Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Jun 1.
Published in final edited form as: Mol Cancer Ther. 2008 Jun;7(6):1430–1439. doi: 10.1158/1535-7163.MCT-07-2345

ISG15 as a Novel Tumor Biomarker for Drug Sensitivity

Shyamal D Desai 1, Laurence M Wood 1, Yu-Chen Tsai 1, Tao-Shih Hsieh 2, Jeffrey R Marks 3, Georgia L Scott 3, Beppino C Giovanella 4, Leroy F Liu 1,*
PMCID: PMC2561335  NIHMSID: NIHMS54091  PMID: 18566215

Abstract

Tumor cells are known to exhibit highly varied sensitivity to CPTs (e.g. irinotecan and topotecan). However, the factors that determine CPT sensitivity/resistance are largely unknown. Recent studies have shown that the ubiquitin-like protein, ISG15 (Interferon-Stimulated Gene 15), which is highly elevated in many human cancers and tumor cell lines, antagonizes the ubiquitin/proteasome pathway. In the present study, we show that ISG15 is a determinant for CPT sensitivity/resistance, possibly through its effect on proteasome-mediated repair of TOP1-DNA covalent complexes. First, shRNA-mediated knockdown of either ISG15 or UbcH8 (major E2 for ISG15) in breast cancer ZR-75-1 cells decreased CPT sensitivity, suggesting that ISG15 overexpression in tumors could be a factor affecting intrinsic CPT sensitivity in tumor cells. Second, the level of ISG15 was found to be significantly reduced in a number of tumor cells selected for resistance to CPT, suggesting that altered ISG15 regulation could be a significant determinant for acquired CPT resistance. Parallel to reduced CPT sensitivity, shRNA-mediated knockdown of either ISG15 or UbcH8 in ZR-75-1 cells resulted in increased proteasomal degradation of CPT-induced TOP1-DNA covalent complexes. Taken together, these results suggest that ISG15, which interferes with proteasome-mediated repair of TOP1-DNA covalent complexes, is a potential tumor biomarker for CPT sensitivity.

Keywords: Topoisomerase I, Ubiquitin, 26S proteasome, ISG15, Camptothecin

Introduction

Two camptothecin (CPT) analogs, irinotecan (CamptosarR) and topotecan (HycamtinR), have been developed and used in the clinic for the treatment of certain human cancers (e.g. ovarian and colorectal cancers) (1-3). However, it has been shown that not all cancers are sensitive to CPT-based chemotherapy (4, 5). It is of particular significance that in vitro CPT sensitivity also varies greatly in a panel of breast and colon cancer cell lines (6-8). To date, the factors affecting tumor sensitivity to CPT are not well understood.

CPTs kill tumor cells by trapping topoisomerase I (TOP1)-DNA covalent complexes (9, 10). The repair of this unique type of DNA damage, which is not fully understood, is expected to affect CPT sensitivity/resistance (7, 11, 12). Recent studies have demonstrated that an ubiquitin/26S proteasome pathway is activated by CPT and this leads to the degradation of TOP1-DNA covalent complexes in CPT-treated cells (13-15). It has been suggested that proteasomal degradation of TOP1 (TOP1 down-regulation) represents a repair mechanism for CPT-induced TOP1-DNA covalent complexes (13, 14). Indeed, cells proficient in this repair process are more resistant to CPT (7). In addition, overexpression of Cullin3, a component of an SCF complex, has been shown to increase ubiquitination and TOP1 down-regulation, resulting in CPT resistance (16). Furthermore, co-treatment with the proteasome inhibitor, MG132, that inhibits TOP1 down-regulation, increases tumor cell sensitivity to CPT (7). These results suggest that the ubiquitin/proteasome pathway could be an important determinant for CPT sensitivity/resistance.

Several studies have demonstrated that CPT-induced TOP1 down-regulation is defective in many tumors, a factor that could contribute to tumor-specific killing by CPTs. In tissue culture models, CPT has been shown to induce TOP1 down-regulation in normal non-transformed cells, but not in many tumor cells (7). Similarly, in a nude mouse model, topotecan treatment has been shown to cause TOP1 down-regulation in many normal tissues (e.g. blood, brain, kidney, liver and skin) but not in xenografted MDA-MB-435 breast cancer cells (14). Furthermore, patients receiving topotecan therapy also exhibit reduced TOP1 levels in normal peripheral blood cells, but not in leukemic cells (17, 18). Thus, TOP1 down-regulation in normal tissues has been suggested to be a cellular response to evade the toxic effect of TOP1-directed anticancer drugs (7). Most tumor cells are defective in CPT-induced TOP1 down-regulation, which could explain in part the increased sensitivity of tumor cells to CPTs (7, 19).

The molecular basis for the defective proteasomal degradation of TOP1 in many tumor cells is not clear. However, recent studies have shown that the ubiquitin-like protein, ISG15 (Interferon-Stimulated Gene 15), is highly elevated, but variably expressed, in many tumors (20-22). In addition, high-level expression of ISG15 has been shown to interfere with the ubiquitin/26S proteasome pathway, leading to altered degradation of many cellular proteins (20). ISG15 is composed of two ubiquitin homology domains connected by a small linker region (23, 24). Each homology domain is roughly 30% homologous to ubiquitin (25-27). The carboxyl terminus of ISG15 retains the canonical LRLRGG ubiquitin sequence required for its conjugation to intracellular targets (28-30). ISG15 is conjugated to its substrates in much the same way as ubiquitin, requiring E1, E2 and E3, all of which are induced by type I interferons (23, 27). The E1 for ISG15, UBE1L, is specific for ISG15 (31). However, the E2 (i.e. UbcH8) (32, 33) and E3s (i.e. Rsp5, Herc5 and Efp (32, 34-36)) for ISG15 are dual functional E2/E3, needed for both protein ISGylation and ubiquitination. It has been suggested that ISGylation, which is elevated in many tumors, interferes with ubiquitination through substrate competition at the E2/E3 level (20).

In the present study, we test the hypothesis that the ISG15 conjugation pathway is a determinant for tumor cell sensitivity to CPT by antagonizing CPT-induced TOP1 down-regulation. By knocking down either ISG15 or UbcH8 (the major E2 for ISG15 (32)), the ISG15 pathway in breast cancer ZR-75-1 cells was shown to be an important determinant for CPT sensitivity by interfering with TOP1 down-regulation. In addition, ISG15 expression was also shown to be significantly reduced in a number of tumor cells selected for CPT resistance. These results suggest that ISG15 and factors in its conjugation pathway could serve as tumor biomarkers for CPT sensitivity/resistance.

Materials and Methods

Cells

All cells were cultured in RPMI supplemented with 10% Fetalplex™ (Gemini Bio-Products), L-glutamine (2 mM), penicillin (100 units/ml), and streptomycin (100 μg/ml) in a 37°C incubator with 5% CO2. Breast cancer ZR-75-1 cells stably expressing ISG15 or UbcH8 shRNA were maintained in hygromycin B (100 μg/ml).

Immunoblotting

Cells (5 x 105) were plated in 35 x 10 mm tissue culture dishes and incubated at 37°C in a CO2 incubator. One day after plating, cells were lysed with 2x SDS gel sample buffer. After boiling for 10 min, cell lysates were sonicated and subjected to analysis by SDS-PAGE (6% and 15% for determination of TOP1 and ISG15, respectively). Proteins were transferred onto nitrocellulose membrane. Immunoblotting was carried out using various antibodies, followed by the enhanced chemiluminescence (ECL) Western procedure (Pierce). The signals were detected and quantified by the Kodak Image Station 2000R. Equal protein loading was assessed by re-probing the same membrane with anti-tubulin antibody.

Band depletion assay for TOP1 cleavage complexes

Cells (106/sample) were treated with CPT (25 μM in 1% DMSO) for various times at 37°C. Cells were then lysed with 0.2 N NaOH containing 2 mM EDTA (14). Cell lysates were then neutralized with 1/10 volume of a solution containing 10% NP-40, 1 M Tris (pH 7.4), 0.1 M MgCl2, 0.1 M CaCl2, 10 mM dithiothreitol, 1 mM EGTA, and a mixture of peptide protease inhibitors (100 μg/ml each of leupeptin, pepstatin, and aprotinin), followed by the addition of another 1/10 volume of 2 N HCl. Reactions were terminated by the addition of SDS-PAGE sample buffer. Immunoblotting analysis of cell lysates was carried out using anti-Scl-70 antibody from scleroderma patients as described above.

CPT-induced TOP1 down-regulation

TOP1 down-regulation was measured as described above with two modifications. First, cells were incubated in CPT-free medium for 30 min prior to lysis (to reverse TOP1 cleavage complexes and to de-conjugate TOP1-ubiquitin and TOP1-UBL conjugates). Second, neutralized cell lysates were incubated with Staphylococcus aureus nuclease S7 (60 U/reaction) for 20 min on ice (to release TOP1 from residual TOP1-DNA covalent complexes) prior to termination with SDS-PAGE sample buffer.

Construction of ISG15 and UbcH8 shRNA vectors

ISG15 shRNA vector

The pSilencer 4.1 CMV-hygro shRNA expression vector (Ambion) was utilized for constructing ISG15-shRNA expression vector. Sense (5’-GATCCTGCGACGAACCTCTGAACATTCAAGAGATTACGCTGCTTGGAGACTT GTA-3’) and antisense (5’AGCTTACAAGTCTCCAAGCAGCGTAATCTCTTGAATGTTCAGAGGTTCGTC GCAG-3’) shRNA oligonucleotides, targeting the 232-250 region of ISG15 (accession no. AY168648), were synthesized (IDTDNA). The oligonucleotides were diluted in TE (10 mM Tris, 1 mM EDTA) to approximately 1 μg/ml. The sense and antisense oligonucleotides were annealed by heating to 90°C for 30 min in an annealing solution (provided by the manufacturer), followed by incubation at 37°C for 1hr. The annealed DNA was ligated into the pSilencer 4.1 CMV-hygro vector DNA cut with BamHI and HindIII restriction enzymes, followed by transformation into E. coli. DH5α. Plasmid DNA was purified and sequenced using the supplied primer sequences (5’AGGCGATTAAGTTGGGTA-3’, 5’-CGGTAGGCGTGTACGGTG-3’) for verification.

Ubch8 shRNA vector

The pSilencer 4.1 CMV-hygro shRNA expression vector (Ambion) was utilized for constructing the UbcH8-shRNA expression vector. Sense (5’-GATCCCGAGAACGGACAGATTTGCTTCAAGAGATTGCTCTTGCCTGTCTAAAC GA-3’) and antisense (5’-AGCTTCGTTTAGACAGGCAAGAGCAATCTCTTGAAGCAAATCTGTCCGTTCTC GG-3’) shRNA oligonucleotides, targeting the 237-255 region of UbcH8 (accession no. AF031141), were synthesized (IDTDNA). Construction and verification of UbcH8-shRNA vector were performed as described above.

Control shRNA vector

As a negative control, the pSilencer 4.1 CMV-hygro Negative Control plasmid was utilized (Ambion). The plasmid encodes a shRNA whose sequence is not found in the mouse, human, or rat genome databases.

Construction of shRNA stable transfectants

Breast cancer ZR-75-1 cells (1 x 106) were transfected with 4 μg each of XMNI-linearized ISG15, UbcH8 or control shRNA vectors using the Polyfect transfection reagent (Qiagen). Following incubation for 72 hrs, cells were washed with fresh RPMI medium and incubated at 37°C for 24 hrs. Cells were trypsinized and replated into 150 mm tissue culture plates. Selection media that contained 200 μg/ml hygromycin B was added to the cells 24 hrs after replating. Individual colonies were picked following 3 weeks of hygromycin selection and screened for ISG15 and UbcH8 expression by Western blotting analysis using anti-ISG15 and anti-UbcH8 antisera, respectively.

Cell survival assays

MTT assay

Cells (3000 cells/well) were plated in 96-well microtiter plates and incubated at 37°C in a CO2 incubator. For determination of IC50, cells were treated with varying concentrations of CPT for four days. Cells were then incubated with MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) for 4 hrs at 37°C. The dye produced by viable cells was dissolved in DMSO and the optical density measured at 570 nm. All assays were performed at least twice in six replicate wells.

Clonogenic assay

Cells (100-500 cells/plate) were plated in 6-well tissue culture plates and incubated at 37°C in a CO2 incubator. Cells were treated with various concentrations of CPT for 1 hr. Following CPT treatment, cells were washed free of CPT and placed in fresh medium. After 10 days, survived colonies were stained with Methylene blue and counted using the Minicount machine.

Cell counting assay

Logarithmically growing cells were treated with various concentrations of CPT for 1 hr. CPT was removed by washing the plates with CPT-free medium four times. Washed cells were allowed to grow in CPT-free medium for 4 days. Cell survival was determined by counting trypsinized cells with the Coulter counter.

Results

Breast cancer cells exhibit highly varied ISG15 expression, CPT sensitivity, and TOP1 down-regulation

CPT sensitivity has been shown to vary greatly among various breast cancer cells in vitro (7, 8). No single parameter could account for the observed variation in CPT sensitivity (8). In the present study, the hypothesis that the expression levels of ISG15 and its conjugates are correlated with CPT sensitivity of breast cancer cells was tested. As shown in Fig. 1, ZR-75-1 cells were much more (greater than 50-fold) sensitive to CPT than BT474 cells based on cell counting (one-hour acute exposure, Fig. 1A) and MTT (4 days continuous exposure, Fig. 1B). These results are consistent with previous published studies (7). As shown in Fig. 1C, breast cancer ZR-75-1 cells expressed high levels of ISG15 and its conjugates while breast BT474 cells expressed very low levels of ISG15 and its conjugates. To test whether this apparent correlation between ISG15 and CPT sensitivity is generally true, other cells such as glioblastoma, colorectal cancer, and ATM+/ATM- cells, were also included in the comparison. Indeed, there was a general correlation between ISG15 expression (Fig. 2A-C, right panels) and CPT sensitivity (Fig. 2D, IC50s determined by MTT assay) among these limited numbers of cell lines; Cells expressing higher levels of ISG15 were more sensitive to CPT.

Figure 1.

Figure 1

Breast cancer cells exhibit highly varied ISG15 expression, CPT sensitivity, and TOP1 down-regulation. A, CPT sensitivity. Breast cancer ZR-75-1 and BT474 cells were treated with CPT for 1 hr followed by incubation in CPT-free medium for 4 days. Cell survival was determined by cell counting using a Coulter counter as described in Materials and Methods. B, CPT sensitivity. MTT assay was performed at least twice in six replicate wells as described in Materials and Methods. C, ISG15 expression. ISG15 expression in breast cancer BT474 and ZR-75-1 cells was determined by immunoblotting using anti-ISG15 antibody as described in Materials and Methods. D, CPT-induced down-regulation of TOP1. Breast cancer BT474 and ZR-75-1 cells (106 cells/sample) were treated with either 1% DMSO (lanes #1 and 5) or CPT (25 μM in 1% DMSO) (lanes # 2-4 and 6-8) for various times at 37°C. TOP1 down-regulation was then measured as described in Materials and Methods. The same membrane was stripped and re-probed with anti-tubulin antibody to verify equal protein loading (lower panels).

Figure 2.

Figure 2

Elevated ISG15 expression in tumor cells is inversely correlated with TOP1 down-regulation. A-C, ISG15 expression and TOP1 down-regulation. Both ISG15 expression (right panels) and CPT-induced TOP1 down-regulation (upper left panels) were determined in glioblastoma U138G and T98G cells (panel A), colorectal cancer HT29 and KM12 cells (panel B), and FT169A-pEBS7 (ATM-) and FT169A-pEBS7-YZ5 (ATM+) cells (panel C). Cells were treated with either 1% DMSO (lanes #1 and 4) or CPT (25 μM in 1% DMSO) (lanes # 2, 3, 5 and 6) for various times at 37°C. TOP1 down-regulation and ISG15 expression were measured as described in Materials and Methods. The same membranes shown in left upper panels A-C and right upper panels A and B were stripped and re-probed with anti-ISG15 (A, left lower panel) or anti-tubulin (B and C, left lower panels), and anti-TOP1 (A, right lower panel) or anti-tubulin (B, right lower panel) antibodies respectively to confirm equal protein loading. A duplicate gel was stained with Coomassie blue to assess protein loading in C, right panel. D, CPT sensitivity for cells expressing different levels of ISG15. MTT assay was performed at least twice in six replicate wells as described in Materials and Methods.

Previous studies have shown that the ISG15 pathway interferes with the ubiquitin/26S proteasome pathway (20). It is thus possible that elevated expression of the ISG15 pathway in these cells could lead to increased CPT sensitivity by interfering with proteasomal degradation of TOP1-DNA covalent complexes (TOP1 down-regulation). To test this hypothesis, CPT-induced degradation of TOP1 in these cells was measured. As shown in Fig. 1D and Fig. 2A-C (left panels), cells expressing high levels of ISG15 were much less efficient in CPT-induced TOP1 down-regulation. These results thus are consistent with the notion that the ISG15 pathway may affect CPT sensitivity through its interference with TOP1 down-regulation.

Elevated ISG15 expression in tumor cells confers increased CPT sensitivity

To demonstrate a causal relationship between ISG15 expression and CPT sensitivity, shRNA-mediated knockdown of ISG15 in breast cancer ZR-75-1 cells was conducted. Several clones of ISG15 shRNA transfectants and control shRNA transfectants were isolated (see Materials and Methods). One clone, ZR/ISG15-shRNA1 was extensively characterized. As shown in Fig. 3A, the expression level of ISG15 in ZR/ISG15-shRNA1 cells was significantly (more than 70%, as quantified by using the Image Station 2000R) reduced compared to that in ZR/control-shRNA1 cells. ZR/ISG15-shRNA1 cells were shown to be much more resistant to CPT (one hr acute exposure followed by cell survival measurement using clonogenic assay) than control-shRNA cells (Fig. 3B), suggesting that the ISG15 expression in tumor cells may be causally linked to CPT sensitivity.

Figure 3.

Figure 3

shRNA-mediated down-regulation of ISG15 in breast cancer ZR-75-1 cells confers CPT resistance and restores CPT-induced TOP1 down-regulation. A, Reduced ISG15 expression in ZR-75-1 cells expressing ISG15 shRNA. Cell lysates of ZR-75-1 clones expressing either control shRNA (lane # 1) or ISG15 shRNA (lanes # 2) were analyzed by 15% SDS-PAGE. Western blotting analysis was performed using anti-ISG15 antisera (upper panel). B, CPT sensitivity. Clonogenic survival assay was carried out as described in Materials and Methods. Colonogenic survival curves of a ZR-75-1 clone expressing control shRNA and ISG15 shRNA after CPT treatment is shown. Mean ± SD values from at least two experiments are presented. C, CPT-induced TOP1 down-regulation. ZR-75-1 cells stably transfected with control shRNA (lanes 1-4) or ISG15 shRNA (lanes # 5-8) (106 cells /sample) were treated with either DMSO (lanes #1 and 5) or CPT (25 μM in 1% DMSO) (lanes # 2-4 and 6-8) for various times at 37°C. TOP1 down-regulation was measured as described in Materials and Methods.

The mechanism for increased CPT sensitivity in ISG15-overexpressing tumor cells was investigated. As suggested from results shown in Fig. 1 and 2, ISG15 overexpression is inversely correlated with TOP1 down-regulation. To test whether elevated ISG15 expression in tumor cells is causally linked to reduced TOP1 down-regulation, TOP1 down-regulation was measured in both ZR/ISG15-shRNA1 and ZR/control-shRNA1 cells. As shown in Fig. 3C, similar to ZR-75-1 cells (7), ZR/control-shRNA1 cells exhibited minimal TOP1 down-regulation. By contrast, ZR/ISG15-shRNA1 cells exhibited greatly increased rate of TOP1 down-regulation (about 50% down-regulation in 2 hrs), suggesting that ISG15 negatively regulates TOP1 down-regulation. The level of TOP1 protein and the amount of TOP1 cleavable complexes formed in response to CPT treatment in the ZR-75-1/control-shRNA1 were not significantly different from those in ZR-75-1/ISG15-shRNA1 cells (data not shown). Hence, the observed differences in their CPT sensitivity and TOP1 down-regulation are not due to alteration in their steady-state levels of TOP1 or the amount of TOP1 cleavable complexes in these cells. Together, these results suggest that reduced TOP1 down-regulation may contribute to increased CPT sensitivity in ISG15 overexpressing tumor cells.

Protein ISGylation in tumor cells increases CPT sensitivity

The above studies have suggested that the elevated ISG15 protein level in tumor cells could contribute to CPT sensitivity by interfering with TOP1 down-regulation. Previous studies have shown that, in addition to free ISG15 protein, the formation of ISG15-protein conjugates (ISGylation) also interferes with protein polyubiquitination (20). Therefore, the hypothesis that ISGylation is related to increased CPT sensitivity in ZR-75-1 cells was tested by knocking down the major E2, UbcH8, for ISG15. Several stable clones of UbcH8-shRNA transfected ZR-75-1 cells were isolated. Two clones, ZR/UbcH8-shRNA1 and ZR/UbcH8-shRNA2, were extensively characterized.

As shown in Fig. 4A, the expression levels of UbcH8 in ZR/UbcH8-shRNA1 and ZR/UbcH8-shRNA2 cells were reduced to 70 and 85 %, respectively, as compared to those in ZR/control-shRNA2 cells (another control shRNA clone isolated from control shRNA-transfected ZR-75-1 cells). The levels of ISG15-protein conjugates in ZR/UbcH8-shRNA1 and ZR/UbcH8-shRNA2 cells were also significantly reduced compared to those in control-shRNA2 cells. These results confirmed the effectiveness of UbcH8 shRNA in knocking down UbcH8 in ZR-75-1 cells.

Figure 4.

Figure 4

shRNA-mediated down-regulation of UbcH8 in breast cancer ZR-75-1 cells confers CPT resistance and restores CPT-induced TOP1 down-regulation. A, The reduced UbcH8 protein level in ZR-75-1 cells expressing UbcH8 shRNA. Cell lysates prepared from ZR-75-1 clones expressing either control shRNA (lane # 1, labeled ZR/control-shRNA2) or UbcH8 shRNA (lanes # 2 and 3, from two independent clones, labeled ZR/UbcH8-shRNA1 and ZR/UbcH8-shRNA2, respectively), and the purified UbcH8 protein (lane # 4) were analyzed by 15% SDS-PAGE. Western blotting analysis was performed using anti-UbcH8 antibody (Abcam). B, UbcH8 shRNA decreases ISG15 conjugation in ZR-75-1 cells. Cell lysates prepared from ZR-75-1 clones expressing either control shRNA (lane # 1) or UbcH8 shRNA (lanes # 2 and 3) were analyzed by 15% SDS-PAGE. Western blotting analysis was performed using anti-ISG15 antibody. The non-specific bands are due to the crossreactivity of the ISG15 antibody to bovine serum albumin. C, Knocking down UbcH8 confers CPT resistance. ZR-75-1 clones expressing control shRNA and UbcH8 shRNA (two independent clones) were treated with CPT and cell survival was measured as described in Material and Methods. D, CPT-induced TOP1 down-regulation in ZR-75-1 cells expressing UbcH8 shRNA. Clonal cells of ZR-75-1 expressing control (first panel) or UbcH8 shRNA (second and third panels, representing two independent clones) (106/sample) were treated with either 1% DMSO (lanes #1, 5, and 9) or CPT (25 μM in 1% DMSO) (lanes # 2-4, 6-8, and 10-12) for various times at 37°C. TOP1 down-regulation was measured as described in Materials and Methods.

CPT sensitivity of ZR/UbcH8-shRNA1 and ZR/UbcH8-shRNA2 clones was measured by clonogenic survival following one-hr acute CPT exposure. As shown in Fig. 4C, both ZR/UbcH8-shRNA1 and ZR/UbcH8-shRNA2 cells were much more resistant to CPT than ZR/control-shRNA2, suggesting that the formation of ISG15-protein conjugates (ISGylation) affects CPT sensitivity.

TOP1 down-regulation in these clones was also determined. Similar to ZR-75-1 cells (7), ZR/control-shRNA2 cells exhibited minimal TOP1 down-regulation (Fig. 4D, first panel). By contrast, ZR/UbcH8-shRNA1 (Fig. 4D, second panel) and ZR/UbcH8-shRNA2 (Fig. 4D, third panel) cells exhibited significantly increased rate of TOP1 down-regulation (about 50% degradation of TOP1 in 2 hrs). Again, the level of TOP1 protein and the amount of TOP1 cleavable complexes formed in response to CPT treatment in the ZR-75-1/control-shRNA2 were not significantly different than those in the two clones of ZR-75-1/UbCh8-shRNA (data not shown). Hence, the observed differences in the CPT sensitivity and TOP1 down-regulation are not due to the alteration in the steady-state levels of TOP1 or the amount of TOP1 cleavable complexes in these cells. Together, these results suggest that ISGylation in tumor cells interferes with TOP1 down-regulation and therefore increases CPT sensitivity.

ISG15 expression is down-regulated in tumor cells selected for CPT resistance

Our results have demonstrated that ISG15 and its conjugates are important determinants for intrinsic CPT sensitivity in various tumor cells. To test whether altered regulation of ISG15 might also contribute to acquired CPT resistance, the ISG15 protein levels were measured in three tumor cell lines selected for high levels of CPT resistance (see Fig. 5B). As shown in Fig. 5A, ISG15 expression in these CPT-resistant cell lines (the ovarian cancer cell line 2774/RC, the prostate cancer cell line DU145/RC, and the melanoma cancer cell line Bro/RC) was greatly (more than five-fold) reduced compared to that in their respective parental cells (2774, DU145, and BRO cells). In addition to 2774, DU145, and BRO cells, three other CPT-resistant cell lines (RPMI/CPT-K5, U937/CR, and SB1B/RC) were also examined for their ISG15 expression. These three resistant lines showed no change in ISG15 expression (RPMI/CPT-K5), minimally reduced ISG15 expression (U937/CR), or no detectable ISG15 (unpublished results). The growth rates of these CPT-resistant cells were comparable to those of their respective parental cells (data not shown). Together, these results suggest that ISG15 expression may play an important role in acquired CPT resistance.

Figure 5.

Figure 5

Reduced ISG15 expression in various tumor cells selected for high levels of CPT resistance. A, Expression of ISG15 is reduced in tumor cells selected for CPT resistance. The human ovarian cancer 2774 and its CPT-resistant variant 2774/RC, the human prostate cancer DU145 and its CPT-resistant variant DU145/RC, and melanoma BRO and its CPT-resistant variant BRO/RC cells were analyzed by 15% SDS-PAGE, followed by immunoblotting with anti-ISG15 antibody (left panel). A duplicate gel was stained with Coomassie blue to assess protein loading (right panel). B, Determination of IC50s by MTT assay. Cells were treated with different concentrations of CPT for 4 days. MTT assay was then performed as described in Materials and Methods.

The resistant clones described above were selected for high levels of CPT resistance with stepwise increase in CPT concentrations. Many genetic changes are likely to have occurred in these resistant clones, which may complicate the interpretation of the role of ISG15 expression in CPT resistance. Indeed, DU145/RC and 2774/RC cells express mutant TOP1 proteins which are defective in the formation of TOP1 cleavage complexes in response to CPT (14). To avoid this problem, MCF7 breast cancer cells were selected for low levels of CPT resistance. The MCF7/RC (IC50=0.030 μM), one of the low-level CPT-resistant clones of MCF7, was about 8-fold more resistant to CPT than MCF7 cells (IC50=0.0035 μM). No change in the amount of TOP1-DNA covalent complexes was observed (Fig. 6A, first panel). However, ISG15 protein band at 15 kDa in MCF7/RC was significantly reduced compared to that in MCF7 cells when detected using either anti-ubiquitin (Fig. 6A, third panel, detected as a 15 kDa band labeled UCRP) or anti-ISG15 antibody (Fig. 6A, fourth panel, detected as ISG15). By contrast, a ubiquitin conjugate band (marked by *), which was detected by the anti-ubiquitin antibody (Fig. 6A, third panel), remained unchanged, suggesting that the reduced levels of UCRP (ISG15) is not due to reduced protein loading. Interestingly, TOP1 down-regulation, which was minimal in the parental MCF7 cells, was proficient in MCF7/RC cells (Fig. 6A, second panel).

Figure 6.

Figure 6

Reduced ISG15 expression in breast cancer cells selected for low levels of CPT resistance. A, MCF7 and MCF7/RC cells were treated with either 1% DMSO (lanes # 1 and 5) or CPT (25 μM in 1% DMSO) (lanes # 2-4 and 6-8) for 0, 2, 4, and 6 hrs. The amount of TOP1 cleavage complexes (first panel), the degree of TOP1 down-regulation (second panel), the free ISG15 levels detected as UCRP by using anti-ubiquitin antibody (third panel), and the free ISG15 levels detected by anti-ISG15 antibody (fourth panel) were determined by immunoblotting as described in Materials and Methods. B, CPT-induced TOP1 down-regulation in ZR-75-1 and ZR-75-1/RC (10 nM clone) cells (left panel). ZR-75-1 cells and a stable CPT-resistant clone of ZR-75-1 cells (ZR/RC 10 nM clone #1) were treated with either 1% DMSO (lanes # 1 and 4) or CPT (25 μM in 1% DMSO) (lanes # 2, 3, 5, 6) for 2 and 4 hrs. TOP1 down-regulation was measured as described in Materials and Methods. The expression levels of ISG15 in ZR-75-1 and ZR-75-1 (10 nM clone #1) (right panel). C, A proposed model for the role of protein ISGylation in CPT sensitivity/resistance. In this model, CPT is shown to trap the TOP1-DNA covalent complexes on chromosomal DNA. An ubiquitin/26S proteasome pathway is activated for the repair of these complexes by degrading TOP1. During tumorigenesis, the ISG15 conjugation pathway is elevated, which interferes with the ubiquitin-mediated degradation of TOP1, leading to increased CPT sensitivity.

Similar to MCF7 cells, breast cancer ZR-75-1 cells were also selected for low-level CPT resistance (selected with either 10 nM or 20 nM CPT). Clones were isolated. Among 18 CPT-resistant clones, 7 of them showed reduced ISG15 expression. One of the CPT-resistant clones with reduced ISG15 expression (Fig. 6B, right panel) was further characterized for TOP1 down-regulation. As shown in Fig. 6B (left panel), CPT treatment was shown to induce TOP1 down-regulation only in CPT-resistant ZR-75-1 cells but not in parental ZR-75-1 cells. Together, these results suggest that ISG15 expression is an important determinant for acquired CPT resistance, and provide additional support for the negative regulatory role of ISG15 in TOP1 down-regulation.

Discussion

It has been documented that CPT sensitivity varies greatly in different tumor cell lines and no single cellular parameter has been shown to correlate with CPT sensitivity (6-8). It has also been demonstrated that the expression of ISG15 and its conjugates is highly elevated in many tumors compared to their normal counterparts (20, 21). In the present study, the expression of ISG15 and its conjugates is shown to correlate with CPT sensitivity among several pairs of cancer cell lines (ZR-75-1 vs. BT474 breast cancer cells, HT29 vs. KM12 colorectal cancer cells, and T98G vs.U138G glioblastoma cells).

The results from this limited correlation study are further supported by shRNA-mediated knockdown studies, confirming the causal relationship between the ISG15 conjugation pathway and CPT sensitivity. Two separate knockdown studies have been performed in ZR-75-1 breast cancer cells which are known to express a high level of ISG15 and be hypersensitive to CPTs (20). First, shRNA-mediated knockdown of ISG15 in ZR-75-1 cells resulted in reduced CPT sensitivity. Second, shRNA-mediated knockdown of UbcH8 (the major E2 for ISG15) in ZR-75-1 cells also resulted in reduced CPT sensitivity. These results suggest that the formation of ISG15-protein conjugates (ISGylation) could be responsible for increased CPT sensitivity.

Previous studies have shown that shRNA-mediated knockdown of either ISG15 or UbcH8 results in increased protein polyubiquitination (20). It has been suggested that protein ISGylation interferes with protein polyubiquitination, leading to reduced degradation of many proteins (20). Indeed, ISG15 expression has been shown to inhibit ubiquitination of Gag and Tsg101 proteins (proteins required for HIV-1 replication) (37). Consistently, our present study has shown that shRNA-mediated knockdown of either ISG15 or UbcH8 results in increased proteasomal degradation of TOP1 in CPT-treated ZR-75-1 cells. Since CPT-induced proteasomal degradation of TOP1 (TOP1 down-regulation) has been suggested to be a repair mechanism for CPT-induced DNA lesion, it seems reasonable to speculate that elevated protein ISGylation in tumor cells may inhibit CPT-induced TOP1 down-regulation, leading to increased CPT sensitivity.

The importance of the ISG15 conjugation pathway in CPT sensitivity/resistance is further supported from studies of cell lines selected for acquired CPT resistance. Among six cell lines step-wise selected for high levels of CPT resistance, three (i.e. 2774/RC ovarian cancer cells, DU145/RC prostate cancer cells and BRO/RC melanoma cells) showed significant reduction of ISG15 expression compared to their respective wild type cells. The other three showed either minimal change in ISG15 expression (RPMI/CPT-K5 and U937/CR) or undetectable ISG15 (SB1B/RC melanoma cells) as compared to their respective wild type cells (unpublished results). The interpretation of the results could be complicated by the possibility that multiple genetic changes are likely to have occurred in these resistant clones. For example overexpression of drug efflux pump BCRP has been demonstrated to be associated with CPT resistance (5). Altered TOP1 localization (5) or mutations in TOP1 has also been shown to lead to CPT resistance ( 5). To avoid these potential complications, we selected MCF7 and ZR-75-1 breast cancer cells for low-level CPT resistance. We observed that MCF7 and ZR-75-1 cells selected for low level resistance also exhibit reduced ISG15 expression. Analysis of the low-level CPT resistant clones of ZR-75-1 cells has demonstrated that about one third of the clones exhibit reduced ISG15 expression. This is significant since low-level CPT resistance is more likely to mimic CPT resistance in patients. Our results thus support the possibility that the reduced expression of ISG15 could be one of the significant determinants of CPT resistance in the clinic.

Our results can be summarized schematically as shown in Fig. 6C. In this schematic, CPT induces TOP1-DNA covalent complexes which are the key DNA lesion responsible for tumor cell killing. Ubiquitin/26S proteasome-mediated degradation of TOP1-DNA covalent complexes represents a repair mechanism for cell survival. During tumorigenesis, the ISG15 conjugation pathway is highly, but variably, elevated in tumors, resulting in reduced proteasomal degradation of TOP1-DNA covalent complexes and hence increased CPT sensitivity (Fig. 6C). The reason for elevated expression of the ISG15 pathway in tumors is currently being investigated.

Our results have demonstrated a significant role of ISG15 in determining CPT sensitivity/resistance. These results could have significant implications in the clinic for cancer patients. The highly variable expression of ISG15 and its conjugates in tumors could be used as predictors for cancer cell sensitivity to CPTs. This is particularly important since both ISG15 expression levels and CPT sensitivity are highly variable among different tumors (6-8). It is also interesting to note that, in addition to being present in tumors, ISG15 has been shown to be secreted by tumor cells (22) and detectable in blood (38). The blood ISG15 level may therefore be conveniently used for both diagnosis of cancer and prediction for CPT (and other TOP1-directed drugs) treatment response in targeted chemotherapy.

Modulation of the ISG15 pathway also could have implications in drug combinations in the clinic. Since type I interferons are known to induce the ISG15 pathway (22, 23, 26), a combined use of type I interferons and CPT (or other TOP1-targeting drugs) is expected to increase CPT sensitivity in tumors expressing low levels of ISG15. Indeed, interferons have been shown to exhibit synergistic anticancer activity with CPT-11 against human colon cancer xenografts in nude mice (39, 40). It is also interesting to note that all-trans retinoic acid is known to induce ISG15 expression, possibly through type I IFNs (41). Consequently, all-trans retinoic acid, like type I interferons, could be used in combination with CPT (or other TOP1-targeting drugs) to sensitize tumors with low levels of ISG15 expression. Clearly, further studies on the molecular basis for the connection between ISG15 and CPT sensitivity/resistance may have important clinical implications.

Acknowledgments

We thank Dr. Arthur Haas (LSUHSC, New Orleans, LA) for a sample of affinity-purified anti-ISG15 antibody.

This work was supported by the NIH RO1 grant CA39662.

Abbreviations

ISG15

Interferon-Stimulated Gene 15

CPT

camptothecin

TOP1

topoisomerase I

Footnotes

Conflict of interest statement: There is no conflict of interest.

References

  • 1.Fuchs C, Mitchell EP, Hoff PM. Irinotecan in the treatment of colorectal cancer. Cancer Treat Rev. 2006;32:491–503. doi: 10.1016/j.ctrv.2006.07.001. [DOI] [PubMed] [Google Scholar]
  • 2.Randall-Whitis LM, Monk BJ. Topotecan in the management of cervical cancer. Expert Opin Pharmacother. 2007;8:227–36. doi: 10.1517/14656566.8.2.227. [DOI] [PubMed] [Google Scholar]
  • 3.Pommier Y. Topoisomerase I inhibitors: camptothecins and beyond. Nat Rev Cancer. 2006;6:789–802. doi: 10.1038/nrc1977. [DOI] [PubMed] [Google Scholar]
  • 4.Beretta GL, Perego P, Zunino F. Mechanisms of cellular resistance to camptothecins. Curr Med Chem. 2006;13:3291–305. doi: 10.2174/092986706778773121. [DOI] [PubMed] [Google Scholar]
  • 5.Rasheed ZA, Rubin EH. Mechanisms of resistance to topoisomerase I-targeting drugs. Oncogene. 2003;22:7296–304. doi: 10.1038/sj.onc.1206935. [DOI] [PubMed] [Google Scholar]
  • 6.Goldwasser F, Bae I, Valenti M, Torres K, Pommier Y. Topoisomerase I-related parameters and camptothecin activity in the colon carcinoma cell lines from the National Cancer Institute anticancer screen. Cancer Res. 1995;55:2116–21. [PubMed] [Google Scholar]
  • 7.Desai SD, Li TK, Rodriguez-Bauman A, Rubin EH, Liu LF. Ubiquitin/26S proteasome-mediated degradation of topoisomerase I as a resistance mechanism to camptothecin in tumor cells. Cancer Res. 2001;61:5926–32. [PubMed] [Google Scholar]
  • 8.Davis PL, Shaiu WL, Scott GL, Iglehart JD, Hsieh TS, Marks JR. Complex response of breast epithelial cell lines to topoisomerase inhibitors. Anticancer Res. 1998;18:2919–32. [PubMed] [Google Scholar]
  • 9.Liu LF. DNA topoisomerase poisons as antitumor drugs. Annu Rev Biochem. 1989;58:351–75. doi: 10.1146/annurev.bi.58.070189.002031. [DOI] [PubMed] [Google Scholar]
  • 10.Li TK, Liu LF. Tumor cell death induced by topoisomerase-targeting drugs. Annu Rev Pharmacol Toxicol. 2001;41:53–77. doi: 10.1146/annurev.pharmtox.41.1.53. [DOI] [PubMed] [Google Scholar]
  • 11.Liu LF, Desai SD, Li TK, Mao Y, Sun M, Sim SP. Mechanism of action of camptothecin. Ann N Y Acad Sci. 2000;922:1–10. doi: 10.1111/j.1749-6632.2000.tb07020.x. [DOI] [PubMed] [Google Scholar]
  • 12.Wu J, Liu LF. Processing of topoisomerase I cleavable complexes into DNA damage by transcription. Nucleic Acids Res. 1997;25:4181–6. doi: 10.1093/nar/25.21.4181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Desai SD, Liu LF, Vazquez-Abad D, D’Arpa P. Ubiquitin-dependent destruction of topoisomerase I is stimulated by the antitumor drug camptothecin. J Biol Chem. 1997;272:24159–64. doi: 10.1074/jbc.272.39.24159. [DOI] [PubMed] [Google Scholar]
  • 14.Desai SD, Zhang H, Rodriguez-Bauman A, et al. Transcription-dependent degradation of topoisomerase I-DNA covalent complexes. Mol Cell Biol. 2003;23:2341–50. doi: 10.1128/MCB.23.7.2341-2350.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Beidler DR, Cheng YC. Camptothecin induction of a time- and concentration-dependent decrease of topoisomerase I and its implication in camptothecin activity. Mol Pharmacol. 1995;47:907–14. [PubMed] [Google Scholar]
  • 16.Zhang HF, Tomida A, Koshimizu R, Ogiso Y, Lei S, Tsuruo T. Cullin 3 promotes proteasomal degradation of the topoisomerase I-DNA covalent complex. Cancer Res. 2004;64:1114–21. doi: 10.1158/0008-5472.can-03-2858. [DOI] [PubMed] [Google Scholar]
  • 17.Hochster H, Liebes L, Speyer J, et al. Effect of prolonged topotecan infusion on topoisomerase 1 levels: a phase I and pharmacodynamic study. Clin Cancer Res. 1997;3:1245–52. [PubMed] [Google Scholar]
  • 18.Rubin E, Wood V, Bharti A, et al. A phase I and pharmacokinetic study of a new camptothecin derivative, 9- aminocamptothecin. Clin Cancer Res. 1995;1:269–76. [PubMed] [Google Scholar]
  • 19.Pantazis P, Early JA, Mendoza JT, DeJesus AR, Giovanella BC. Cytotoxic efficacy of 9-nitrocamptothecin in the treatment of human malignant melanoma cells in vitro. Cancer Res. 1994;54:771–6. [PubMed] [Google Scholar]
  • 20.Desai SD, Haas AL, Wood LM, et al. Elevated expression of ISG15 in tumor cells interferes with the ubiquitin/26S proteasome pathway. Cancer Res. 2006;66:921–28. doi: 10.1158/0008-5472.CAN-05-1123. [DOI] [PubMed] [Google Scholar]
  • 21.Andersen JB, Aaboe M, Borden EC, Goloubeva OG, Hassel BA, Orntoft TF. Stage-associated overexpression of the ubiquitin-like protein, ISG15, in bladder cancer. Br J Cancer. 2006;94:1465–71. doi: 10.1038/sj.bjc.6603099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Padovan E, Terracciano L, Certa U, et al. Interferon stimulated gene 15 constitutively produced by melanoma cells induces e-cadherin expression on human dendritic cells. Cancer Res. 2002;62:3453–8. [PubMed] [Google Scholar]
  • 23.Andersen JB, Hassel BA. The interferon regulated ubiquitin-like protein, ISG15, in tumorigenesis: friend or foe? Cytokine Growth Factor Rev. 2006;17:411–21. doi: 10.1016/j.cytogfr.2006.10.001. [DOI] [PubMed] [Google Scholar]
  • 24.Sorensen CM, Rempel LA, Nelson SR, et al. The hinge region between two ubiquitin-like domains destabilizes recombinant ISG15 in solution. Biochemistry. 2007;46:772–80. doi: 10.1021/bi061408x. [DOI] [PubMed] [Google Scholar]
  • 25.Chen P, Hochstrasser M. Autocatalytic subunit processing couples active site formation in the 20S proteasome to completion of assembly. Cell. 1996;86:961–72. doi: 10.1016/s0092-8674(00)80171-3. [DOI] [PubMed] [Google Scholar]
  • 26.Dao CT, Zhang DE. ISG15: a ubiquitin-like enigma. Front Biosci. 2005;10:2701–22. doi: 10.2741/1730. [DOI] [PubMed] [Google Scholar]
  • 27.Ritchie KJ, Zhang DE. ISG15: the immunological kin of ubiquitin. Semin Cell Dev Biol. 2004;15:237–46. doi: 10.1016/j.semcdb.2003.12.005. [DOI] [PubMed] [Google Scholar]
  • 28.Loeb KR, Haas AL. The interferon-inducible 15-kDa ubiquitin homolog conjugates to intracellular proteins. J Biol Chem. 1992;267:7806–13. [PubMed] [Google Scholar]
  • 29.Haas AL, Ahrens P, Bright PM, Ankel H. Interferon induces a 15-kilodalton protein exhibiting marked homology to ubiquitin. J Biol Chem. 1987;262:11315–23. [PubMed] [Google Scholar]
  • 30.Loeb KR, Haas AL. Conjugates of ubiquitin cross-reactive protein distribute in a cytoskeletal pattern. Mol Cell Biol. 1994;14:8408–19. doi: 10.1128/mcb.14.12.8408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yuan W, Krug RM. Influenza B virus NS1 protein inhibits conjugation of the interferon (IFN)-induced ubiquitin-like ISG15 protein. EMBO J. 2001;20:362–71. doi: 10.1093/emboj/20.3.362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhao C, Beaudenon SL, Kelley ML, et al. The UbcH8 ubiquitin E2 enzyme is also the E2 enzyme for ISG15, an IFN-alpha/beta-induced ubiquitin-like protein. Proc Natl Acad Sci U S A. 2004;101:7578–82. doi: 10.1073/pnas.0402528101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kim KI, Giannakopoulos NV, Virgin HW, Zhang DE. Interferon-inducible ubiquitin E2, Ubc8, is a conjugating enzyme for protein ISGylation. Mol Cell Biol. 2004;24:9592–600. doi: 10.1128/MCB.24.21.9592-9600.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kim JS, Sun Q, Yu C, Liu A, Liu LF, LaVoie EJ. Quantitative structure-activity relationships on 5-substituted terbenzimidazoles as topoisomerase I poisons and antitumor agents. Bioorg Med Chem. 1998;6:163–72. doi: 10.1016/s0968-0896(97)10021-9. [DOI] [PubMed] [Google Scholar]
  • 35.Dastur A, Beaudenon S, Kelley M, Krug RM, Huibregtse JM. Herc5, an interferon-induced HECT E3 enzyme, is required for conjugation of ISG15 in human cells. J Biol Chem. 2006;281:4334–8. doi: 10.1074/jbc.M512830200. [DOI] [PubMed] [Google Scholar]
  • 36.Zou W, Zhang DE. The interferon-inducible ubiquitin-protein isopeptide ligase (E3) EFP also functions as an ISG15 E3 ligase. J Biol Chem. 2006;281:3989–94. doi: 10.1074/jbc.M510787200. [DOI] [PubMed] [Google Scholar]
  • 37.Okumura A, Lu G, Pitha-Rowe I, Pitha PM. Innate antiviral response targets HIV-1 release by the induction of ubiquitin-like protein ISG15. Proc Natl Acad Sci U S A. 2006;103:1440–5. doi: 10.1073/pnas.0510518103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.D’Cunha J, Ramanujam S, Wagner RJ, Witt PL, Knight E, Jr, Borden EC. In vitro and in vivo secretion of human ISG15, an IFN-induced immunomodulatory cytokine. J Immunol. 1996;157:4100–8. [PubMed] [Google Scholar]
  • 39.Ohwada S, Kobayashi I, Maemura M, et al. Interferon potentiates antiproliferative activity of CPT-11 against human colon cancer xenografts. Cancer Lett. 1996;110:149–54. doi: 10.1016/s0304-3835(96)04477-1. [DOI] [PubMed] [Google Scholar]
  • 40.Kobayashi I, Ohwada S, Maemura M. Interferon-alpha potentiates the antiproliferative activity of CPT-11 against human colon cancer xenografts in nude mice. Anticancer Res. 1996;16:2677–80. [PubMed] [Google Scholar]
  • 41.Dao CT, Luo JK, Zhang DE. Retinoic acid-induced protein ISGylation is dependent on interferon signal transduction. Blood Cells Mol Dis. 2006;36:406–13. doi: 10.1016/j.bcmd.2006.02.005. [DOI] [PubMed] [Google Scholar]

RESOURCES