulation of a herpes simplex virus immediate early gene is mediated through an enhancer-type sequence. EMBO J. 1984 Feb;3(2):389–395. doi: 10.1002/j.1460-2075.1984.tb01817.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Mackem S., Roizman B. Differentiation between alpha promoter and regulator regions of herpes simplex virus 1: the functional domains and sequence of a movable alpha regulator. Proc Natl Acad Sci U S A. 1982 Aug;79(16):4917–4921. doi: 10.1073/pnas.79.16.4917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Mackem S., Roizman B. Regulation of alpha genes of herpes simplex virus: the alpha 27 gene promoter-thymidine kinase chimera is positively regulated in converted L cells. J Virol. 1982 Sep;43(3):1015–1023. doi: 10.1128/jvi.43.3.1015-1023.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mackem S., Roizman B. Structural features of the herpes simplex virus alpha gene 4, 0, and 27 promoter-regulatory sequences which confer alpha regulation on chimeric thymidine kinase genes. J Virol. 1982 Dec;44(3):939–949. doi: 10.1128/jvi.44.3.939-949.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Manley J. L., Fire A., Cano A., Sharp P. A., Gefter M. L. DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract. Proc Natl Acad Sci U S A. 1980 Jul;77(7):3855–3859. doi: 10.1073/pnas.77.7.3855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
  24. McDonough S. H., Spector D. H. Transcription in human fibroblasts permissively infected by human cytomegalovirus strain AD169. Virology. 1983 Feb;125(1):31–46. doi: 10.1016/0042-6822(83)90061-2. [DOI] [PubMed] [Google Scholar]
  25. McKnight S. L. The nucleotide sequence and transcript map of the herpes simplex virus thymidine kinase gene. Nucleic Acids Res. 1980 Dec 20;8(24):5949–5964. doi: 10.1093/nar/8.24.5949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Michelson-Fiske S., Horodniceanu F., Guillon J. C. Immediate early antigens in human cytomegalovirus infected cells. Nature. 1977 Dec 15;270(5638):615–617. doi: 10.1038/270615a0. [DOI] [PubMed] [Google Scholar]
  27. Moreau P., Hen R., Wasylyk B., Everett R., Gaub M. P., Chambon P. The SV40 72 base repair repeat has a striking effect on gene expression both in SV40 and other chimeric recombinants. Nucleic Acids Res. 1981 Nov 25;9(22):6047–6068. doi: 10.1093/nar/9.22.6047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nagata K., Guggenheimer R. A., Hurwitz J. Specific binding of a cellular DNA replication protein to the origin of replication of adenovirus DNA. Proc Natl Acad Sci U S A. 1983 Oct;80(20):6177–6181. doi: 10.1073/pnas.80.20.6177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. O'Hare P., Hayward G. S. Expression of recombinant genes containing herpes simplex virus delayed-early and immediate-early regulatory regions and trans activation by herpesvirus infection. J Virol. 1984 Nov;52(2):522–531. doi: 10.1128/jvi.52.2.522-531.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. O'Sullivan M. J., Marks V. Methods for the preparation of enzyme-antibody conjugates for use in enzyme immunoassay. Methods Enzymol. 1981;73(Pt B):147–166. doi: 10.1016/0076-6879(81)73062-3. [DOI] [PubMed] [Google Scholar]
  31. Post L. E., Mackem S., Roizman B. Regulation of alpha genes of herpes simplex virus: expression of chimeric genes produced by fusion of thymidine kinase with alpha gene promoters. Cell. 1981 May;24(2):555–565. doi: 10.1016/0092-8674(81)90346-9. [DOI] [PubMed] [Google Scholar]
  32. Post L. E., Norrild B., Simpson T., Roizman B. Chicken ovalbumin gene fused to a herpes simplex virus alpha promoter and linked to a thymidine kinase gene is regulated like a viral gene. Mol Cell Biol. 1982 Mar;2(3):233–240. doi: 10.1128/mcb.2.3.233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Preston C. M., Cordingley M. G., Stow N. D. Analysis of DNA sequences which regulate the transcription of a herpes simplex virus immediate early gene. J Virol. 1984 Jun;50(3):708–716. doi: 10.1128/jvi.50.3.708-716.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rawlins D. R., Rosenfeld P. J., Wides R. J., Challberg M. D., Kelly T. J., Jr Structure and function of the adenovirus origin of replication. Cell. 1984 May;37(1):309–319. doi: 10.1016/0092-8674(84)90327-1. [DOI] [PubMed] [Google Scholar]
  35. Shaw W. V. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 1975;43:737–755. doi: 10.1016/0076-6879(75)43141-x. [DOI] [PubMed] [Google Scholar]
  36. Siebenlist U., Hennighausen L., Battey J., Leder P. Chromatin structure and protein binding in the putative regulatory region of the c-myc gene in Burkitt lymphoma. Cell. 1984 Jun;37(2):381–391. doi: 10.1016/0092-8674(84)90368-4. [DOI] [PubMed] [Google Scholar]
  37. Stenberg R. M., Thomsen D. R., Stinski M. F. Structural analysis of the major immediate early gene of human cytomegalovirus. J Virol. 1984 Jan;49(1):190–199. doi: 10.1128/jvi.49.1.190-199.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Stinski M. F. Sequence of protein synthesis in cells infected by human cytomegalovirus: early and late virus-induced polypeptides. J Virol. 1978 Jun;26(3):686–701. doi: 10.1128/jvi.26.3.686-701.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stinski M. F. Synthesis of proteins and glycoproteins in cells infected with human cytomegalovirus. J Virol. 1977 Sep;23(3):751–767. doi: 10.1128/jvi.23.3.751-767.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Stinski M. F., Thomsen D. R., Stenberg R. M., Goldstein L. C. Organization and expression of the immediate early genes of human cytomegalovirus. J Virol. 1983 Apr;46(1):1–14. doi: 10.1128/jvi.46.1.1-14.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tanaka S., Otsuka M., Ihara S., Maeda F., Watanabe Y. Induction of pre-early nuclear antigen(s) in HEL cells infected with human cytomegalovirus. Microbiol Immunol. 1979;23(4):263–271. doi: 10.1111/j.1348-0421.1979.tb00462.x. [DOI] [PubMed] [Google Scholar]
  42. Thomsen D. R., Stenberg R. M., Goins W. F., Stinski M. F. Promoter-regulatory region of the major immediate early gene of human cytomegalovirus. Proc Natl Acad Sci U S A. 1984 Feb;81(3):659–663. doi: 10.1073/pnas.81.3.659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Thomsen D. R., Stinski M. F. Cloning of the human cytomegalovirus genome as endonuclease XbaI fragments. Gene. 1981 Dec;16(1-3):207–216. doi: 10.1016/0378-1119(81)90077-9. [DOI] [PubMed] [Google Scholar]
  44. Wagner M. J., Sharp J. A., Summers W. C. Nucleotide sequence of the thymidine kinase gene of herpes simplex virus type 1. Proc Natl Acad Sci U S A. 1981 Mar;78(3):1441–1445. doi: 10.1073/pnas.78.3.1441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wasylyk B., Wasylyk C., Augereau P., Chambon P. The SV40 72 bp repeat preferentially potentiates transcription starting from proximal natural or substitute promoter elements. Cell. 1983 Feb;32(2):503–514. doi: 10.1016/0092-8674(83)90470-1. [DOI] [PubMed] [Google Scholar]
  46. Wasylyk B., Wasylyk C., Chambon P. Short and long range activation by the SV40 enhancer. Nucleic Acids Res. 1984 Jul 25;12(14):5589–5608. doi: 10.1093/nar/12.14.5589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wathen M. W., Stinski M. F. Temporal patterns of human cytomegalovirus transcription: mapping the viral RNAs synthesized at immediate early, early, and late times after infection. J Virol. 1982 Feb;41(2):462–477. doi: 10.1128/jvi.41.2.462-477.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wathen M. W., Thomsen D. R., Stinski M. F. Temporal regulation of human cytomegalovirus transcription at immediate early and early times after infection. J Virol. 1981 May;38(2):446–459. doi: 10.1128/jvi.38.2.446-459.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Weeks D. L., Jones N. C. E1A control of gene expression is mediated by sequences 5' to the transcriptional starts of the early viral genes. Mol Cell Biol. 1983 Jul;3(7):1222–1234. doi: 10.1128/mcb.3.7.1222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Weiher H., König M., Gruss P. Multiple point mutations affecting the simian virus 40 enhancer. Science. 1983 Feb 11;219(4585):626–631. doi: 10.1126/science.6297005. [DOI] [PubMed] [Google Scholar]
  51. Wentworth B. B., French L. Plaque assay of cytomegalovirus strains of human origin. Proc Soc Exp Biol Med. 1970 Nov;135(2):253–258. doi: 10.3181/00379727-135-35031. [DOI] [PubMed] [Google Scholar]
  52. Woo S. L., Beattie W. G., Catterall J. F., Dugaiczyk A., Staden R., Brownlee G. G., O'Malley B. W. Complete nucleotide sequence of the chicken chromosomal ovalbumin gene and its biological significance. Biochemistry. 1981 Oct 27;20(22):6437–6446. doi: 10.1021/bi00525a024. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES