Skip to main content
Viral Immunology logoLink to Viral Immunology
. 2008 Jun;21(2):141–152. doi: 10.1089/vim.2007.0109

Disruption of IFN-γ-Mediated Antiviral Activity in Neurons: The Role of Cannabinoids

R Antonio Herrera 1,,*, Joseph H Oved 1,,*, Carol Shoshkes Reiss 1,,2,,3,,4,
PMCID: PMC2556635  NIHMSID: NIHMS66988  PMID: 18570588

Abstract

Interferon-γ (IFN-γ) has potent antiviral activity in neurons which is affected by the production of nitric oxide (NO). This study examines the interactions between cannabinoid receptor-1 (CB1), IFNγ–induced pathways, and inhibition of vesicular stomatitis virus (VSV) replication in neuronal cells. CB1 is abundantly expressed in neurons of the CNS and the NB41A3 neuroblastoma cell line. CB1 activation of NB41A3 cells by the synthetic cannabinoid, WIN55,212-2, is associated with an inhibition of Ca2+ mobilization, leading to diminished nitric oxide synthase (NOS)-1 activity and the production of NO, in vitro. This ultimately results in antagonism of IFN-γ–mediated antiviral activity and enhanced viral replication. Therefore, activation of cells expressing CB1 by endogenous (or exogenous) ligands may contribute to decreased inflammation and to increased viral replication in neurons and disease in the CNS.

Introduction

Intranasal administration of vesicular stomatitis virus (VSV) to immunocompetent mice results in an acute infection that can lead to host death (33,34,63). The expression of the neuronal isoform of nitric oxide synthase (NOS-1) is critical for host survival and elimination of VSV infection from infected neurons (44). NOS-1 activity is regulated by many factors, including substrate, tetrahydrobiopterin, protein inhibitor of NOS-1, and cellular calcium-activated kinases. (9,18,21,32,39,57). NOS-1 accumulates in neurons exposed to inflammatory cytokines such as interleukin (IL)-12 and IFN-γ (13,16,17,43,79). This study was performed to investigate if a lipid mediator, naturally produced in the CNS, which is capable of binding to neurons, was able to alter the cell-autonomous antiviral response of neurons to IFN-γ.

Cannabinoids derive from three sources of lipid molecules: endogenously synthesized endocannabinoids, compounds from some plants (e.g., marijuana), or pharmaceutically manufactured chemicals. Two receptors that are expressed on distinct cell types have been well described: CB1 expressed by neurons, and CB2 expressed by cells of the reticuloendothelial system including microglia (48,60,61,73,74). The functions of these receptors are distinct, although the same signaling pathways are used: the serpentine 7-transmembrane receptor is G-protein coupled, negatively regulates Ca2+ channels resulting in inhibition of Ca2+ release, activates a signal transduction cascade of Raf-1, MEK, and ERK, as well as adenyl cyclase, ultimately activating protein kinase A (5,22,50,51).

Signaling through the CB1 receptor is associated with sensory responses (77) including analgesia (56), hypothermia (12,76), immobility, euphoria (47), and hyperphagia (12,30). In contrast, activation of cells expressing the CB2 receptor has indicated that CB2 is a negative regulator of monocyte and microglial activation (23,48), and hence is immuno-dampening. Many agonists or antagonists are able to bind and activate both, but selective receptor agonists target either immune or neuronal responses.

Endocannabinoids may be released locally and have paracrine effects in the CNS (4) or may have affects on infiltrating inflammatory cells (24,68,73,74); alternatively, ingested or administered drugs may have systemic effects (19). Determining the contribution of the distinct receptors is potentially ambiguous when you consider both the ability of unselective ligands to trigger both receptors and the regulation of cell-autonomous innate immune responses to viral infections of neurons in the CNS. To begin to dissect this, in this study we have examined the in vitro effects of synthetic cannabinoids and an antagonist on the ability of IFN-γ to inhibit VSV replication in neuronal cells. We have found that cannabinoid signaling suppresses the production of NO and antagonizes the beneficial antiviral activity of IFN-γ, resulting in enhanced production of viral progeny.

Materials and Methods

Cell culture, virus, and reagents

NB41A3, HN9e, N18, L929, and RAW 264.7 cells were purchased from ATCC, and were maintained as previously described (37). All tissue culture reagents were obtained from Mediatech (Manassas, VA). VSV, Indiana serotype, San Juan strain, originally obtained from Alice S. Huang (The Children's Hospital, Boston, MA) was used in all viral studies. Recombinant murine IFN-γ was purchased from R&D Systems (Minneapolis, MN) and used at a concentration of 20 ng/mL. Agonists WIN55,212-2 (WIN55) and anandamide (AEA), and the CB1 antagonist AM251 were purchased from Tocris USA (Ellisville, MO). U0126, a MEK1/2 inhibitor, was purchased from Cell Signaling Technology (Danvers, MA). Preliminary experiments were performed to optimize the doses of all drugs; drug ranges were initially based on published studies. Propridium iodide (PI) and 7-nitroindazole (7-NI) were purchased from Sigma. CalciumGreen-AM, was purchased from Invitrogen Molecular Probes (Carlsbad, CA).

Cell viability assays

Cell viability was determined by the Cell Titer 96 Aqueous Non-Radioactive Cell Proliferation colorimetric assay (Promega, Fitchburg, WI) following cannabinoid agonist and antagonist treatments. Triplicate samples of 1 × 104 cells were seeded per time point with 100 μL media in 96-well flat-bottom plates, then 20 μl of freshly mixed MTS reagent was added to each well and incubated for 4h. Absorbance was determined at 490 nm using a microplate reader (Model 550; Bio-Rad, Hercules, CA), and the results expressed as the mean absorbance of triplicate experiments ± SE. Based on viability assays (Fig. 1) we concluded that treatment of NB41A3 cells with up to 10 μM WIN55 is not harmful.

FIG. 1.

FIG. 1.

Cytotoxicity of WIN55 and AEA. Neither WIN55 nor AEA are toxic to NB41A3 cells. NB41A3 cells were cultured with AEA (diamonds) or WIN55 (triangles) at concentrations starting with 10 mM and serially diluted 105-fold. Viability was assessed by the Promega cytotoxicity kit, following the manufacturer's directions, as described in the text. NaN3 is a positive control for uncoupling of mitochondrial function (toxicity). Addition of media alone is the “Cntrl” sample to set 100% viability.

RT-PCR

mRNA levels were determined by multiplex RT-PCR using the Qiagen One-Step RT-PCR kit (Germantown, MD). Total RNA was used in each reaction. The following program was used to carry out the reaction: lid preheated to 105°C then 50°C for 30 min, 95°C for 15 min, 39 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, then 72°C for 10 min, and 4°C hold. Products were resolved by 1.5% agarose gel electrophoresis, stained using ethidium bromide, and visualized using a UV transilluminator. Results were digitally photographed using a Kodak DC290 camera controlled by Kodak 1D analytical software (Eastman Kodak, Rochester, NY). Primers used for RT-PCR are shown in Table 1.

Table 1.

The Primers Used for RT-PCR

CB1 gtcaccagtgtgctgttgct tgtctcaggtccttgctcct
β-Actin gccactgccgcatcctcttcctcc gccctggctgcctcaacacctcaa
CB2 tcattgccatcctcttttcc Gaaccagcatatgagcagca

Plaque assays

Viral titers were determined in triplicate using serially diluted culture supernatants on monolayers of L929 cells as previously described (43).

Western blot

Cell lysates were prepared in the presence of both protease and phosphatase inhibitors, protein concentrations were determined using the Bio-Rad DC protein assay, and samples were boiled for 5 min in SDS sample buffer with 2-mercaptoethanol. Samples were resolved by 10%, 12%, or 14% SDS-PAGE electrophoresis, transferred to Transblot™ membranes (Bio-Rad), and incubated for either 1 h at ambient temperature or overnight at 4°C with primary antibodies, and then probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at ambient temperature. Membranes were visualized with Pierce PicoWest Enhanced™ Chemiluminescent Reagents (Pierce Immnuochemical, Rockford, IL, USA). Film exposure was on Kodak BioMax™ (Eastman Kodak, Rochester, NY, USA) film for 3 min. Protein band densities were quantitated using UN-SCAN-IT™ software.

Antibodies

Primary antibody reagents included rabbit anti-N-terminus of CB1 (Invitrogen BioSource; 1:1000). Mouse mAb anti-GAPDH (ABCAM, 1:100,000), sheep anti-VSV (1:100,000; a generous gift from Dr. Alice S. Huang), rabbit anti-ERK (p42/p44 MAP kinase; 1:1000), and mAb anti-phospho-ERK (1:1000 for Western blot and 1:50 for immunohistochemistry) were purchased from Cell Signaling. Mouse mAb 5A7, anti-IL-12Rβ2 was the generous gift of Jerome Ritz, Dana-Farber Cancer Institute (75). HRP-conjugated anti-mouse and anti-rabbit secondary antibodies (1:2000) were purchased from Vector (Vector Laboratories, Burlingame, CA, USA) and Zymax (Zymax: Spectrum Laboratories, Rancho Dominguez, CA, USA), and HRP-conjugated donkey anti-sheep (1:4000) was purchased from Jackson ImmunoResearch (West Grove, PA).

Greiss assay

Nitrite levels were measured by the Nitrite/Nitrate Colorimetric Assay Kit from Cayman Chemical (Ann Arbor, MI). NB41A3 cells were treated with IFN-γ, and either 10 μM WIN55 or 400 μM 7-NI 24 h later. Supernatants were collected and then incubated for 2 h at room temperature with nitrate reductase. Greiss reagent was added to triplicate samples, and the product was read with a Bio-Rad Microplate model 550 Reader at 540 nm.

Calcium measurement

NB41A3 cells (50,000 cells/well incubated overnight) were treated for 1, 5, and 15 min with either 10 μM WIN55 or 400 μM N-methyl D-aspartate (Sigma), or mock-treated for 1, 5, and 15 min. Before fixation, cells were incubated with 10 μM CalciumGreen-AM (Invitrogen Molecular Probes) for 1 h. CalciumGreen-AM is a cell permeant ester that is cleaved and sequestered in the cytosol. Cell nuclei were labeled with PI. Cells were assessed by confocal microscopy on a Leica instrument (LeicaMicrosystems, Inc., Bannockburn, IL, USA).

Immunocytochemistry

In some experiments, NB41A3 cells were cultured on glass slides coated with poly-D-lysine. Twenty-four hours after WIN55 treatment, cells were fixed in 4% paraformaldehyde, and then permeabilized with 0.1% Triton X-100. In other experiments, NB41A3 cells were plated on fibronectin-coated Aclar film and treated for 1 hour with either WIN55 or AEA. Cells were then fixed and stained with primary antibodies. Primary rabbit anti-CB1 N-terminus, mAb anti-IL-12Rβ2, or mAb anti-phospho-ERK were utilized. Following treatment with secondary goat anti-rabbit AlexaFluor-488 (Invitrogen Molecular Probes) or secondary rabbit anti-mouse AlexaFluor-546, cells were covered with Vectashield Hardset (Vector Labs, Burlingame, CA) with DAPI and/or propidium iodide, and analyzed by confocal microscopy on a Leica confocal microscope.

Detection of phospho-ERK1/2

Wells of NB41A3 cells were treated with 10 μM WIN55 or 10 μM AEA for 1, 5, 5, 30, and 60 min. In some samples, 10 μM AM251 (a CB1 antagonist) or 10 μM U0126 (a MEK1/2 antagonist) were added 1 h prior to WIN55 administration to inhibit ERK phosphorylation. Cell lysates were isolated for Western blot in the presence of protease and phosphatase inhibitors (Calbiochem). Techniques described above in the sections on Western blot and immunohistochemistry were utilized to visualize phospho-ERK1/2 and total ERK1/2 in NB41A3 cells.

Statistical analysis

To determine if there was a significant difference among the groups, means ± SEM of each group were compared using a parametric ANOVA. The results were considered significant for a p value <0.05.

Results

CB1 but not CB2 mRNA is expressed in NB41A3 neuroblastoma cells

NB41A3 cells, a mouse neuroblastoma line, has been used extensively for studies of VSV infection, of responses to cytokines, and of dynamics of NOS-1 activity (8,1315,36,37,44,78,79). To determine if the NB41A3 cell line was appropriate for our experimental system, the reverse transcription polymerase chain reaction (RT-PCR) was performed to detect CB1 or CB2 mRNA transcripts. NB41A3, RAW264.7, N18, HN9e, and L929 cells were used for RNA extraction. As expected, NB41A3, HN9e, and N18 cells showed significant expression of CB1 mRNA transcripts, while RAW264.7 and L929 cells did not (Fig. 2A). RAW264.7 cells served as a positive control for CB2 mRNA expression (not shown). NB41A3 cells did not express detectable levels of CB2 mRNA transcripts.

FIG. 2.

FIG. 2.

Expression of CB1 by neuronal cells. (A) RT-PCR results of CB1 mRNA expression in NB41A3, HN9e, and N18 cells, but not in L929 cells. β-Actin was used as a loading control. From left to right the lanes are NB41A3, HN9e, N18, and L929. (B) NB41A3 cells were plated on microscope slides and fixed with 8% paraformaldehyde. Cells were probed with antiCB1. (C) DIC microscopic image of the same single cell. (D) CB1 expression is unaffected by treatment with agonist. Densitometry (right) of Western blot (left) bands from NB41A3 cells treated with 10 μM WIN55 for 24 h. These indicate that there is no significant degradation of CB1 upon treatment with WIN55. Error bars indicate ± 2 standard deviations.

Expression of CB1 protein by neuronal cells

In an effort to determine if the CB1 mRNA transcripts in NB41A3 cells were translated into functional receptor proteins we examined the CB1 protein and localization by fluorescence microscopy and Western blot analysis. Confocal microscopy indicated that CB1 protein was localized to the plasma membrane and vesicles within NB41A3 cells (Fig. 2B and C). Western blot experiments showed CB1 protein in whole-cell lysates. CB1 was not degraded following treatment of NB41A3 cells with the receptor agonist WIN55 (Fig. 2D). These data confirm that CB1 receptor protein is expressed by the NB41A3 cell line.

CB1 undergoes capping upon agonist treatment

We used immunofluorescence and confocal microscopy to examine the distribution of the CB1 receptor following agonist treatment. NB41A3 cells were plated on fibronectin-coated Aclar film and treated for 1 h with either a synthetic cannabinoid (WIN55), or the endocannabinoid AEA. Cells were then fixed and stained using primary antibodies against CB1 and IL-12Rβ2, expressed on the plasma membranes of neuronal cells (37), as a positive control. As shown in Fig. 3, there was no evidence of endocytosis of the receptor CB1 receptor following treatment.

FIG. 3.

FIG. 3.

Distribution of CB1 receptor is affected by agonist treatment. (A) Untreated NB41A3 cells. (B) NB41A3 cells treated with 10 μM WIN55 for 24 h. (C) NB41A3 cells treated with 10 μM AEA for 24 h. Overlay indicates membrane association of CB1 and the IL-12Rβ2. Notice the morphological changes in receptor localization and capping of CB1 following treatment with either agonist. Bar = 7 μM.

Instead, we observed significant morphological changes in WIN55- and AEA-treated cells when compared to untreated cells. This change in morphology was not associated with apoptosis. Furthermore, the CB1 protein was mobilized along the plasma membrane (Fig. 3), into patches and caps. We interpret these data to be consistent with the concept that CB1 ligand-receptor binding leads to cytoskeletal rearrangement, which results in change in the cell's shape and receptor distribution into patches; this is indicative of functional activation of the CB1 receptor by its ligand.

CB1 signals through the mitogen-activated protein kinase system

One of the major signal transduction pathways CB1 uses is the mitogen-activated protein kinase (MAP kinase) cascade. We treated NB41A3 cells with either WIN55 or AEA for 1, 5, 15, 30, or 60 min. Whole-cell lysates were collected and Western blots were performed using anti-p42/44 (ERK) and anti-phospho-p42/22 (pERK). A significant increase in pERK was seen at 1 and 5 min after addition of the agonist, and to some extent at the 15-min time point, in both WIN55- (not shown) and AEA-treated samples (Fig. 4A). These data indicate that in neuronal cultures, CB1 signals through the MAP kinase cascade.

FIG. 4.

FIG. 4.

Cannabinoid treatment of neuronal cells activates the MAP kinase pathway. Western blots of phosphorylated ERK (pERK; p-p44/p-p42) were done to examine if CB1 agonists activated the MAP kinase pathway. (A) AEA treatment rapidly activates the MAP kinase cascade and there is a strong induction of pERK as early as 1 min after addition of the agonist. The membrane was stripped and reprobed with anti-ERK to indicate total ERK protein, lower panel. (B) The addition of either AM251 (a CB1 antagonist, lanes 3 and 4) or U0126 (a MEK1/2 inhibitor, lanes 5 and 6) abrogated the WIN55 (lanes 2, 4, and 6) and mediated upregulation of pERK at either 1 min (top pair of gels) or 15 min (bottom pair of gels) after agonist challenge. As in A above, after detection of pERK, membranes were stripped and reprobed for total ERK.

In order to further assess CB1 activation of MAP kinases, AM251 (a CB1 receptor antagonist) or U2106 (a MEK-1/2 inhibitor) was added to NB41A3 cultures before the addition of WIN55. MEK is upstream from ERK in the MAP kinase cascade. When these protein samples were analyzed by Western blot, the induction of pERK was inhibited by both AM251 and U2106 to levels below the level of detection both at 1 min and at 15 min after WIN55 stimulation (Fig. 4B). We interpret these data to indicate that AM251 blocked WIN55 binding to CB1, and that inhibition of the upstream enzyme, MEK, by U2106, prevented ERK phosphorylation. In addition, these data are consistent with the interpretation that the response to CB1 agonist is not delayed in the presence of antagonists, but rather is prevented. Therefore WIN did not successfully signal (induce phosphorylation of ERK1/2) in cells treated with either a receptor or kinase antagonist.

Generally, when ERK is phosphorylated, it undergoes nuclear translocation and acts as a transcription factor (70). To confirm and extend the Western blot analysis we examined the cellular location of pERK by confocal microscopy. NB41A3 cells were cultured on fibronectin-coated Aclar film. Cells were stimulated with WIN55 for 1, 15, or 30 min and were then fixed, and stained with anti-ERK and anti-pERK antibodies. Our data from these immunofluorescence experiments are consistent with the results from the Western blot assays (Fig. 4). The 3D confocal images indicate that pERK translocated to the nucleus as early as 1 min post-WIN55 treatment (Fig. 5). Taken together, these data provide strong evidence for CB1 signaling through the MAP kinase pathway in neuroblastoma cells. The activation of this pathway may be central to CB1's many broad effects including its role in immunomodulation.

FIG. 5.

FIG. 5.

Phospho-ERK is translocated to the nucleus following cannabinoid treatment of neuronal cells. NB41A3 cells were treated with 10 μM WIN55 for 1, 15, or 30 min and three-dimensional confocal images were generated. Nuclear localization of pERK is apparent at 1 min. Nuclei were stained with PI. Bar = 7 μM.

Intracellular Ca2+ in WIN-treated NB41A3 cells

Neuronal signaling relies on stringent control of intracellular Ca2+ levels through a variety of mechanisms (e.g., NMDA receptors and GQ proteins). Previous reports have shown that under a variety of physiological conditions CB1 ligands modulate Ca2+ influx into neurons (26,45). CalciumGreen-AM is a cell permeant ester that is cleaved in the cytosol and cannot transverse the membrane once inside the cell. Free Ca2+ binds CalciumGreen-AM, inducing fluorescence at 488 nm. In an effort to determine if CB1 activation had an effect on intracellular Ca2+ levels in this neuronal cell line, NB41A3 cells were incubated with 10 μM CalciumGreen-AM for 1 h and then treated with 10 μM WIN55 or 400 μM N-methyl D-aspartate (NMDA) for 1, 5, or 15 minutes. The cells were then fixed and stained with propidium iodide to indicate nuclei. The data shown in Fig. 6 indicate that NMDA rapidly induced an influx of Ca2+ into the cytosol, shown as bright green staining at 1 min after addition of NMDA, fading over the observation period. WIN55 binding of CB1 does not increase intracellular Ca2+ levels, and appear very similar to untreated neuronal cells (top far right panel), which are detected only by virtue of nuclear staining.

FIG. 6.

FIG. 6.

NB41A3 cells treated with NMDA had rapid influx of intracellular calcium, while cells treated with WIN55 did not. Green indicates CalciumGreen fluorescence, indicative of free Ca2+ in the cytoplasm. Untreated cells (top right panel labeled “Negative”) were used as a control for the effects of NMDA (top panels) or WIN55 (bottom panels) on cells. NB41A3 cells were incubated with CalciumGreen for 1 h prior to addition of either NMDA or WIN55, then fixed at the indicated time and stained with PI to indicate nuclei (red). Bar = 7 μM.

CB1 activation inhibits IFN-γ–induced intracellular NO concentrations

In neurons, the antiviral effect of IFN-γ involves an increase in NO via increased neosynthesis and stability of NOS-1 (14,79). NOS-1 is a Ca2+- and calmodulin-dependent enzyme (9,21,57). Since WIN55 may limit intracellular Ca2+ levels (Fig. 6), one potential mechanism through which it might be antagonizing the IFN-γ antiviral response is by inhibiting the synthesis of NO. In order to test this hypothesis, we examined NO production, by measuring nitrite levels in supernatants of NB41A3 cells treated with both IFN-γ and WIN55, compared to cells treated solely with IFN-γ. Treatment with IFN-γ and WIN55 results in diminished production of NO (Fig. 7) when compared to neuronal cells that were treated only with IFN-γ.

FIG. 7.

FIG. 7.

Production of NO is inhibited by treatment with WIN55. Greiss assays were done to measure nitrite, a stable by-product of NO (nitrate was converted to nitrite prior to reaction). Line graph showing nitrite concentrations in supernatants from NB41A3 cells treated with IFN-γ, WIN55, or 7-NI (a NOS-1-selective enzyme antagonist). Error bars represent SEM. Asterisk indicates IFN versus IFN + 7-NI; p = 0.004. Daggers indicate IFN versus IFN + WIN; p = 0.0112. Both WIN55 and 7-NI treatment result in substantial and significant inhibition of induction of IFN-γ by NO production.

CB1 activation alters the IFN-γ antiviral response in neurons in vitro

We have previously shown that IFN-γ induces a potent antiviral response in neurons, and leads to a ∼100-fold reduction in VSV viral titers over untreated cells. In order to examine if CB1 activation modified the IFN-γ–induced antiviral response, NB41A3 cells were pretreated with IFN-γ for 24 h, followed by a 24-h treatment with WIN55, then the cells were infected with VSV at a multiplicity of infection of 0.1 for 7 h. Supernatants were collected, and viral titers were analyzed by plaque assay. Although WIN55 treatment itself had no discernible effect on the neuronal response to viral infection (p = 0.42), we found that when the NB41A3 cells were pretreated with IFN-γ and subsequently treated with WIN55, there was a 10-fold increase in infectious virus released, compared to NB41A3 cells that were treated solely with IFN-γ (Fig. 8A) (p = 0.00053). While CB1 activation antagonized the IFN-γ–induced antiviral response, it does not completely abrogate the antiviral activity of IFN-γ.

FIG. 8.

FIG. 8.

Cannabinoid treatment of neuronal cells antagonizes IFN-γ–mediated inhibition of VSV replication. (A) NB41A3 cells were pretreated for 48 h with 20 ng IFN-γ. 24 h before VSV infection the cells were treated with 10 μM WIN55. Viral supernatants were collected 7 h post-infection and virus was measured by plaque assay on L929 cells in triplicate samples. (B) Western blot analysis of VSV proteins and GAPDH in infected NB41A3 cells. (C) Densitometric analysis of Western blot, VSV M protein normalized to GAPDH levels, based on five separate experiments. **p ≤ 0.005.

CB1 agonist treatment partially abrogates the IFN-γ–induced inhibition of VSV protein synthesis in NB41A3 cells

IFN-γ treatment of neurons inhibits viral replication by inhibiting VSV protein synthesis in infected NB41A3 cells (15,43). In order to elucidate the mechanism by which CB1 partially antagonizes the IFN-γ response, NB41A3 cells were pretreated with IFN-γ followed by WIN55. The cells were subsequently infected with VSV at a multiplicity of infection of 1.0. At 5 h post-infection, whole-cell lysates were collected and protein samples were analyzed by Western blot (Fig. 8B). These data are consistent with the viral replication assays. WIN55 treatment on its own did not exert any detectable changes in viral protein concentrations (p = 0.539), while IFN-γ treatment reduced synthesis of all five viral proteins (p = 0.00969). Viral protein production was intermediate in cells that were pretreated with IFN-γ followed by WIN55 treatment (p = 0.0039), a result of partial antagonism of the IFN-γ–induced viral protein synthesis inhibition (Fig. 8C). These data indicate that CB1 agonists antagonize the IFN-γ–induced antiviral response in neuronal cells in vitro.

Discussion

Treatment of neuronal cells expressing the CB1 receptor (Fig. 2) with WIN55 results in patching and capping of the receptor (Fig. 3), activation of the MAP kinase cascade (Fig. 4), phosphorylation of ERK (Fig. 5), and no increase in cellular Ca2+ concentrations (Fig. 6). Neuronal cells treated with WIN55 produce less nitrite, the stable end-product of NOS-1 (Fig. 7) and, most importantly, WIN55 antagonizes the inhibition of VSV replication, which is associated with IFN-γ treatment (Fig. 8), resulting in 10-fold enhanced viral yields. These data are consistent with a model in which cannabinoid regulation of intracellular Ca2+ levels in neurons diminishes NOS-1 activity and NO production, and therefore suppresses the inhibition of VSV replication which would otherwise be effected by IFN-γ.

Endogenous cannabinoids are released following injury to the brain (50,62). Cannabinoids may contribute to neurogenesis by antagonizing NO production (41) and may be protective in ischemia (7,71) and excitotoxicity (28,42).

An indirect anti-inflammatory effect of cannabinoids has been associated with activation of the nuclear transcription factor PPAR family (10,59,72). CB2 receptor activation may lead to release of endogenous opioids, which inhibit inflammatory pain (35,64). Somewhat unexpectedly, the anti-nociceptive and anti-pyretic effects of acetaminophen may be due to binding CB1 receptors (2,66).

Cannabinoids have been shown to be neuroprotective in several inflammatory or neurodegenerative diseases including Alzheimer's disease, Parkinson's, experimental autoimmune allergic encephalomyelitis, stroke, and excitotoxicity (25,27,28,38,49,65). These lipid molecules may target microglial activation (6,60,68,69,73). WIN55 may also induce PGE2 (52). Thus, where inflammation contributes to pathology, cannabinoids may be beneficial.

In an infection model in which inflammation contributes to pathology (Theiler's murine encephalomyelitis virus infection [TMEV]), WIN55 treatment ameliorates clinical disease (20,53). Another potentially beneficial cannabinoid effect may be protection of BBB integrity during infections in which microglial NOS-2 (iNOS) is overactive, such as Borna virus infection (31). In both TMEV and Borna viral disease, the effect is probably attributable to CB2-expressing cells.

In contrast, Δ9-tetrahydrocannabinol treatment decreases host resistance to HSV-2 infection in both mice and guinea pigs (11,54), possibly by inhibiting host inflammatory immune responses against the virally-infected cells; like VSV, herpesviruses are sensitive to the antiviral effects of NO (1,40). However, cannabinoids may contribute to syncytia formation in HIV-E (58), which is associated with disease pathology; the mechanism of this phenomenon may be suppressing inhibition of viral gene expression. In the case of VSV, WIN55 treatment resulted in enhanced viral replication (Fig. 8).

Conclusion

We speculate that in models of infection in which the replication is sensitive to NO-associated inhibition [roughly half of viruses studied (3,29,46,67)], cannabinoids promote viral replication and disease. Replication may be enhanced by the paracrine release of cannabinoids in response to viral infection–associated neuronal injury (50,62). However, in those other viral infections in which inflammation is deleterious, cannabinoids are potentially beneficial.

Since cannabinoids are both widely used recreational drugs (55), and their receptors are therapeutic targets (60), understanding the impact of agonists and antagonists for the CB1 and CB2 receptors on the outcome of viral infections, especially those in the CNS, is important. Work is in progress to examine the in vivo effects and to distinguish between effects on cell autonomous pathways from inflammation-associated contributions of the CB2-bearing cells.

References

  • 1.Adler H. Beland JL. Del-Pan NC. Kobzik L. Brewer JP. Martin TR. Rimm IJ. Suppression of herpes simplex virus type 1a(HSV-1)-induced pneumonia in mice by inhibition of inducible nitric oxide synthase (iNOS, NOS2) J Exp Med. 1997;185:1533–1540. doi: 10.1084/jem.185.9.1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ahn DK. Choi HS. Yeo SP, et al. Blockade of central cyclooxygenase (COX) pathways enhances the cannabinoid-induced antinociceptive effects on inflammatory temporo-mandibular joint (TMJ) nociception. Pain. 2007;132:23–32. doi: 10.1016/j.pain.2007.01.015. [DOI] [PubMed] [Google Scholar]
  • 3.Akaike T. Maeda H. Nitric oxide and virus infection. Immunology. 2000;101:300–308. doi: 10.1046/j.1365-2567.2000.00142.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Alger BE. Endocannabinoid identification in the brain: Studies of breakdown lead to breakthrough, and there may be NO hope. Sci. STKE. 2005:e51. doi: 10.1126/stke.3092005pe51. [DOI] [PubMed] [Google Scholar]
  • 5.Andersson M. Usiello A. Borgkvist A, et al. Cannabinoid action depends on phosphorylation of dopamine- and cAMP-regulated phosphoprotein of 32 kDa at the protein kinase A site in striatal projection neurons. J Neurosci. 2005;25:8432–8438. doi: 10.1523/JNEUROSCI.1289-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bahr BA. Karanian DA. Makanji SS. Makriyannis A. Targeting the endocannabinoid system in treating brain disorders. Expert Opin Investig Drugs. 2006;15:351–365. doi: 10.1517/13543784.15.4.351. [DOI] [PubMed] [Google Scholar]
  • 7.Belayev L. Busto R. Watson BD. Ginsberg MD. Post-ischemic administration of HU-211, a novel non-competitive NMDA antagonist, protects against blood-brain barrier disruption in photochemical cortical infarction in rats: a quantitative study. Brain Res. 1995;702:266–270. doi: 10.1016/0006-8993(95)01127-9. [DOI] [PubMed] [Google Scholar]
  • 8.Bi Z. Reiss CS. Inhibition of vesicular stomatitis virus infection by nitric oxide. J Virol. 1995;69:2208–2213. doi: 10.1128/jvi.69.4.2208-2213.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bredt DS. Snyder SH. Nitric oxide: A physiologic messenger molecule. Ann Rev Biochem. 1994;63:175–195. doi: 10.1146/annurev.bi.63.070194.001135. [DOI] [PubMed] [Google Scholar]
  • 10.Burstein S. PPAR-gamma: a nuclear receptor with affinity for cannabinoids. Life Sci. 2005;77:1674–1684. doi: 10.1016/j.lfs.2005.05.039. [DOI] [PubMed] [Google Scholar]
  • 11.Cabral GA. Mishkin EM. Marciano-Cabral F. Coleman P. Harris L. Munson AE. Effect of delta 9-tetrahydro-cannabinol on herpes simplex virus type 2 vaginal infection in the guinea pig. Proc Soc Exp Biol Med. 1986;182:181–186. doi: 10.3181/00379727-182-42325. [DOI] [PubMed] [Google Scholar]
  • 12.Chaperon F. Thiebot MH. Beneficial effects of cannabinoid agents in animals. Crit Rev Neurobiol. 1999;13:243–281. doi: 10.1615/critrevneurobiol.v13.i3.20. [DOI] [PubMed] [Google Scholar]
  • 13.Chesler DA. Dodard C. Lee GY. Levy DE. Reiss CS. Interferon-gamma-induced inhibition of neuronal vesicular stomatitis virus infection is STAT1 dependent. J Neurovirol. 2004;10:57–63. doi: 10.1080/13550280490261707. [DOI] [PubMed] [Google Scholar]
  • 14.Chesler DA. McCutcheon JA. Reiss CS. Posttranscriptional regulation of neuronal nitric oxide synthase expression by IFN-gamma. J Interferon Cytokine Res. 2004;24:141–149. doi: 10.1089/107999004322813381. [DOI] [PubMed] [Google Scholar]
  • 15.Chesler DA. Munoz-Jordan JL. Donelan N. Garcia-Sastre A. Reiss CS. PKR is not required for interferon-gamma inhibition of VSV replication in neurons. Viral Immunol. 2003;16:87–96. doi: 10.1089/088282403763635474. [DOI] [PubMed] [Google Scholar]
  • 16.Chesler DA. Reiss CS. IL-12, while beneficial, is not essential for the host response to VSV encephalitis. J Neuroimmunol. 2002;131:92–97. doi: 10.1016/s0165-5728(02)00257-6. [DOI] [PubMed] [Google Scholar]
  • 17.Chesler DA. Reiss CS. The role of IFN-gamma in immune responses to viral infections of the central nervous system. Cytokine Growth Factor Rev. 2002;13:441–454. doi: 10.1016/s1359-6101(02)00044-8. [DOI] [PubMed] [Google Scholar]
  • 18.Coleman JW. Nitric oxide in immunity and inflammation. Int Immunopharmacol. 2001;1:1397–1406. doi: 10.1016/s1567-5769(01)00086-8. [DOI] [PubMed] [Google Scholar]
  • 19.Croxford JL. Therapeutic potential of cannabinoids in CNS disease. CNS Drugs. 2003;17:179–202. doi: 10.2165/00023210-200317030-00004. [DOI] [PubMed] [Google Scholar]
  • 20.Croxford JL. Miller SD. Immunoregulation of a viral model of multiple sclerosis using the synthetic cannabinoid R(+)WIN55,212. J Clin Invest. 2003;111:1231–1240. doi: 10.1172/JCI17652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Dawson TM. Zhang J. Dawson VL. Snyder SH. Nitric oxide: cellular regulation and neuronal injury. Prog Brain Res. 1994;103:365–369. doi: 10.1016/s0079-6123(08)61150-4. [DOI] [PubMed] [Google Scholar]
  • 22.Diaz-Laviada I. Ruiz-Llorente L. Signal transduction activated by cannabinoid receptors. Mini Rev Med Chem. 2005;5:619–630. doi: 10.2174/1389557054368808. [DOI] [PubMed] [Google Scholar]
  • 23.Ehrhart J. Obregon D. Mori T, et al. Stimulation of cannabinoid receptor 2 (CB2) suppresses microglial activation. J Neuroinflammation. 2007;12:2–29. doi: 10.1186/1742-2094-2-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Eljaschewitsch E. Witting A. Mawrin C, et al. The endocannabinoid anandamide protects neurons during CNS inflammation by induction of MKP-1 in microglial cells. Neuron. 2006;49:67–79. doi: 10.1016/j.neuron.2005.11.027. [DOI] [PubMed] [Google Scholar]
  • 25.Fernandez-Lopez D. Martinez-Org E. Nunez J. Romero P. Lorenzo M. Moro A. Lizasoain I. Characterization of the neuroprotective effect of the cannabinoid agonist WIN-55212 in an in vitro model of hypoxic-ischemic brain damage in newborn rats. Pediatr Res. 2006;60:169–173. doi: 10.1203/01.pdr.0000228839.00122.6c. [DOI] [PubMed] [Google Scholar]
  • 26.Fisyunov A. Tsintsadze V. Min R. Burnashev N. Lozovaya N. Cannabinoids modulate the P-type high-voltage-activated calcium currents in Purkinje neurons. J Neurophysiol. 2006;96:1267–1277. doi: 10.1152/jn.01227.2005. [DOI] [PubMed] [Google Scholar]
  • 27.González S. Scorticati C. Garcia-Arencibia M. de Miguel R. Ramos JA. Fernández-Ruiz J. Effects of rimonabant, a selective cannabinoid CB1 receptor agonist, in a rat model of Parkinson's disease. Brain Res. 2006;209-9:1073–1074. doi: 10.1016/j.brainres.2005.12.014. [DOI] [PubMed] [Google Scholar]
  • 28.Gilbert GL. Kim HJ. Waataja JJ. Thayer SA. Delta(9)-Tetrahydrocannabinol protects hippocampal neurons from excitotoxicity. Brain Res. 2007;1128:61–69. doi: 10.1016/j.brainres.2006.03.011. [DOI] [PubMed] [Google Scholar]
  • 29.Gomez RM. Yep A. Schattner M. Berria MI. Junin virus-induced astrocytosis is impaired by iNOS inhibition. J Med Virol. 2003;69:145–149. doi: 10.1002/jmv.10254. [DOI] [PubMed] [Google Scholar]
  • 30.Gomez R. Navarro M. Ferrer B, et al. A peripheral mechanism for CB1 cannabinoid receptor-dependent modulation of feeding. J Neurosci. 2002;22:9612–9617. doi: 10.1523/JNEUROSCI.22-21-09612.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hooper DC. Kean RB. Scott GS, et al. The central nervous system inflammatory response to neurotropic virus infection is peroxynitrite dependent. J Immunol. 2001;167:3470–3477. doi: 10.4049/jimmunol.167.6.3470. [DOI] [PubMed] [Google Scholar]
  • 32.Hu J. El-Fakahany EE. Intricate regulation of nitric oxide synthesis in neurons. Cellular Signal. 1996;8:185–189. doi: 10.1016/0898-6568(95)02053-5. [DOI] [PubMed] [Google Scholar]
  • 33.Huneycutt BS. Bi Z. Aoki CJ. Reiss CS. Central neuropathogenesis of vesicular stomatitis virus infection of immunodeficient mice. J Virol. 1993;67:6698–6706. doi: 10.1128/jvi.67.11.6698-6706.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Huneycutt BS. Plakhov IV. Shusterman Z. Bartido SM. Huang A. Reiss CS. Aoki C. Distribution of vesicular stomatitis virus proteins in the brains of BALB/c mice following intranasal inoculation: an immunohistochemical analysis. Brain Res. 1994;635:81–95. doi: 10.1016/0006-8993(94)91426-5. [DOI] [PubMed] [Google Scholar]
  • 35.Ibrahim MM. Rude ML. Stagg NJ, et al. CB2 cannabinoid receptor mediation of antinociception. Pain. 2006;122:36–42. doi: 10.1016/j.pain.2005.12.018. [DOI] [PubMed] [Google Scholar]
  • 36.Ireland DD. Palian BM. Reiss CS. Interleukin (IL)-12 receptor beta1 or IL-12 receptor beta 2 deficiency in mice indicates that IL-12 and IL-23 are not essential for host recovery from viral encephalitis. Viral Immunol. 2005;18:397–402. doi: 10.1089/vim.2005.18.397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ireland DD. Reiss CS. Expression of IL-12 receptor by neurons. Viral Immunol. 2004;17:411–422. doi: 10.1089/vim.2004.17.411. [DOI] [PubMed] [Google Scholar]
  • 38.Jackson SJ. Diemel LT. Pryce G. Baker D. Cannabinoids and neuroprotection in CNS inflammatory disease. J Neurol Sci. 2005;233:21–25. doi: 10.1016/j.jns.2005.03.002. [DOI] [PubMed] [Google Scholar]
  • 39.Jaffrey SR. Snyder SH. PIN: an associated protein inhibitor of neuronal nitric oxide synthase. Science. 1996;274:774–777. doi: 10.1126/science.274.5288.774. [DOI] [PubMed] [Google Scholar]
  • 40.Karupiah G. Xie QW. Buller RM. Nathan C. Duarte C. MacMicking JD. Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase. Science. 1993;261:1445–1448. doi: 10.1126/science.7690156. [DOI] [PubMed] [Google Scholar]
  • 41.Kim SH. Won SJ. Mao XO. Ledent C. Jin K. Greenberg DA. Role for neuronal nitric-oxide synthase in cannabinoid-induced neurogenesis. J Pharmacol Exp Ther. 2006;319:150–154. doi: 10.1124/jpet.106.107698. [DOI] [PubMed] [Google Scholar]
  • 42.Kim SH. Won SJ. Mao XO. Jin K. Greenberg DA. Molecular mechanisms of cannabinoid protection from neuronal excitotoxicity. Mol Pharmacol. 2006;69:691–696. doi: 10.1124/mol.105.016428. [DOI] [PubMed] [Google Scholar]
  • 43.Komatsu T. Bi Z. Reiss CS. Interferon-gamma induced type I nitric oxide synthase activity inhibits viral replication in neurons. J Neuroimmunol. 1996;68:101–108. doi: 10.1016/0165-5728(96)00083-5. [DOI] [PubMed] [Google Scholar]
  • 44.Komatsu T. Ireland DD. Chen N. Reiss CS. Neuronal expression of NOS-1 is required for host recovery from viral encephalitis. Virology. 1999;258:389–395. doi: 10.1006/viro.1999.9734. [DOI] [PubMed] [Google Scholar]
  • 45.Kushmerick C. Price GD. Taschenberger H, et al. Retroinhibition of presynaptic Ca2+ currents by endocannabinoids released via postsynaptic mGluR activation at a calyx synapse. J Neurosci. 2004;24:5955–5965. doi: 10.1523/JNEUROSCI.0768-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lane TE. Fox HS. Buchmeier MJ. Inhibition of nitric oxide synthase-2 reduces the severity of mouse hepatitis virus-induced demyelination: implications for NOS2/NO regulation of chemokine expression and inflammation. J Neurovirol. 1999;5:48–54. doi: 10.3109/13550289909029745. [DOI] [PubMed] [Google Scholar]
  • 47.Lukas SE. Mendelson JH. Benedikt R. Electroencephalographic correlates of marihuana-induced euphoria. Drug Alcohol Depend. 1995;37:131–140. doi: 10.1016/0376-8716(94)01067-u. [DOI] [PubMed] [Google Scholar]
  • 48.Maresz K. Carrier EJ. Ponomarev ED. Hillard CJ. Dittel BN. Modulation of the cannabinoid CB2 receptor in microglial cells in response to inflammatory stimuli. J Neurochem. 2005;95:437–445. doi: 10.1111/j.1471-4159.2005.03380.x. [DOI] [PubMed] [Google Scholar]
  • 49.Maresz K. Pryce G. Ponomarev ED, et al. Direct suppression of CNS autoimmune inflammation via the cannabinoid receptor CB1 on neurons and CB2 on autoreactive T cells. Nat Med. 2007;13:492–497. doi: 10.1038/nm1561. [DOI] [PubMed] [Google Scholar]
  • 50.Marsicano G. Goodenough Monory K, et al. CB1 cannabinoid receptors and on-demand defense against excitotoxicity. Science. 2003;302:84–88. doi: 10.1126/science.1088208. [DOI] [PubMed] [Google Scholar]
  • 51.Martinez-Orgado B. Fernandez-Frutos R. Gonzalez R. Romero E. Uriguen L. Romero J. Viveros MP. Neuroprotection by the cannabinoid agonist WIN-55212 in an in vivo newborn rat model of acute severe asphyxia. Mol Brain Res. 2003;114:132–139. doi: 10.1016/s0169-328x(03)00163-3. [DOI] [PubMed] [Google Scholar]
  • 52.Mestre L. Correa F. Docagne F. Clemente D. Guaza C. The synthetic cannabinoid WIN 55,212-2 increases COX-2 expression and PGE2 release in murine brain-derived endothelial cells following Theiler's virus infection. Biochem Pharmacol. 2006;72:869–880. doi: 10.1016/j.bcp.2006.06.037. [DOI] [PubMed] [Google Scholar]
  • 53.Mestre L. Correa F. Revalo-Martin A, et al. Pharmacological modulation of the endocannabinoid system in a viral model of multiple sclerosis. J Neurochem. 2005;92:1327–1339. doi: 10.1111/j.1471-4159.2004.02979.x. [DOI] [PubMed] [Google Scholar]
  • 54.Mishkin EM. Cabral GA. delta-9-Tetrahydrocannabinol decreases host resistance to herpes simplex virus type 2 vaginal infection in the B6C3F1 mouse. J Gen Virol. 1985;66(Pt 12):2539–2549. doi: 10.1099/0022-1317-66-12-2539. [DOI] [PubMed] [Google Scholar]
  • 55.Murray RM. Morrison PD. Henquet C. Di FM. Cannabis, the mind and society: the hash realities. Nat Rev Neurosci. 2007;8:885–895. doi: 10.1038/nrn2253. [DOI] [PubMed] [Google Scholar]
  • 56.Naef M. Curatolo M. Petersen-Felix S. Rendt-Nielsen L. Zbinden A. Brenneisen R. The analgesic effect of oral delta-9-tetrahydrocannabinol (THC), morphine, and a THC-morphine combination in healthy subjects under experimental pain conditions. Pain. 2003;105:79–88. doi: 10.1016/s0304-3959(03)00163-5. [DOI] [PubMed] [Google Scholar]
  • 57.Nathan C. Xie QW. Nitric oxide synthases: roles, tolls, and controls. Cell. 1994;78:915–918. doi: 10.1016/0092-8674(94)90266-6. [DOI] [PubMed] [Google Scholar]
  • 58.Noe SN. Nyland SB. Ugen K. Friedman H. Klein TW. Cannabinoid receptor agonists enhance syncytia formation in MT-2 cells infected with cell free HIV-1MN. Adv Exp Med Biol. 1998;437:223–229. doi: 10.1007/978-1-4615-5347-2_25. [DOI] [PubMed] [Google Scholar]
  • 59.O'Sullivan SE. Tarling EJ. Bennett AJ. Kendall DA. Randall MD. Novel time-dependent vascular actions of Delta9-tetrahydrocannabinol mediated by peroxisome proliferator-activated receptor gamma. Biochem. Biophys. Res. Commun. 2005;337:824–831. doi: 10.1016/j.bbrc.2005.09.121. [DOI] [PubMed] [Google Scholar]
  • 60.Pacher P. Batkai S. Kunos G. The endocannabinoid system as an emerging target of pharmacotherapy. Pharmacol Rev. 2006;58:389–462. doi: 10.1124/pr.58.3.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Pan X. Ikeda SR. Lewis DL. Rat brain cannabinoid receptor modulates N-type Ca2+ channels in a neuronal expression system. Mol Pharmacol. 1996;49:707–714. [PubMed] [Google Scholar]
  • 62.Panikashvili D. Simeonidou C. Ben-Shabat S. Hanus L. Breuer A. Mechoulam R. Shohami E. An endogenous cannabinoid (2-AG) is neuroprotective after brain injury. Nature. 2001;413:527–531. doi: 10.1038/35097089. [DOI] [PubMed] [Google Scholar]
  • 63.Plakhov IV. Arlund EE. Aoki C. Reiss CS. The earliest events in vesicular stomatitis virus infection of the murine olfactory neuroepithelium, entry of the central nervous system. Virology. 1995;209:257–262. doi: 10.1006/viro.1995.1252. [DOI] [PubMed] [Google Scholar]
  • 64.Quartilho A. Mata HP. Ibrahim MM. Vanderah TW. Porreca F. Makriyannis A. Malan TP., Jr. Inhibition of inflammatory hyperalgesia by activation of peripheral CB2 cannabinoid receptors. Anesthesiology. 2003;99:955–960. doi: 10.1097/00000542-200310000-00031. [DOI] [PubMed] [Google Scholar]
  • 65.Ramirez BG. Blazquez C. del Gomez PT. Guzman M. de Ceballos ML. Prevention of Alzheimer's disease pathology by cannabinoids: neuroprotection mediated by blockade of microglial activation. J Neurosci. 2005;25:1904–1913. doi: 10.1523/JNEUROSCI.4540-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Rawls SM. Tallarida RJ. Gray AM. Geller EB. Adler MW. L-NAME (N omega-nitro-L-arginine methyl ester), a nitric-oxide synthase inhibitor, WIN 55212-2 [4,5-dihydro-2-methyl-4(4-morpholinylmethyl)-1-(1-naphthalenyl-carbonyl)-6 H-pyrrolo[3,2,1ij]quinolin-6-one], a cannabinoid agonist, interact to evoke synergistic hypothermia. J Pharmacol Exp Ther. 308:780–786. doi: 10.1124/jpet.103.054668. [DOI] [PubMed] [Google Scholar]
  • 67.Reiss CS. Komatsu T. Does nitric oxide play a critical role in viral infections? J Virol. 1998;72:4547–4551. doi: 10.1128/jvi.72.6.4547-4551.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Rivest S. Cannabinoids in microglia: a new trick for immune surveillance and neuroprotection. Neuron. 2006;49:4–8. doi: 10.1016/j.neuron.2005.12.004. [DOI] [PubMed] [Google Scholar]
  • 69.Sarne Y. Mechoulam R. Cannabinoids: between neuroprotection and neurotoxicity. Curr Drug Targets CNS Neurol Disord. 2005;4:677–684. doi: 10.2174/156800705774933005. [DOI] [PubMed] [Google Scholar]
  • 70.Shackelford DA. Yeh RY. Activation of extracellular signal-regulated kinases (ERK) during reperfusion of ischemic spinal cord. Mol Brain Res. 2003;115:173–186. doi: 10.1016/s0169-328x(03)00206-7. [DOI] [PubMed] [Google Scholar]
  • 71.Shohami E. Novikov M. Mechoulam R. A nonpsychotropic cannabinoid, HU-211, has cerebroprotective effects after closed head injury in the rat. J Neurotrauma. 1993;10:109–119. doi: 10.1089/neu.1993.10.109. [DOI] [PubMed] [Google Scholar]
  • 72.Sun Y. Alexander SP. Kendall DA. Bennett AJ. Cannabinoids and PPARalpha signalling. Biochem Soc Trans. 2006;34:1095–1097. doi: 10.1042/BST0341095. [DOI] [PubMed] [Google Scholar]
  • 73.Ullrich O. Merker K. Timm J. Tauber S. Immune control by endocannabinoids—New mechanisms of neuroprotection? J Neuroimmunol. 2007;184(1-2):127–35. doi: 10.1016/j.jneuroim.2006.11.018. [DOI] [PubMed] [Google Scholar]
  • 74.Ullrich O. Schneider-Stock R. Zipp F. Cell-cell communication by endocannabinoids during immune surveillance of the central nervous system. Results Probl Cell Differ. 2006;43:281–305. doi: 10.1007/400_015. [DOI] [PubMed] [Google Scholar]
  • 75.Wang KS. Frank DA. Ritz J. Interleukin-2 enhances the response of natural killer cells to interleukin-12 through up-regulation of the interleukin-12 receptor and STAT4. Blood. 2000;95:3183–3190. [PubMed] [Google Scholar]
  • 76.Wenger T. Moldrich G. The role of endocannabinoids in the hypothalamic regulation of visceral function. Prostaglandins Leukot Essent Fatty Acids. 2002;66:301–307. doi: 10.1054/plef.2001.0353. [DOI] [PubMed] [Google Scholar]
  • 77.Wilson RI. Kunos G. Nicoll RA. Presynaptic specificity of endocannabinoid signaling in the hippocampus. Neuron. 2001;31:453–462. doi: 10.1016/s0896-6273(01)00372-5. [DOI] [PubMed] [Google Scholar]
  • 78.Yang J. Dennison NN. Reiss CS. PIN: a novel protein involved in IFN-g accumulation of NOS-1 in neurons. J DNA and Cell Bio. 2008;27(1):9–17. doi: 10.1089/dna.2007.0673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Yang J. Tugal D. Reiss CS. The role of the proteasome-ubiquitin pathway in regulation of the IFN-gamma mediated anti-VSV response in neurons. J Neuroimmunol. 2006;181:34–45. doi: 10.1016/j.jneuroim.2006.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Viral Immunology are provided here courtesy of SAGE Publications

RESOURCES