Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Sep 30.
Published in final edited form as: DNA Cell Biol. 2008 Jan;27(1):9–17. doi: 10.1089/dna.2007.0673

PIN: A Novel Protein Involved in IFN-γ Accumulation of NOS-1 in Neurons

Jingjun Yang 1, Natalie Nicole Dennison 1, Carol Shoshkes Reiss 1,2,3,4
PMCID: PMC2556631  NIHMSID: NIHMS66992  PMID: 17941806

Abstract

In this study we investigate the role of the protein inhibitor of NOS-1 (PIN) in the interferon-γ (IFN-γ)–mediated posttranscriptional accumulation of nitric oxide synthase-1 (NOS-1) and the anti-vesicular stomatitis virus response in neuronal cells. IFN-γ–induced enhancement of NOS-1 activity is crucial for its antiviral activity in the central nervous system. IFN-γ treatment of neuronal cells results in an increase of total NOS-1 and decrease of total PIN proteins without alteration in their respective mRNA levels. PIN/NOS-1 complexes decreased after IFN-γ treatment. Transfection of cells with small interfering RNA (siRNA) for PIN results in a higher constitutive activity of NOS-1 and inhibition of viral replication. IFN-γ treatment did not change the amount of NOS-1 detectable by Western blot, when PIN is diminished by RNAi treatment. Overexpression of PIN results in lower constitutive NOS-1 expression and activity, and diminishes activation of NOS-1 by IFN-γ. Our findings indicate that in neurons, IFN-γ upregulates NOS-1 through proteasomal degradation of PIN.

Introduction

Interferon-γ (IFN-γ) plays a crucial early antiviral role in protection against viral infection in the central nervous system (CNS) (Komatsu et al., 1999; Rodriguez et al., 2003). IFN-γ treatment results in nitric oxide synthase-1 (NOS-1) accumulation posttranscriptionally. Viral clearance from neurons is associated with increased NO production both in vitro and in the CNS (Bi and Reiss, 1995; Komatsu et al., 1996; Chesler et al., 2004). The regulation and the mechanism of this phenomenon largely remain unknown. Protein inhibitor of NOS-1 (PIN) is degraded following IFN-γ treatment; more ubiquitin-modified PIN and a shorter half-life are observed in IFN-γ–treated neuronal cells (Yang et al., 2006). We propose that PIN is centrally involved in the IFN-γ–mediated accumulation of NOS-1 and antiviral responses in neurons.

Localization and activation of NOS enzymes are regulated via protein–protein interactions (Alderton et al., 2001; Dedio et al., 2001). Of the three NOS isoforms, NOS-1 is the largest due to a 300-amino-acid PDZ (PSD-95/Discs large/zona occludens-1) domain insertion at the N terminus, targeting the protein to the postsynaptic density (PSD). Several proteins have been identified to interact with NOS-1 in neurons and modulate its activity. The PSD protein PSD-95 binds and anchors NOS-1 in a complex with the N-methyl-D-aspartic acid receptor (NMDAR) (Christopherson et al., 1999). Carboxy-terminal PDZ ligand of nNOS (CAPON) competes with PSD-95 for interaction with NOS-1 in the PSD of synaptic spines (Jaffrey et al., 1998), and is thought to reduce the capability of NOS-1 to produce NO. Nitric oxide synthase–interacting protein (NO-SIP) interacts and colocalizes with NOS-1 in synaptic spines and inhibits NOS activity (Dreyer et al., 2004). In the CNS, NOS-1 is activated by Ca2+ influx through the NMDA glutamate receptor, triggering of the NMDAR kinase (Putzke et al., 2000).

A 10 kDa protein that physically interacts with and inhibits the activity of NOS-1 was identified using a yeast two-hybrid screen. The protein was named Protein Inhibitor of Neuronal NOS (Jaffrey and Snyder, 1996a). PIN and NMDAR colocalize with NOS-1 in penile nerves (Ferrini et al., 2003). The PIN-binding region of NOS-1 maps to a 17-residue peptide fragment from Met-228 to His-244 of NOS-1 (Fan et al., 1998). PIN binding destabilizes the NOS-1 homodimer, a conformation necessary for enzymatic activity (Dunbar et al., 2004). Prostaglandin E2, an inhibitor of NOS-1, induces PIN expression in neurons; Celecoxib™ treatment, which enhances NOS-1 activity, inhibits PIN expression (Chen and Reiss, 2002). In addition, PIN inhibits NO and superoxide production by purified NOS-1 (Xia et al., 2006).

IFN-γ treatment prolongs the half-life of NOS-1 (Yang et al., 2006). In neurons, PIN is posttranscriptionally downregulated by IFN-γ treatment; more ubiquitination and faster degradation of PIN are detected in IFN-γ–treated samples (Yang et al., 2006). In this study, we examine the turnover and interaction of PIN and NOS-1 following IFN-γ treatment. To assess this, RNA interference (RNAi) and overexpression techniques were employed. The results demonstrate that in neuronal cells, IFN-γ enhances NOS-1 and antiviral activity through down-regulation of PIN.

Materials and Methods

Cell cultures and reagents

NB41A3 cells and L929 cells were purchased from ATCC (Manassas, VA). NB41A3 cells were maintained in F-12K medium containing 15% horse serum, 2.5% fetal bovine serum (FBS), and 1% penicillin/streptomycin at 37°C and 5% carbon dioxide (CO2) (Komatsu et al., 1996). L929 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) low-glucose media containing 10% FBS, 1 mM L-glutamine, HEPES buffer, and 1% penicillin/streptomycin at 37°C and 5% CO2 (Reiss et al., 1983). Unless otherwise stated, all tissue culture reagents were obtained from Mediatech (Herndon, VA). Anti-vesicular stomatitis virus (VSV), Indiana serotype, San Juan strain, originally obtained from Alice S. Huang (then at the Children’s Hospital, Boston, MA) was used in all viral studies. VSV was propagated in Chinese hamster ovary cells and purified over a sucrose gradient as previously described (Chang et al., 1994). Recombinant murine IFN-γ was purchased from R&D Systems (Minneapolis, MN) and used at a concentration of 20 ng/mL in all experiments.

Antibodies

Mouse anti-mouse NOS-1 monoclonal antibody (mAb) (1:2000 for Western blot) and rabbit anti-mouse NOS-1 polyclonal antibodies (pAbs) were purchased from BD Pharmingen (San Jose, CA). Rat anti-mouse PIN mAb (1:500 for Western blot, 1:50 for IP) was purchased from Axxora (San Diego, CA). Anti-GAPDH mAb (1:100,000 for Western blot) was purchased from Abcam (Cambridge, MA). Anti-Xpress mAb was purchased from Invitrogen (Carlsbad, CA). Sheep anti-VSV pAb was a generous gift from Dr. Alice S. Huang (when at the Children’s Hospital, Boston, MA). Horseradish peroxidase (HRP)–conjugated anti-mouse secondary antibody (1:2000) was purchased from Vector (Southfield, MI). Donkey anti-sheep (1:4000) and donkey anti-rabbit (1:5000) secondary antibodies, both HRP conjugated, were purchased from Jackson Immunologicals (West Grove, PA) and Zymed (South San Francisco, CA), respectively.

Plaque assay

Viral titers were determined in triplicates using serially diluted culture supernatants on monolayers of L929 cells as previously described (Komatsu et al., 1996). The geometric mean and geometric mean error of the titer were calculated, and the groups were compared statistically using analysis of variance (ANOVA).

RT-PCR

mRNA levels were determined by multiplex RT-PCR using the Qiagen One-Step RT-PCR kit (Valencia, CA). Total RNA (100 ng) was used in each reaction. The following protocol was used to carry out the reaction: 50°C for 30 min, 95 °C for 15 min, 36 cycles of 94°C for 1 min, 58°C for 30 s, 72°C for 1 min, then 72°C for 10 min, and 4°C hold. The primers used in these reactions are listed in Table 1. Products were resolved by 1% agarose gel electrophoresis, stained using ethidium bromide (Bio-Rad, Hercules, CA) or Sybr-Gold dye (Invitrogen), and visualized using a UV transilluminator. Results were digitally photographed using a Kodak DC290 camera controlled by the Kodak 1D analytic software (Kodak, Rochester, NY). DNA band densities were determined using the UN-SCAN-IT software.

Table 1.

Primers Used for PCR/RT-PCR and Size of Products

Sense 5′–3′ Antisense 5′–3′ Size (bp)
Xpress-PIN tagcatgactggtggacagc ggatcactgggtgtttggca 490
GAPDH attcaacggcacagtcaagg tggatgcagggatgatgttc 467
IFN-β catcaactataagcagctcca ttcaagtggagagcagttgag 353
PcDNA3.1/His A/MUTA ccagcacagtggcggccgcgctgtc gacagcgcggccgccactgtgctgg 6000
Open in a new tab

Griess assay

The concentration of NO2− in culture supernatants was determined by assaying the stable end product of NO (Hewett, 1999).

Western blot

Cells were lysed, and proteins were analyzed by Western blot (Chesler et al., 2004). Protein band densities were quantitated by UN-SCAN-IT software.

Sandwich enzyme-linked immunosorbent assay

Flat 96-well plates were coated with capture antibody (anti-NOS mAb 500 ng/well, or anti-PIN mAb 100 ng/well) diluted in 100 μL coating buffer (0.1 M sodium bicarbonate, pH 9.6) and incubated at 37°C for 1 h. The plates were washed five times with phosphate-buffered saline (PBS) containing 0.1% Tween-20 and air dried. Two hundred μL (0.5 mg/mL) of the test sample was added to duplicate wells and incubated overnight at 4°C. Wells were washed five times as above and blocked with 100 μL 2% dried milk powder/PBS (BLOTTO) for 1 h at 37°C. Following another five washes, detecting antibody (anti-NOS mAb 10 μg/mL, or anti-PIN mAb 10 μg/mL) diluted in 100 μL BLOTTO was added to plates and incubated at 37°C for 1 h. Wells were washed and incubated with secondary antibody for 30 min (HRP-conjugated anti-mouse IgG 1:1000 or anti-Rat IgM 1:500). TMB substrate was added, and 15 min later the reaction was stopped by TMB Stopping Solution (Sigma, St. Louis, MO). The reaction produces a yellow-to-orange color, which was quantified at 450 nm by microplate reader.

RNAi

siRNA targeting PIN, a negative control siRNA, and the siPORT™ Amine® transfection reagent were purchased from Ambion (Austin, TX). The siRNA was transfected into NB41A3 cells according to the instruction of the manufacturer’s manual (Ambion). Briefly, the transfection was carried out using siR-NA (final concentration 50 nM) diluted in 50 μL of OPTI-MEM media and 1.5 μL of the Amine reagent diluted in 47.5 μL OPTI-MEM media. Ten minutes later, the siRNA was mixed with the transfection reagent and incubated for another 10 min at room temperature (RT) for complex formation. The 100 μL siRNA–Amine complex was mixed with 900 μL regular NB41A3 media containing 1×105 NB41A3 cells and plated into 12-well plates. Total RNA was extracted at 24 h posttransfection, and protein isolation or VSV infection was conducted 48 h posttransfection.

Plasmid construction and mutagenesis

The plasmid containing cDNA of PIN, PGEX-4T2-PIN, was a gift from Dr. Samie Jaffrey at Weill Cornell Medical School (Jaffrey and Snyder, 1996b). The PIN cDNA fragment was cloned into PcDNA3.1/His A vector by restricting enzyme cutting and ligation (EcoRI and NotI), generating PcDNA3.1/His A/PIN. Mutagenesis of this new plasmid was conducted by constructing a one-nucleotide insertion in the PIN sequence, using Stratagene QuickChange kit (La Jolla, CA). Primers used for mutagenesis are listed in Table 1. The PCR was programmed as follows: 95°C for 30 s, 18 cycles of 95°C for 30 s, 55°C for 30 s, 68°C for 6 min, and then 4°C hold. PCR products were digested with Dpn to remove original template and purified with a Qiagen gel extraction kit. Successful mutagenesis was confirmed by sequencing.

Transient and stabilized transfection

NB41A3 cells were transfected with the PcDNA3.1/His A/PIN vector using the Lipofectamine2000® transfection reagent, following manufacturer’s instructions (Invitrogen). Briefly, 2×105 NB41A3 cells were plated in each well and grown overnight to reach 50% confluency in six-well plates (Nunc, Rochester, NY). The transfection was carried out using 6 μg of plasmid diluted in 75 μL of DNA diluent and 15 μL of the Lipofectamine2000 reagent diluted in 60 μL serum-free DMEM. The DNA was then added to the transfection reagent and incubated for 10 min at RT for complex formation.

The PcDNA3.1/His A/PIN–Lipofectamine2000 complex was placed on the cells and incubated for 48 h at 37°C and 5% CO2. For transient transfection, cells were lysed on 24 h for RNA expression and 48 h for protein detection. For stabilized transfection, 48 h posttransfection the media were replaced with standard growth media containing 400 μg/mL G418. Mock-transfected NB41A3 cells and NB41A4 cells transfected with PcDNA3.1/His A/MUTA were also treated with G418 as a control for selection. After 4 days of culture, the mock-transfected NB41A3 cells were completely eliminated, while the PcDNA3.1-transfected cells were healthy. These cells were split under selection conditions and plated for further experiments.

Statistical methods

To determine if there was a significant difference among the groups, mean ± SEM of each group was compared using a parametric ANOVA. The results were considered significant for a p-value less than 0.05. Pairwise comparison among the groups was done using the Tukey’s post hoc test.

Results

The constitutive ratio of PIN:NOS-1 and complexes between these proteins are affected by IFN-γ treatment

To investigate if the interaction between PIN and NOS-1 was altered by IFN-γ treatment, we collected total protein from IFN-γ–treated and control cells and determined the amount of PIN/NOS-1 complexes as well as free PIN and NOS-1 by sandwich enzyme-linked immunosorbent assay (ELISA). We had earlier attempted to characterize this interaction using standard co-immunoprecipitation (co-IP), but we found that the association of PIN and NOS-1 is weak and easily disrupted (data not shown). To resolve this problem, we combined bivalent reversible cross-linking with co-IP; however, two cross-linkers aggregated too many proteins and the gels were uninterpretable (data not shown).

Using a sandwich ELISA, equal amounts of fresh cell lysates from cells treated with media or IFN-γ at different time points were added to plates precoated with the indicated capture antibody, and then incubated with primary detection and secondary antibodies for signal production (Fig. 1). Consistent with Western blot data (Yang et al., 2006), IFN-γ treatment resulted in a sixfold increase of total NOS-1 and 75% decrease of total PIN. A transient increase followed by a decrease of PIN/NOS-1 complexes was observed with IFN-γ treatment in neuronal cells (Fig. 1). This suggests that there is more free PIN than NOS-1 in NB41A3 cells.

FIG. 1.

FIG. 1

Open in a new tab

IFN-γ treatment in neuronal cells results in an increase followed by decrease of PIN/NOS-1 complexes. NB41A3 cells were treated with media or IFN-γ for 8, 16, or 24 h. Amounts of NOS-1, PIN, or NOS-1/PIN complex were determined by double-antibody sandwich ELISA. HRP-conjugated secondary antibody and TMB substrate were used in all reactions. (A) Expression of NOS-1 increases with IFN-γ treatment. Ninety-six–well plates were coated with anti-NOS-1 pAb (Capture Ab). Equal amounts of cell lysates from above treated samples were added in triplicate into precoated well and detected with anti-NOS-1 mAb. (B) Expression of PIN decreases with IFN-γ treatment. Anti-PIN antibody was used for both capturing and detecting. (C) An increase followed by decrease of NOS-1/PIN complexes was observed along with IFN-γ treatment in neuronal cells. Anti-NOS-1 antibody was used in capturing steps, and anti-PIN antibody was used in detecting steps. Same results were observed when using anti-PIN antibody for capturing and anti-NOS-1 antibody for detecting. Results are representative of three independent experiments (*p < 0.01; **p < 0.05).

RNAi of PIN expression results in a higher constitutive expression and activity of NOS-1 and diminishes enhancement of NOS-1 by IFN-γ

To further characterize the involvement of PIN in the IFN-γ–mediated accumulation of NOS-1 and the antiviral response, we suppressed expression of PIN by RNAi. PIN siRNA and the negative control siRNA were introduced to NB41A3 cells.

One concern we had using this technique is that RNAi may induce an IFN-β response (Sledz et al., 2003) because of double-stranded RNA (dsRNA) segments. Although reports suggested that siRNA smaller than 30 nucleotides was less likely to induce this response (Zhou et al., 2003a), we wanted to make certain that IFN-β production was not triggered by introduction of siRNA. We tested for expression of the IFN-β mRNA in our samples by RT-PCR and confirmed that siRNA treatment did not induce IFN response in NB41A3 cells (Supplemental Fig. 1, available online at www.liebertpub.com).

siRNA-transfected cells and mock-transfected cells were treated with IFN-γ for 24 h, and the suppression of PIN expression by siRNA was validated by Western blot (Fig. 2A). Expression of NOS-1 protein and NO2− production were measured. Figure 2A shows that when PIN is diminished, a higher constitutive NOS-1 level is observed and IFN-γ treatment does not change the amount of NOS-1. NO production is consistent with the protein expression data (Fig. 2B).

FIG. 2.

FIG. 2

Open in a new tab

IFN-γ treatment does not change the amount of NOS-1 when PIN is knocked down by RNAi. siRNA of PIN or negative control siRNA (Neg, random sequence that does not target any genes) was introduced to NB41A3 cells using siPORT Amine transfection reagent. siRNA-transfected cells and mock-transfected cells were treated with IFN-γ for 24 h. (A) Expressions of PIN and NOS-1 protein were determined by Western blot. (B) NO2− production was measured by Griess assay. Values are mean ± SE of three independent experiments (*p > 0.05; **p < 0.01; ***p < 0.05).

RNAi suppression of PIN results in increased inhibition of viral replication

Following siRNA transfection and IFN-γ treatment, we infected NB41A3 cells with VSV and examined the expression of VSV proteins by Western blot and viral replication by plaque assay. RNAi inhibition of PIN results in ~25% of the amount of M protein synthesized compared to the control, and more than 10-fold increased inhibition of release of infectious viral progeny (Fig. 3). We interpret these data to be consistent with the decrease of PIN results in increased functional NOS-1 and decreased unstable PIN/NOS-1 complexes. As a consequence, the half-life of NOS-1 is prolonged, higher constitutive NOS-1 expression is observed, accompanied by increased NOS-1 activity, and enhanced inhibition of VSV replication results.

FIG. 3.

FIG. 3

Open in a new tab

RNAi of PIN in NB41A3 cells results in inhibition of viral replication. siRNA of PIN or Neg siRNA was introduced to NB41A3 cells using siPORT Amine transfection reagent. siRNA-transfected cells and mock-transfected cells were treated with IFN-γ for 24 h and infected with VSV at M.O.I = 3. Cell lysates were extracted at 5 h postinfection. Supernatants were collected at 7 h postinfection. (A) Expression of the VSV M protein relative to GAPDH was determined by Western blot. (B) Viral replication was measured by plaque assay. Values are mean ± SE of three samples. Results are representative of three independent experiments (*p > 0.05; **p < 0.01; ***p < 0.05).

Overexpression of PIN results in lower constitutive NOS-1 levels and diminished activation of NOS-1 by IFN-γ

We overexpressed PIN in NB41A3 cells to examine its effect on IFN-γ–mediated accumulation of NOS-1 and inhibition of viral replication. cDNA for PIN from PGEX-4T2-PIN (Jaffrey and Snyder, 1996a; Zhou et al., 2003b) was excised and inserted into a cytomegalovirus (CMV)–driven eukaryotic expression vector PcDNA3.1/His A. The newly constructed PcDNA3.1/His A/PIN encodes cDNA with an N-terminal Xpress™ tag fused to PIN. Transfected cells were visualized by antibody staining and fluorescence microscopy (Supplemental Fig. 2A, available online at www.liebertpub.com). A 50–70% transfection efficiency was achieved. Expression of Xpress-PIN mRNA was determined by RT-PCR (Supplemental Fig. 2B, available online at www.liebertpub.com).

A negative control plasmid PcDNA3.1/His A/MUTA was constructed using PcDNA3.1/His A/PIN as template; mutagenesis was performed by PCR to introduce a one-nucleotide insertion within the open-reading frame of Xpress-PIN. With the frameshift on the open-reading frame, the cells transfected with PcDNA3.1/His A/MUTA did not express Xpress-PIN (Fig. 4A).

FIG. 4.

FIG. 4

Open in a new tab

Overexpression of PIN results in lower constitutive NOS-1 expression and activity, increased PIN/NOS-1 complexes, and diminished activation of NOS-1 by IFN-γ. NB41A3 cells were plated in six-well plates and cultured overnight prior to transfection with PcDNA3.1/His A/PIN or PcDNA3.1/is A/MUTA. The untransfected control NB41A3 cells were treated with the same amount of transfection reagent. Twenty-four hours posttransfection, cells were treated with media or IFN-γ for indicated time. (A) Overexpression of Xpress-PIN was confirmed by co-IP of Xpress and PIN. Anti-PIN antibody was used at IP step, and anti-Xpress antibody was used for Western blot (or vice verse, data not shown). Original lysates (no IP step involved) collected from NB41A3 cells transfected with pcDNA3.1/His/LacZ plasmid (Invitrogen) served as a positive control for anti-Xpress antibody in the Western blot. (B) Amount of NOS-1/PIN complex was measured by sandwich ELISA using original lysates. (C) Expression of NOS-1 protein was determined by Western blot. (D) In a parallel experiment, NB41A3 cells were transfected with PcDNA3.1/His A/PIN or PcDNA3.1/His A/MUTA, and then treated with media or IFN-γ for 48 h. Supernatant medium was collected, and production of NO2− was measured by Griess assay. Values are mean ± SEM of three independent experiments (*p > 0.05; **p < 0.01; ***p < 0.05).

To characterize the consequence(s) of PIN overexpression on the IFN-γ–mediated anti-VSV response in the neuronal cells, NB41A3 cells were transfected with PcDNA3.1/His A/PIN or PcDNA3.1/His A/MUTA. Cell lysates were collected, and overexpression of Xpress-PIN was confirmed by co-IP of Xpress and PIN (Fig. 4A). The interaction of Xpress-PIN and NOS-1 was determined by sandwich ELISA (Fig. 4B). Expression of NOS-1 protein and NO2− production were also measured (Fig. 4C, D). When PIN is overexpressed, we observed increases in PIN/NOS-1 complexes, lower constitutive NOS-1 expression and activity, and diminished activation of NOS-1 by IFN-γ (Fig. 4). While IFN-γ downregulates Xpress-PIN by ~25%, in PIN overexpressing cells, there was an excess pool of endogenous PIN remaining in the cells that inhibits NOS-1 accumulation and activity as effectively as in control cells.

The effect of PIN overexpression on viral replication

In a parallel experiment, neuronal cells were mock treated or IFN-γ treated for 24 h and infected with VSV. Viral proteins were detected by Western blot, and viral titer in supernatants was determined by plaque assay (Fig. 5A and B, respectively). More abundant viral proteins are produced, and increased viral replication is observed in NB41A3 cells that over-expressed PIN. IFN-γ treatment inhibits viral replication about threefold in PIN-overexpressing neuronal cells, while more than 15-fold inhibition is observed in the control IFN-γ–treated cells (Fig. 5). These data indicate that PIN is centrally involved in the IFN-γ regulation of NOS-1 activity.

FIG. 5.

FIG. 5

Open in a new tab

PIN overexpression resulted in increased viral replication in NB41A3 cells. In PIN overexpressed cells, IFN-γ treatment did not inhibit viral replication as significantly as the control group. NB41A3 cells were plated in 12-well plates (2.5×105 cells/well) and cultured overnight prior to transfection with PcDNA3.1/His A/PIN or PcDNA3.1/His A/MUTA. The untransfected control NB41A3 cells were treated with the same amount of transfection reagent. Twenty-four hours posttransfection, cells were treated with media or IFN-γ. Following 24 h IFN-γ treatment, cells were infected with VSV at M.O.I = 3. Supernatant and cell lysates were collected at 5 h postinfection. (A) VSV M protein was measured by Western blot with GAPDH as housekeeping control. (B) The viral titer was determined by plaque assay. This experiment is representative of three independent experiments (*p < 0.01; **p > 0.05).

Discussion

Posttranscriptional accumulation of NOS-1 by IFN-γ treatment appears to be critical in the inflammatory cytokine-mediated antiviral response in the neurons (Chesler et al., 2004). The mechanism of this posttranscriptional increase in NOS-1 and enhanced viral clearance in neurons were investigated in this study. We have concentrated on the role(s) of PIN in VSV infection in the neuronal cells.

Following IFN-γ treatment of neuronal cells, we observed a transient increase followed by a decrease of PIN/NOS-1 complexes (Fig. 1). This suggests that there are more free PIN than NOS-1 in the cytosol. When expression of PIN is reduced, higher constitutive NOS-1 expression levels and activity are observed (Fig. 2 and Supplemental Fig. 1). In PIN-overexpressing neuronal cells, we observed lower constitutive NOS-1 activity, and diminished activation of NOS-1 by IFN-γ compared with the control cells (Figs. 4 and 5, and Supplemental Fig. 2). While the conditions we have used are not physiological, they may give insights into responses in vivo.

In the CNS, IFN-γ’s functions are related to the modulation of the immune system and the control of the infectious diseases. Elevated expression of IFN-γ was observed in the human immunodeficiency virus (HIV-1)–infected brain and may play an important role in neuropathological pathways of HIV-related encephalopathy (Koedel et al., 1999; Shapshak et al., 2004). IFN-γ–producing γδT cells may help control murine West Nile virus infection (Wang et al., 2003). The murine coronavirus, JHMV, infects a variety of CNS cell types during the acute phase of infection. In IFN-γ KO mice, increased morbidity and mortality were associated with persistent virus replication, indicating a role of the cytokine in control of viral replication (Parra et al., 1999). These diverse viral infections illustrate the importance of IFN-γ in the immune modulation and clearance of viruses from the CNS.

NO-dependent antiviral activity has been found in a variety of neurotropic virus infections, including CMV (Kosugi et al., 2002), HIV (Hori et al., 1999), herpes simplex virus 1 (HSV-1) (Kodukula et al., 1999), mouse hepatitis virus (MHV) (Lane et al., 1997), poliovirus (Komatsu et al., 1996), and reovirus (Goody et al., 2005). Several studies have suggested possible mechanisms by which viral replication is inhibited by NO. Peroxynitrite, ONOO(−), was reported to react with tyrosines, serines, and cysteines of proteins, and results in NO2Y, NO2S, and NO2C (Gu et al., 2002). Such modifications could alter the activity of a viral polymerase or other viral proteins that are critically involved in virus life cycle, or affect host proteins required for virus assembly to attenuate viral infection (Simon et al., 1996; Saura et al., 1999).

PIN was reported to inhibit nNOS activity in cell lysates through disruption of enzyme dimerization (Dunbar et al., 2004). In both in vitro and in vivo studies, dimer stabilization of NOS-1 protects the enzyme from proteolysis (Bender et al., 2000; Dunbar et al., 2004). However, the effect of PIN on degradation and NO production of NOS-1 in the neurons has not been examined. Utilizing overexpression and siRNA, as well as the sandwich ELISA technique, we not only explore the role of PIN in the IFN-γ–mediated accumulation and activation of NOS-1, but also quantitate the PIN:NOS ratio over the course of IFN-γ treatment. Our findings provide important insights into IFN-γ–mediated antiviral responses in neurons.

Supplementary Material

Acknowledgments

We are grateful to Dr. Samie Jaffrey for the gift of the plasmid containing cDNA of PIN, PGEX-4T2-PIN, and Dr. Alice S. Huang for the gift of VSV and sheep anti-VSV antibody. Dr. Michele Pagano (NYU School of Medicine), Dr. Todd Holmes (UC Irvine Department of Physiology and Biophysics), and Dr. Jane A. McCutcheon (NYU College of Dentistry) generously participated in helpful discussions. This work was supported by NIH grants NS039746 and DC003536, and an NYU Research Challenge Fund award N5385 (to C.S.R).

References

  1. Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001;357:593–615. doi: 10.1042/0264-6021:3570593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bender AT, Demady DR, Osawa Y. Ubiquitination of neuronal nitric-oxide synthase in vitro and in vivo. J Biol Chem. 2000;275:17407–17411. doi: 10.1074/jbc.M000155200. [DOI] [PubMed] [Google Scholar]
  3. Bi Z, Reiss CS. Inhibition of vesicular stomatitis virus infection by nitric oxide. J Virol. 1995;69:2208–2213. doi: 10.1128/jvi.69.4.2208-2213.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chang TL, Reiss CS, Huang AS. Inhibition of vesicular stomatitis virus RNA synthesis by protein hyper-phosphorylation. J Virol. 1994;68:4980–4987. doi: 10.1128/jvi.68.8.4980-4987.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen N, Reiss CS. Distinct roles of eicosanoids in the immune response to viral encephalitis: or why you should take NSAIDS. Viral Immunol. 2002;15:133–146. doi: 10.1089/088282402317340288. [DOI] [PubMed] [Google Scholar]
  6. Chesler DA, McCutcheon JA, Reiss CS. Post-transcriptional regulation of neuronal nitric oxide synthase expression by IFN-gamma. J Interferon Cytokine Res. 2004;24:141–149. doi: 10.1089/107999004322813381. [DOI] [PubMed] [Google Scholar]
  7. Christopherson KS, Hillier BJ, Lim WA, Bredt DS. PSD-95 assembles a ternary complex with the N-methyl-D-aspartic acid receptor and a bivalent neuronal NO synthase PDZ domain. J Biol Chem. 1999;274:27467–27473. doi: 10.1074/jbc.274.39.27467. [DOI] [PubMed] [Google Scholar]
  8. Dedio J, Konig P, Wohlfart P, Schroeder C, Kummer W, Muller-Esterl W. NOSIP, a novel modulator of endothelial nitric oxide synthase activity. FASEB J. 2001;15:79–89. doi: 10.1096/fj.00-0078com. [DOI] [PubMed] [Google Scholar]
  9. Dreyer J, Schleicher M, Tappe A, Schilling K, Kuner T, Kusumawidijaja G, Muller-Esterl W, Oess S, Kuner R. Nitric oxide synthase (NOS)-interacting protein interacts with neuronal NOS and regulates its distribution and activity. J Neurosci. 2004;24:10454–10465. doi: 10.1523/JNEUROSCI.2265-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dunbar AY, Kamada Y, Jenkins GJ, Lowe ER, Billecke SS, Osawa Y. Ubiquitination and degradation of neuronal nitric-oxide synthase in vitro: dimer stabilization protects the enzyme from proteolysis. Mol Pharmacol. 2004;66:964–969. doi: 10.1124/mol.104.000125. [DOI] [PubMed] [Google Scholar]
  11. Fan JS, Zhang Q, Li M, Tochio H, Yamazaki T, Shimizu M, Zhang M. Protein inhibitor of neuronal nitric-oxide synthase, PIN, binds to a 17-amino acid residue fragment of the enzyme. J Biol Chem. 1998;273:33472–33481. doi: 10.1074/jbc.273.50.33472. [DOI] [PubMed] [Google Scholar]
  12. Ferrini MG, Magee TR, Vernet D, Rajfer J, Gonzalez-Cadavid NF. Penile neuronal nitric oxide synthase and its regulatory proteins are present in hypothalamic and spinal cord regions involved in the control of penile erection. J Comp Neurol. 2003;458:46–61. doi: 10.1002/cne.10543. [DOI] [PubMed] [Google Scholar]
  13. Goody RJ, Hoyt CC, Tyler KL. Reovirus infection of the CNS enhances iNOS expression in areas of virus-induced injury. Exp Neurol. 2005;195:379–390. doi: 10.1016/j.expneurol.2005.05.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gu Z, Kaul M, Yan B, Kridel SJ, Cui J, Strongin A, Smith JW, Liddington RC, Lipton SA. S-nitrosylation of matrix metalloproteinases: signaling pathway to neuronal cell death. Science. 2002;297:1186–1190. doi: 10.1126/science.1073634. [DOI] [PubMed] [Google Scholar]
  15. Hewett SJ. Interferon-gamma reduces cyclooxygenase-2-mediated prostaglandin E2 production from primary mouse astrocytes independent of nitric oxide formation. J Neuroimmunol. 1999;94:134–143. doi: 10.1016/s0165-5728(98)00240-9. [DOI] [PubMed] [Google Scholar]
  16. Hori K, Burd PR, Furuke K, Kutza J, Weih KA, Clouse KA. Human immunodeficiency virus-1-infected macrophages induce inducible nitric oxide synthase and nitric oxide (NO) production in astrocytes: astrocytic NO as a possible mediator of neural damage in acquired immunodeficiency syndrome. Blood. 1999;93:1843–1850. [PubMed] [Google Scholar]
  17. Jaffrey SR, Snowman AM, Eliasson MJ, Cohen NA, Snyder SH. CAPON: a protein associated with neuronal nitric oxide synthase that regulates its interactions with PSD95. Neuron. 1998;20:115–124. doi: 10.1016/s0896-6273(00)80439-0. [DOI] [PubMed] [Google Scholar]
  18. Jaffrey SR, Snyder SH. PIN: an associated protein inhibitor of neuronal nitric oxide synthase. Science. 1996a;274:774–777. doi: 10.1126/science.274.5288.774. [DOI] [PubMed] [Google Scholar]
  19. Jaffrey SR, Snyder SH. PIN: an associated protein inhibitor of neuronal nitric oxide synthase. Science. 1996b;274:774–777. doi: 10.1126/science.274.5288.774. [DOI] [PubMed] [Google Scholar]
  20. Kodukula P, Liu T, Rooijen NV, Jager MJ, Hendricks RL. Macrophage control of herpes simplex virus type 1 replication in the peripheral nervous system. J Immunol. 1999;162:2895–2905. [PubMed] [Google Scholar]
  21. Koedel U, Kohleisen B, Sporer B, Lahrtz F, Ovod V, Fontana A, Erfle V, Pfister HW. HIV type 1 Nef protein is a viral factor for leukocyte recruitment into the central nervous system. J Immunol. 1999;163:1237–1245. [PubMed] [Google Scholar]
  22. Komatsu T, Bi Z, Reiss CS. Interferon-gamma induced type I nitric oxide synthase activity inhibits viral replication in neurons. J Neuroimmunol. 1996;68:101–108. doi: 10.1016/0165-5728(96)00083-5. [DOI] [PubMed] [Google Scholar]
  23. Komatsu T, Ireland DD, Chen N, Reiss CS. Neuronal expression of NOS-1 is required for host recovery from viral encephalitis. Virology. 1999;258:389–395. doi: 10.1006/viro.1999.9734. [DOI] [PubMed] [Google Scholar]
  24. Kosugi I, Kawasaki H, Arai Y, Tsutsui Y. Innate immune responses to cytomegalovirus infection in the developing mouse brain and their evasion by virus-infected neurons. Am J Pathol. 2002;161:919–928. doi: 10.1016/S0002-9440(10)64252-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lane TE, Paoletti AD, Buchmeier MJ. Disassociation between the in vitro and in vivo effects of nitric oxide on a neurotropic murine coronavirus. J Virol. 1997;71:2202–2210. doi: 10.1128/jvi.71.3.2202-2210.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Parra B, Hinton DR, Marten NW, Bergmann CC, Lin MT, Yang CS, Stohlman SA. IFN-gamma is required for viral clearance from central nervous system oligodendroglia. J Immunol. 1999;162:1641–1647. [PubMed] [Google Scholar]
  27. Putzke J, Seidel B, Huang PL, Wolf G. Differential expression of alternatively spliced isoforms of neuronal nitric oxide synthase (nNOS) and N-methyl-D-aspartate receptors (NMDAR) in knockout mice deficient in nNOS alpha (nNOS alpha(Delta/Delta) mice) Brain Res Mol Brain Res. 2000;85:13–23. doi: 10.1016/s0169-328x(00)00220-5. [DOI] [PubMed] [Google Scholar]
  28. Reiss CS, Evans GA, Margulies DH, Seidman JG, Burakoff SJ. Allospecific and virus-specific cytolytic T lymphocytes are restricted to the N or C1 domain of H-2 antigens expressed on L cells after DNA-mediated gene transfer. Proc Natl Acad Sci USA. 1983;80:2709–2712. doi: 10.1073/pnas.80.9.2709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Rodriguez M, Zoecklein LJ, Howe CL, Pavelko KD, Gamez JD, Nakane S, Papke LM. Gamma interferon is critical for neuronal viral clearance and protection in a susceptible mouse strain following early intracranial Theiler’s murine encephalomyelitis virus infection. J Virol. 2003;77:12252–12265. doi: 10.1128/JVI.77.22.12252-12265.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Saura M, Zaragoza C, McMillan A, Quick RA, Hohenadl C, Lowenstein JM, Lowenstein CJ. An antiviral mechanism of nitric oxide: inhibition of a viral protease. Immunity. 1999;10:21–28. doi: 10.1016/S1074-7613(00)80003-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Shapshak P, Duncan R, Minagar A, Rodriguez de la Vega P, Stewart RV, Goodkin K. Elevated expression of IFN-gamma in the HIV-1 infected brain. Front Biosci. 2004;9:1073–1081. doi: 10.2741/1271. [DOI] [PubMed] [Google Scholar]
  32. Simon DI, Mullins ME, Jia L, Gaston B, Singel DJ, Stamler JS. Polynitrosylated proteins: characterization, bioactivity, and functional consequences. Proc Natl Acad Sci USA. 1996;93:4736–4741. doi: 10.1073/pnas.93.10.4736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sledz CA, Holko M, de Veer MJ, Silverman RH, Williams BR. Activation of the interferon system by short-interfering RNAs. Nat Cell Biol. 2003;5:834–839. doi: 10.1038/ncb1038. [DOI] [PubMed] [Google Scholar]
  34. Wang T, Scully E, Yin Z, Kim JH, Wang S, Yan J, Mamula M, Anderson JF, Craft J, Fikrig E. IFN-gamma-producing gamma delta T cells help control murine West Nile virus infection. J Immunol. 2003;171:2524–2531. doi: 10.4049/jimmunol.171.5.2524. [DOI] [PubMed] [Google Scholar]
  35. Xia Y, Berlowitz CO, Zweier JL. PIN inhibits nitric oxide and superoxide production from purified neuronal nitric oxide synthase. Biochim Biophys Acta. 2006;1760:1445–1449. doi: 10.1016/j.bbagen.2006.04.007. [DOI] [PubMed] [Google Scholar]
  36. Yang J, Tugal D, Reiss CS. The role of the proteasome-ubiquitin pathway in regulation of the IFN-gamma mediated anti-VSV response in neurons. J Neuroimmunol. 2006;181:34–45. doi: 10.1016/j.jneuroim.2006.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhou HJ, Tsai SY, Tsai MJ. RNAi technology and its use in studying the function of nuclear receptors and coregulators. Nucl Recept Signal. 2003a;1:e008. doi: 10.1621/nrs.01008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhou HJ, Tsai SY, Tsai MJ. RNAi technology and its use in studying the function of nuclear receptors and coregulators. Nucl Recept Signal. 2003b;1:e008. doi: 10.1621/nrs.01008. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS66992-supplement-supplement_1.pdf (52.2KB, pdf)

RESOURCES