Abstract
Non-small cell lung cancer (NSCLC) cells with somatic mutations in K-ras recruit to the tumor a variety of cell types (hereafter collectively termed “stromal cells”) that can promote or inhibit tumorigenesis by mechanisms that have not been fully elucidated. Here we postulated that stromal cells in the tumor microenvironment alter the tumor cell secretome, including those proteins required for tumor growth and dissemination, and we developed an in vitro model to test this hypothesis. Co-culturing a murine K-ras-mutant lung adenocarcinoma cell line (LKR-13) with a murine lung stromal cell (macrophage, endothelial cell, or fibroblast) enhanced stromal cell migration, induced endothelial tube formation, increased LKR-13 cell proliferation, and regulated the secretion of proteins involved in angiogenesis, inflammation, cell proliferation, and epithelial-to-mesenchymal transition. Among these proteins, CXCL1 has been reported to promote NSCLC development, whereas interleukin-18 (IL18) has an undefined role. Genetic and pharmacologic strategies to inhibit CXCL1 and IL18 revealed that stromal cell migration, LKR-13 cell proliferation, and LKR-13 cell tumorigenicity required one or both of these proteins. We conclude that stromal cells enhanced LKR-13 cell tumorigenicity partly through their effects on the secretome of LKR-13 cells. Strategies to inhibit tumor/stromal cell interactions may be useful as therapeutic approaches in NSCLC patients.
The tumor microenvironment is composed of structural (extracellular matrix), soluble (cytokines, proteases, and hormones, among others), and cellular components (tumor cells, fibroblasts, inflammatory cells, vascular and lymphatic endothelial cells, and vascular smooth muscle cells and pericytic cells, among others) (1). Characterization of the inflammatory cells within tumors has revealed cells involved in both the adaptive and innate arms of the immune response. For example, dendritic cells in the microenvironment present tumor antigens to lymphocytes (CD4+, CD8+, and natural killer), promoting an anti-tumor response. A population of immature myeloid cells (called myeloid-derived suppressor cells) suppresses the anti-tumor cytotoxic T cell response by promoting the development of FOXP3+ CD4+ T cells (Tregs) and inducing polarized differentiation of monocytes into tumor-associated macrophages (TAMs or M2 macrophages) (1). TAMs, vascular endothelial cells, and fibroblasts within the tumor stroma secrete a number of growth factors and chemokines that promote tumorigenesis (1).
Chemokines, cytokines, and interleukins, which are expressed in leukocytes, endothelial cells, fibroblasts, tumor cells, and other cell types, regulate the trafficking of leukocytes and endothelial cells to sites of infection, inflammation, trauma, and malignancy (2, 3). Chemokines have been grouped into four subfamilies (CXC, CC, CX3C, and C according to their structural cysteine motif found near the amino-terminus) and bind promiscuously to a family of G protein-coupled chemokine receptors (2). Consistent with their ability to respond to local environmental cues, pro-inflammatory chemokines and interleukins are present at high levels in the microenvironment of epithelial tumors. For example, non-small cell lung cancer (NSCLC) biopsy specimens have high intra-tumoral concentrations of CXCR2 ligands (CXCL1, CXCL5, and CXCL8) and type 2 cytokines (interleukin[IL]-4, IL5, IL10, and IL13) (4, 5). However, the roles of these and other cytokines in the complex network of cell-cell interactions in the tumor microenvironment have not been fully elucidated.
Activating mutations in K-ras occur in approximately 10% of NSCLC specimens overall and 30% of the adenocarcinoma subtype (6). Several lines of evidence suggest that the in vivo transforming activity of oncogenic K-ras is mediated in part through epithelial cell non-autonomous mechanisms. In KrasLA1 mice, lung adenocarcinomas that develop due to somatic activation of a latent oncogenic K-ras allele recruit macrophages, endothelial cells, neutrophils, and fibroblasts, a process driven in part by high expression of CXCR2 ligands (7, 8). Other mouse models that develop Ras-induced tumors are dependent upon expression of matrix metalloproteinases, vascular endothelial growth factor (VEGF), and CXCL8, which recruit inflammatory cells and endothelial cells to the tumor (9–12).
Here we sought to further define the interactions between lung stromal cells and K-ras-mutant lung cancer cells that promote lung tumorigenesis, an important question given that NSCLC patients might benefit from pharmaceutical strategies to target those interactions. We co-cultured a lung adenocarcinoma cell line derived from KrasLA1 mice (LKR-13) with cell lines derived from lung stroma and profiled the secreted proteins in the co-cultures. We found that this in vitro model recapitulated features of the lung cancer microenvironment in vivo and identified novel mediators of cell-cell interactions that warrant further investigation of their roles in NSCLC development.
Materials and Methods
Cell Lines
The derivation and culture conditions of the cell lines used in this study (LKR13, MEC, MHS, and MLg) have been described previously (7, 13–15). LKR-13 cells were a gift (Tyler Jacks, Massachusetts Institute of Technology), and the others were purchased from American Type Culture Collection (Manassas, VA).
Antibodies and Recombinant Peptides
We purchased recombinant murine peptides (CXCL1, CXCL2, IL18, and IL18-binding protein [IL18BP]) (R&D Systems, Minneapolis, MN); IL18 ELISA kits (R&D Systems); IL18 shRNA retroviral vectors (Open Biosystems, Huntsville, AL); anti-total p38 antibodies, anti-P-p38 (Thr180/Tyr182) antibodies, anti-total ERK1/2 antibodies, anti-P-ERK (Thr202/Tyr204) antibodies, and anti-p65 antibodies (Cell Signaling Technologies, Danvers, MA); RNeasy mini kit (Qiagen, Valencia, CA); PCR reagents (MMLV-RT, Rnasin, 5x MMLV Buffer, Hexamer, BSA, and dNTP) (Promega, Madison, WI), PCR primers (Sigma Chemicals, St. Louis, MO), and SYBR green PCR mix (Applied Biosystems, Foster City, CA) for quantitative PCR; and Transwell plates with 8 μm pores for migration assays (BD Biosciences). CXCR2 immune serum and normal goat immune serum were purified to isolate anti-CXCR2 neutralizing antibodies and control IgG as described previously (7).
Migration Assay
Cells (105) were plated in the bottom chambers of 24-well Transwell plates (BD Biosciences) in Dulbecco’s modified essential (DME) medium containing 10% serum and allowed to adhere for 4–6 h. After the membranes of the top chambers were coated with 0.1 % gelatin, cells (5 x 104) were seeded into the top chambers, which were inserted into the bottom wells. The medium was then changed to serum-free Dulbecco’s modified essential medium. Each condition was evaluated in replicate (quadruplicate wells). For CXCR2 and IL18 neutralization experiments, the cells in the upper chamber were pre-treated for 1 h with anti-CXCR2 antibody (1:100) or IL18BP (400 ng/mL) prior to placing the insert into the well. After incubation for 16–18 h, the conditioned medium was removed for use in later experiments, and the cells in the top chamber were fixed with 90% ethanol. Cells remaining on the seeded surface of the membrane were wiped off with a cotton swab, and the migrated cells on the undersurface of the membrane were stained with 0.1% crystal violet, washed with sterile double-distilled H2O, and photographed. Five microscopic fields (4x) were counted per filter. Results were expressed as the mean ± SD of results from the replicate wells.
Tube Formation Assay
MECs (2 x 104) were plated onto 96-well plates coated with GFR-Matrigel (BD Biosciences # 356231) or the upper chambers of Transwell plates coated with GFR-Matrigel. Each condition was performed in replicate (quadruplicate wells). After co-culture for 4 h, the numbers of enclosed tubes within the network were counted from five randomly-chosen microscopic fields (4x). Results are expressed as the mean ± SD of results from the replicate wells.
Proliferation Assay
We evaluated the ability of conditioned medium samples to induce cellular proliferation by using 3-(4,5 dimethylthiazol-2-thiazyl)-2,5-diphenyl-tetrazolium bromide (MTT, Sigma Chemical) assays. Briefly, LKR13 cells or stromal cells (3,000 per well) were plated in 96-well plates (four wells per condition). After 24 h, the cells were washed and treated with conditioned media samples in the presence or absence of different concentrations of recombinant peptides or antibodies. After 24 h, MTT solution (5mg/mL) was added and the cells were incubated at 37°C for 3 h. The supernatant was aspirated, the cells were treated with DMSO (100 μl), and absorbance was measured at 570 nm. Results were expressed as the mean ± SD of results from replicate wells.
Cytokine Quantification in Conditioned Medium Samples
Mouse cytokine concentrations in conditioned medium samples were quantified by using Bioplex multiplex bead-based assays with mouse 23-plex and 9-plex kits (Bio-Rad Laboratories, Hercules, CA). This is a multiplexed, particle-based, flow cytometric assay which utilizes anti-cytokine monoclonal antibodies linked to microspheres incorporating distinct proportions of two fluorescent dyes (16). For each cytokine calibration curve, eight standards were performed that ranged from 2.0 to 32,000 pg/mL. Data acquisition and analysis was completed by using the Bio-Plex 200 system with workstation (Bioplex Manager Software Version 5.0). Each condition was performed in replicate (triplicate conditioned medium samples), from which the means (± SD) were calculated. The assays were performed three times, and results from one of the three assays are shown in Table 1.
Table 1.
Concentrations of Chemokines and Cytokines in Conditioned Media Samples from Mono- and Co-cultures Based on Multiplexed Antibody Bead Assays
Cells in Culture (mono- or co-culture) | ||||||||
---|---|---|---|---|---|---|---|---|
Mean (± S.D.) | LKR13 | MHS | MEC | MLg | MHS/LKR13 | MEC/LKR13 | MLg/LKR13 | |
Chemokines (pg/ml) | MCP-1/CCL2 | 92.66 (9.05) | 270.78 (41.5) | 484.89 (6.07) | 1296.18 (168.39) | 916.16** (65.62) | 416.55 (78.42) | 341.84 (131.62) |
MIP-1a/CCL3 | 41.11 (1.68) | - | 45.10 (3.10) | 55.93 (5.77) | 873.24** (197.48) | 42.34 (2.57) | 85.21 (4.49) | |
MIP-1b/CCL4 | 2.90 (1.13) | 2740.85 (282.56) | 3.16 (0.43) | 9.28 (2.60) | 60.89 (7.20) | 6.78 (1.29) | 5.48 (3.14) | |
RANTES/CCL5 | - | 12697.67 (4843.35) | 115.13 (48.89) | 28.93 (2.22) | 22.05 (1.53) | - | - | |
EOTAXIN/CCL11 | 349.34 (63.20) | 366.16 (30.22) | 347.76 (15.52) | 662.20 (88.83) | 372.50 (6.35) | 247.02 (25.00) | 337.33 (65.78) | |
KC /CXCL1 | 205.33 (8.62) | - | 143 (8.72) | 40.86 (5.56) | 5246.33** (149.22) | 4070.33** (578.84) | 1817.00** (166.58) | |
MIP-2/CXCL2 | 2.22 (0.70) | 13.72 (1.36) | - | - | 969.54* (59.38) | 26.95* (6.25) | 22.92 (7.77) | |
MIG/CXCL9 | - | - | - | - | 16.28 (2.50) | - | - | |
Growth Factors (pg/ml) | bFGF | - | - | - | 24.68 (1.13) | 10.00 (1.41) | 9.00 (0.10) | 4.00 (0.00) |
PDGFβ | - | - | - | - | - | - | - | |
VEGF | 849.65 (196.43) | - | 46.27 (3.62) | 504.55 (40.04) | 1684.52** (466.62) | 2101.63** (205.61) | 2383.64* (534.12) | |
Interleukins (pg/ml) | IL1a | - | - | - | 5.42 (0.78) | - | - | - |
IL1b | 14.74 (1.61) | 119.96 (11.30) | 16.50 (2.29) | 30.10 (1.06) | 64.47 (3.97) | 21.87 (2.45) | 14.54 (6.48) | |
IL2 | - | - | - | 10.06 (0.82) | - | - | - | |
IL3 | - | - | - | - | - | - | - | |
IL4 | - | - | - | 0.45 (0.11) | - | - | - | |
IL5 | - | - | - | - | - | - | - | |
IL6 | - | 1.47 (0.28) | 2.44 (0.14) | 2.27 (0.86) | 26.15** (2.21) | 4.85 (0.97) | - | |
IL9 | 8.08 (3.39) | 15.16 (2.97) | 8.54 (2.82) | 16.02 (5.97) | 25.37 (3.07) | 19.87 (2.43) | 16.29 (2.19) | |
IL10 | 4.19 (1.23) | 14.40 (1.98) | 5.88 (0.67) | 15.28 (1.84) | 8.09 (0.26) | 4.92 (0.46) | 3.82 (1.02) | |
IL12 (p40) | - | - | - | - | - | - | - | |
IL12 (p70) | 13.64 (1.07) | 17.57 (2.60) | 15.71 (3.10) | 17.81 (1.70) | 13.83 (2.09) | 13.18 (0.13) | 13.13 (2.53) | |
IL13 | 66.56 (9.07) | 178.63 (24.91) | 95.72 (4.87) | 164.27 (13.24) | 161.14 (3.83) | 98.493 (9.66) | 55.92 (34.05) | |
IL15 | 6.085 (1.11) | - | - | 187.95** (88.15) | 42.61** (5.99) | 30.94 (15.24) | ||
IL17 | - | - | - | - | - | - | - | |
IL18 | 3.11 (0.53) | - | - | - | 133.52** (70.01) | 48.04** (10.58) | 33.29** (7.55) | |
Other Cytokines (pg/ml) | G-CSF | - | - | - | - | 221.22** (54.75) | - | - |
GM-CSF | 6.34 (0.23) | 5.35 (0.24) | 2.52 (0.38) | 9.65 (0.01) | 70.52** (5.19) | 23.47* (6.06) | 90.60* (21.98) | |
IFNγ | 3.37 (1.10) | 4.31 (0.23) | 3.28 (0.19) | 8.67 (2.95) | 3.40 (0.61) | 3.07 (0.28) | 6.26 (0.64) | |
TNFα | 5.84 (0.94) | 5.8 (1.14) | 5.76 (0.68) | 23.30 (1.17) | 79.59** (8.97) | 9.46 (0.26) | 8.25 (0.79) | |
LIF | 18.63 (4.07) | - | 8.14 (2.29) | 2.69 (0.75) | 169.11** (59.55) | 120.05** (5.04) | 157.67** (65.09) |
The illustrated results are from one experiment and are representative of results from three experiments. Values are the means of triplicate samples. (−) designates undetectable levels. (**) designates p value<0.01. (*) designates p value<0.05.
IL18 short hairpin RNA (shRNA) transfection studies
pSM2 retroviral scrambled shRNA control and murine IL18 shRNAmir clones were purchased from Open Biosystems (Huntsville, AL). The two IL18-specific shRNAmir sequences used included: (A) 5′-TGCTGTTGACAGTGAGCGACGCAGTAATACGGAATATAAATAGTGAAGCCA CAGATGTATTTATATTCCGTATTACTGCGGTGCCTACTGCCTCGGA-3′; (B) 5′-TGCT GTTGACAGTGAGCGCCCAAGTTCTCTTCGTTGACAATAGTGAAGCCACAGATGTA TTGTCAACGAAGAGAACTTGGTTGCCTACTGCCTCGGA-3′. PT67 fibroblasts (Becton Dickson) were transfected with control or an IL18-specific shRNAmir construct and selected for 21 d in 2 μg/ml puromycin to generate mass populations of retrovirus-producing cells. Supernatants from PT67 cells were concentrated using a 0.45 μm PVDF filter. LKR-13 cells were exposed to retrovirus in the presence of 5.0 μg/ml polybrene (Sigma) overnight. The media were then replaced with fresh media, and the transfectants were incubated overnight. To generate transient transfectants, this transfection process was repeated four times to increase the transfection efficiency, and mass populations were used in the experiments. To generate stable transfectants, LKR13 cells were selected in puromycin (4.0 μg/ml) for 21 d, and single cell subclones were isolated and expanded.
Colony Formation Assay
LKR-13 cells (2,500 cells per well in 0.5 ml of 0.8% soft agarose) were seeded into 12-well plates layered with 1.8% agar. Each condition was performed in replicates (triplicate wells). Cells were treated with conditioned medium samples for 14 d and fixed and stained with crystal violet/methanol (0.005% in 20% methanol). Visible colonies were counted using a microscope (4x magnification).
Quantitative PCR Assay
RNA was isolated from cells (RNeasy mini kit), and 2 μg of each RNA sample was reverse-transcribed. PCR analysis was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems). The comparative threshold method was employed using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an endogenous reference housekeeping gene. Serial dilutions of a mixture of cDNA samples were used as the standard curve for each reaction. SYBR green I was used as the fluorophore. All experiments were performed in triplicate. The primer sequences were as follows: GAPDH, forward: 5′-TGAAGCAGGCATCTGAGGG-3′; reverse: 5′-CGAAGGTGGAAGAG TGGGAG-3′; CXCL1, forward: 5′-GCACCCAAACCGA AGT CATA-3′; reverse: 5′-TGGGGACACCTTTTAGCATC-3′; CXCL2, forward: 5′-AGCCT GGATCGTACCTGATG-3′; reverse: 5′-TAACAAC ATCTGGGCAATGG-3′.
Western Blot Analysis
Lysates from cell lines were separated by SDS-PAGE and transferred onto a polyvinylidene fluoride nitrocellulose membrane (Bio-Rad Laboratories, Hercules, CA). Membranes were immunoblotted overnight at 40C with primary antibodies in TBST containing 5% nonfat dry milk. Antibody binding was detected with an enhanced chemiluminescence kit according to the manufacturer’s instructions (Amersham, Arlington Heights, IL).
Sample preparation for quantitative proteomics
LKR13 cells were grown in the presence of 13C6-arginine +2H4 lysine (medium) and 13C6 15N4-arginine +13C6 15N2 lysine (heavy) labeled amino acids; MHS, MEC, MLg cells were grown in light (no label) and heavy amino acids (Cambridge Isotope Labs, Andover, MA). A detailed protocol for stable isotope labeling with amino acids in cell culture (SILAC) media preparation is described (17, 18) and is available online (http://www.silac.org). The cells were adapted to SILAC media by allowing 5 passages of cell culture and completion of labeling was checked by performing in-gel digestion and mass spectrometry analysis using cells collected at the end of 5 passages. At the end of the 5th passage, an equal number of MEC, MHS and MLg grown in heavy media were co-cultured with 3 sets of LKR13 cells cultured in heavy media. For example, MHS/Heavy 5 x 104 cells/5ml were co-cultured with LKR13 cells (5 x 104 cells/5ml) grown in heavy media for 24 h. The two types of cells were separated by using a strainer mesh. Simultaneously, 5 ml of cell-free media were also collected from same number of MHS cells and LKR13 cells labeled with light and medium amino acids, respectively. These three supernatants (cell ratios 1:1:2) were combined in the presence of protease inhibitor cocktail tablets (Roche Applied Science) and concentrated using Centriprep YM-3 (Millipore). The samples were then separated on 1D-SDS-PAGE (10%) and bands were visualized using colloidal Coomassie staining. The protein bands were excised, reduced, alkylated and digested with trypsin as previously described (18). Supernatants from the in-gel digestion were collected by three consecutive extractions using 0.1% formic acid, 0.1% formic acid 50% acetonitrile and acetonitrile and dried in vacufuge.
Liquid chromatography-mass spectrometry (LC-MS/MS)
Dried peptides were reconstituted in 10 μl 0.2% formic acid and analyzed using reversed phase liquid chromatography tandem mass spectrometry (LC-MS/MS). The liquid chromatography system used (Agilent 1100 series) is designed to deliver solvent at 1μl/min flow for sample loading and cleaning on the pre-column and at 250–300 nl/min for peptide fractionation on the analytical column. Pre-column (ID-75μm, 3 cm) was packed with 5–10μm C18 ODS-A (YMC Co, Kyoto, Japan), and the analytical column (ID-75μm, 10 cm) was packed with 5μm Yydac C18 resin (Nest Group, Sothboro, MA). An emitter tip of 8 μM (New Objective, Woburn, MA) was attached. The columns were equilibrated with 95% solvent A containing 0.4% formic acid (0.005% heptafluorobutyric acid, v/v) before applying peptide to the column. Peptides were separated using a linear gradient (90% of solvent A to 40% of solvent B, 90% acetonitrile, 0.1% formic acid, 0.005% heptafluorobutyric acid, v/v) for 30 min. The LC-MS/MS analysis was performed using a Micromass Q-ToF US-API mass spectrometer (Waters) in a data-dependent manner choosing the three most abundant ions selected for MS/MS analysis and further excluded for 45 s.
Mass spectrometry data were acquired using Masslynx (Version 4.0). The following settings were used for automated data collection: Ion mass window, 2.5 Da; Intensity threshold for MS/MS to MS switch, 5 counts/s; MS to MS/MS switch, 20 counts/s; scan time for MS and MS/MS, 1s each; number of scans per cycle, 3; and total cycle time, 10 s with an interscan delay of 0.1 s. Peak list files (pkl) from individual MS/MS scans were generated using Masslynx with the following parameters: smooth window, 4.0; number of smooths, 2 (Savitzky Golay smooth mode). Using a perl script, pkl files from each LC-MS/MS experiment were combined to generate a Mascot-readable file, which were searched using Mascot v2.2.0 (Matrixscience, Manchester, UK) against RefSeq 26 mouse database (dated 11/04/2007) containing 20311 sequences. The following modifications were included while searching the database: carbamidomethylation of cysteine was set as a fixed modification; and 13C6-arginine, 13C615N4-arginine, 2H4 lysine, 13C615N2 lysine, and oxidation of methionine were set as variable modifications. The mass tolerance was set at 0.2 atomic mass units for precursor and 0.5 atomic mass units for fragmented ions. Relative quantitation of SILAC-labeled peptides was performed using MSQuant downloaded from http://msquant.sourceforge.net (19). Mascot search results in .html format were parsed with the raw data file in MSQuant. Under quantitation modes, the masses of the medium and heavy arginine and lysine residues were added in order for MSquant to recognize the MS peaks from raw files for quantitation. The quantitation data were verified by manual inspection of the heavy and light peptides derived from MS and MS/MS spectra in MSQuant. Fold-changes were calculated for the SILAC MS clusters with at least one peak corresponding to >30 mascot score. The average protein ratio was calculated based on the individual ratios obtained for all peptides derived from a specific protein.
Mouse experiments
Prior to their initiation, all mouse studies were submitted to and approved by the Institutional Animal Care and Use Committee at the University of Texas –M. D. Anderson Cancer Center. Mice received standards of care and were euthanized according to the standards set forth by the IACUC. 129/SV mice (n=4 per group) were injected subcutaneously in the right flank with 106 LKR-13 cells that had been stably transfected with IL18-specific shRNA or scrambled control retroviral vectors. Mice were monitored daily for growth of tumor and sacrificed after 21 d. The tumors were removed, photographed, and formalin-fixed.
Results
Co-Culture Model
A co-culture model was created using LKR-13 cells and one of three immortalized murine lung stromal cell lines, including a fibroblast (MLg), an endothelial cell (MEC), and a macrophage (MHS). LKR-13 cells were chosen for this model because they potently chemoattract inflammatory cells and endothelial cells when injected subcutaneously into nude mice (7, 8). The cells were cultured in Transwell plates containing two chambers separated by a porous membrane that allowed bi-directional diffusion of secreted, soluble mediators. For endothelial tube formation assays, MECs were seeded onto a layer of growth factor-reduced Matrigel covering the porous membrane. Cells migrating across the porous membrane and MEC endothelial tubes were counted. Conditioned media samples were collected from these co-cultures to measure cytokine concentrations and to examine their mitogenic effects on cells.
The migration of stromal cells in mono-cultures was sharply enhanced by co-culturing them with either LKR-13 cells or each other (Fig. 1A). The stromal cells only weakly chemoattracted LKR-13 cells (Fig. 1A), which was not due to a defect in the ability of LKR-13 cells to migrate based on our finding that fetal bovine serum (10%) potently chemoattracted LKR-13 cells (data not shown). Cultured alone, MECs developed no tubes, but tubes formed when MECs were co-cultured with any of the other cell types (Fig. 1B). Treatment with conditioned medium samples increased the proliferation of LKR-13 cells and MECs but not the other stromal cells (Fig. 1C). LKR-13 colony formation in soft agar was enhanced by treatment with conditioned medium samples from MECs (mono- or co-cultures) and LKR-13/MLg co-cultures (Fig. 1D). Collectively, these findings demonstrated bi-directional interactions between LKR-13 cells and stromal cells through the secretion of soluble mediators.
Figure 1.
The co-culture model. (A, B) Cells in the in vitro model chemoattract each other and induce MEC tube formation. Co-cultures were performed to evaluate (A) cell migration and (B) MEC tube formation. (A) Cells in the top chambers (“Migrating Cell Types”) were mono-cultured (−) or co-cultured (cell types in the bottom chambers indicated in the top right inset of each picture). Photographs illustrate (A) migrating cells and (B) MEC tubes. Migrating cells and MEC tubes were counted in at least 5 separate microscopic fields per well, which were averaged, and the mean values per well (± SD) were calculated from replicate wells (bar graphs). (C, D) Treatment with conditioned medium samples increases the proliferation of MECs and LKR-13 cells. (C) Cells in monolayer were treated for 24 h with conditioned medium samples and subjected to MTT assays. (D) LKR-13 cells were seeded in soft agar and treated for 14 d with conditioned medium samples, photographed, and quantified. The cell types (mono- or co-cultures) from which the conditioned media samples were collected and used as treatments are indicated (C, legend for the MTT assays; D, bottom edge of each photographed well). Mean values (± SD) of (C) relative cell densities and (D) colony numbers were calculated from replicate samples (bar graphs). * P<0.05: A and B, co-culture versus mono-culture; C and D, conditioned medium versus unconditioned medium
Chemokine and Cytokine Regulation in Co-Cultured Cells
We assessed the mediators secreted by cells in mono- and co-cultures by performing multiplexed cytokine assays on conditioned media samples. Of the 32 proteins examined, 27 were detectable at the limits of sensitivity of this assay (1 pg/mL) (Table 1). The chemokines and cytokines that were most abundant (≥ 50 pg/ml) in the mono-cultures were CCL2, CCL3, CCL4, CCL5, CCL11, CXCL1, VEGF, IL1β, and IL13. Those that increased in the co-cultures based on the criterion of at least a two-fold increase in concentration relative to that of the mono-cultures were CCL2, CCL3, CXCL1, CXCL2, VEGF, IL15, IL18, granulocyte colony stimulating factor, gramnulocyte-monocyte colony stimulating factor, tumor necrosis factor-α (TNFα), and leukemia inhibitory factor (LIF) (Table 1). The majority of these were undetectable in mono-cultured cells, indicating that the cytokines expressed basally were distinct from those regulated by cell-cell interactions. Although LKR-13 cell densities increased by approximately 50% in co-culture, this was far less than the increases in cytokines. For example, KC increased 9- to 20-fold in the co-cultures, and IL18 increased 10- to 44-fold (Table 1), indicating that the changes in LKR-13 cell density can not account for the changes in these cytokine concentrations.
Regulation of Extracellular Matrix Proteins, Cell Adhesion Molecules, and Proteases in Co-Cultures
To further assess the spectrum of biologic processes in the co-cultures and the secreted proteins that mediate these processes, SILAC assays were performed on conditioned media samples obtained from the three co-culture experiments. The secreted proteins were profiled and the relative abundance of each protein was compared in mono- and co-cultures. A total of 299 proteins were isolated and sequenced from the three experiments (83 in MHS/LKR-13, 82 in MEC/LKR-13, and 134 in MLg/LKR-13), 181 of which were found to be unique proteins (Supplementary Table 1). Examples of the MS/MS spectra obtained from the SILAC assays are illustrated in Supplementary Figures 1–4. These proteins did not include any of the cytokines identified by the multiplexed antibody assays (Table 1) because the lower limit of sensitivity for SILAC is approximately 1 μg/ml, which exceeded the concentrations of cytokines identified by the multiplexed antibody assays (Table 1).
Based on the criterion of at least a two-fold difference between mono- and co-cultures, the abundance of certain proteins changed in the co-cultures (Supplementary Table 2). For example, in mono-culture, LKR-13 cells secreted extracellular matrix and cell surface molecules involved in cell adhesion (tenascin XB, calsyntenin-1, E-cadherin, biglycan, and agrin), proteases that promote invasion (osteopontin and cathepsin H), a pro-survival molecule (clusterin), and pro-angiogenic molecules (CX3CL1, vascular cell adhesion molecule-1, and agrin), all of which decreased in the co-cultures. The reduction in cell adhesion molecules, including E-cadherin (Supplementary Table 2), has been reported in cancer cells that have undergone epithelial-to-mesenchymal transition (EMT) (20). Thus, a number of proteins with a broad range of biologic functions in the extracellular matrix were regulated in the co-cultures.
In addition to these extracellular matrix proteins, a number of intracellular proteins (i.e. transaminases, dehydrogenases, and RNA-binding proteins) were identified by the SILAC assays (Supplementary Table 1). This leakage of intracellular proteins into the media suggested that cell lysis had occurred. However, examination of the co-cultures revealed no evidence of floating cells, and western analysis of the adherent cells for caspase-3 cleavage revealed no detectable evidence of apoptosis (data not shown), suggesting that the level of cell death in the co-cultures was minimal.
Role of CXCL1 and IL18
CXCL1 was the most abundant chemokine detected in the co-cultures (Table 1). CXCL1 RNA levels increased in co-cultured LKR-13 cells but not in co-cultured stromal cells (Supplementary Fig. 5A), indicating that LKR-13 cells were the primary source of CXCL1 in the co-cultures. Similarly, lung tumors obtained from KrasLA1 mice have high CXCL1 expression, and the growth of these tumors is dependent upon CXCR2, the primary receptor for CXCL1 (2). To assess whether the in vitro model was CXCR2-dependent, we treated the co-cultures with an anti-CXCR2 neutralizing antibody (7). CXCR2 neutralization decreased the ability of LKR-13 cells to chemoattract stromal cells and attenuated LKR-13 cell colony formation in soft agar (Supplementary Fig. 5B and 5C), demonstrating that these features of the co-cultures were CXCR2-dependent.
A cytokine that increased in all three co-cultures was IL18 (Table 1), a member of the IL1 family that can either inhibit tumorigenesis by activating interferon-χ production in natural killer cells or promote it by enhancing VEGF secretion from tumor cells (21). Because VEGF and IL18 levels were coordinately regulated in these co-cultures (Table 1), we postulated that IL18 promotes cell-cell interactions in this model. IL18 was inhibited pharmacologically by treating the cultures with IL18BP, which neutralizes IL18 biologic activity (22). Pre-treatment with IL18BP inhibited the ability of conditioned media samples from co-cultures to enhance stromal cell migration and LKR-13 colony formation (Fig. 2A, 2B). Treatment of MECs with recombinant IL18 induced tube formation (Fig. 2C), but the addition of IL18BP did not abrogate tube formation induced by treatment with co-culture conditioned media samples (data not shown). Thus, IL18 was sufficient to induce MEC tube formation and IL18 inhibition attenuated the ability of LKR-13 cells to chemoattract stromal cells and to proliferate in anchorage-independent conditions.
Figure 2.
IL18 promotes bi-directional interactions between LKR-13 cells and stromal cells. (A) IL18BP abrogates stromal cell migration induced by conditioned media samples obtained from co-cultures. Stromal cells (“Migrating Cell Types”) were seeded in the top chamber. The bottom chambers were loaded with unconditioned medium (C) or conditioned medium samples in the presence (+) or absence (−) of IL18BP. The cell types (mono- or co-cultures) from which the conditioned media samples were collected and used as treatments are indicated at top right inset of each photographed well. Photographs illustrate migrated cells in representative wells. Cells were counted in at least 5 separate microscopic fields per well, which were averaged, and the mean values per well (± SD) were calculated from replicate wells (adjacent bar graphs). *P<0.05 (IL18BP versus no treatment) (B) IL18BP abrogates LKR-13 colony formation. LKR-13 cells were seeded in soft agar and treated for 14 d with unconditioned medium (Con) or conditioned medium samples in the presence (+) or absence (−) of IL18BP, photographed, and quantified (bar graphs). Results represent the mean values (± SD) of replicate wells. The cell types from which the conditioned media samples were collected and used as treatments are indicated underneath each photographed well. * P<0.05 (IL18BP versus no treatment). (C) IL18 induces MEC tube formation. Photographs illustrate MECs in the presence (+) or absence (−) of recombinant IL18 (200 ng per well). MEC tubes were counted in at least 5 separate microscopic fields per well, which were averaged, and the mean values per well (± SD) were calculated from replicate wells (bar graphs). * P<0.05 (recombinant IL18 versus no treatment).
To genetically inhibit IL18, LKR-13 cells were transiently transfected with IL18 shRNA retroviral vectors. Two different IL18 shRNA constructs (A and B) were used that target different coding sequences to evaluate whether they induced consistent biological effects. ELISA of conditioned media samples revealed that IL18 was inhibited in both transfectants (A and B), and western blot analysis of NFκB, a downstream mediator of IL18, demonstrated accumulation of NFκB in the cytoplasm, which is consistent with NFκB inactivation (Fig. 3A). IL18 depletion from LKR-13 cells inhibited their ability to chemoattract stromal cells in co-culture (Fig. 3B). We next evaluated whether IL18 depletion attenuated LKR-13 cell proliferation in monolayer cultures and tumorigenicity in syngeneic (129/SV) mice. For this experiment, we generated LKR-13 cells stably transfected with IL18-specific shRNA (vector A). ELISA of conditioned media samples revealed that IL18 secretion was inhibited in the IL18-specific shRNA stable transfectants relative to that of control transfectants (Fig. 3C). In monolayer cultures, the IL18-depleted LKR-13 cells exhibited reduced proliferation (Fig. 3C). Three weeks after subcutaneous injection in syngeneic mice (n=4 per group), the IL18-depleted tumors were much smaller than the control tumors (Fig. 3C). Thus, IL18 inhibition attenuated the ability of LKR-13 cells to chemoattract stromal cells, to proliferate in monolayer cultures, and to form tumors in syngeneic mice.
Figure 3.
IL18 promotes bi-directional interactions between LKR-13 cells and stromal cells and enhances LKR-13 cell tumorigenicity. (A) Transfection of IL18 shRNA decreases IL18 secretion and inhibits NFκB activation in LKR-13 cells. (Left) IL18 ELISA of conditioned media samples and (right) western blot analysis of p65 in cytoplasmic (cyt) and nuclear (nuc) fractions of LKR-13 cells transfected with IL18-specific shRNA vectors (A or B) or scrambled shRNA control (Scr). The expression of poly (ADP-ribose) polymerase (PARP) in nuclear but not cytoplasmic fractions on western blotting indicates fractionation efficiency. Intensities of p65 bands in shRNA-transfectants were measured by densitometric scanning and expressed relative to that of scrambled control transfectants (relative densitometric units or R.D.U.). (B) Transfection of IL18 shRNA inhibits stromal cell migration. Stromal cells (“Migrating Cell Types”) were seeded in the top chamber, and LKR-13 cells transfected with IL18-specific shRNA vectors (A or B) or scrambled shRNA control (Scr) were seeded into the bottom chamber. Photographs illustrate migrated cells in representative wells. Cells were counted in at least 5 separate microscopic fields per well, which were averaged, and the mean values per well (± SD) were calculated from replicate wells. * P<0.05 (scrambled versus A or B). (C) IL18 depletion attenuates LKR-13 cell proliferation and tumorigenicity. (Top bar graph) IL18 ELISA performed on conditioned media samples from LKR-13 cells stably transfected with IL18-specific shRNA (vector A) or control shRNA. (Middle bar graph) Stable LKR-13 transfectants were seeded in monolayer cultures and their density was measured by MTT assays after 72 h in culture. Results represent the mean values per well (± SD) calculated from replicate wells. (Bottom bar graph and image) Stable LKR-13 transfectants were injected subcutaneously into syngeneic mice (n=4 per group). Mice were sacrificed after 21 d and the resulting tumors were removed, photographed (IL18-specific shRNA, tumors 1–4; scrambled controls, tumors 5–8), and weighed (mean ± S.D. of 4 tumors in each group).
Discussion
Here we developed an in vitro model to evaluate the mechanisms by which stromal cells regulate the biologic properties of lung adenocarcinoma cells. Several lines of evidence suggest that the in vitro model recapitulated features of KrasLA1 mice and NSCLC patients. First, LKR-13 cells chemoattracted stromal cells, mimicking the intra-tumoral inflammation and angiogenesis in KrasLA1 mice and NSCLC patients (4, 5, 7, 8). Second, conditioned media samples from the co-cultures enhanced LKR-13 cell proliferation and clonogenicity, similar to the mitogenic effect of factors secreted into the tumor microenvironment of KrasLA1 mice (7, 8). Third, some of the chemokines and cytokines found to be regulated in this in vitro model (CCL2, VEGF, CCL5, CXCL1, CXCL2, and CCL11) are also highly expressed in lung tumors in mice and humans (4, 7). Fourth, CXCL1 secretion was enhanced in the co-cultures, and CXCR2 inhibition attenuated cell-cell interactions, which is consistent with the observation that CXCR2 ligands promote malignant progression in KrasLA1 mice and NSCLC patients (4, 7). We concluded that, because the in vitro model recapitulated features of lung tumorigenesis in vivo, it might serve as a useful model of the NSCLC tumor microenvironment.
By using two different proteomic approaches, we profiled the secretome of LKR-13 cells and evaluated its regulation by stromal cells. Many of the proteins secreted by LKR-13 cells have been implicated in neoplastic transformation. For example, in cancer cells, tenascin XB, E-cadherin, and biglycan promote cellular adhesion; osteopontin and cathepsin H have been implicated in invasion; clusterin and LIF are pro-survival molecules; CXCL1, CCL3, LIF, IL18, TNFα, and IL15 are pro-inflammatory molecules; and CXCL1, osteopontin, CX3CL1, VEGF, vascular cell adhesion molecule-1, and agrin promote tumor angiogenesis (24–39). Although many of these proteins were secreted basally, others (CXCL1, CCL3, VEGF, IL18, and LIF) increased in response to cell-cell interactions. Depletion of IL18 resulted in attenuation of LKR-13 cell tumorigenicity, indicating that one of the proteins expressed in response to stromal cell interactions was tumorigenic in LKR-13 cells.
An unexpected finding from the proteomic studies was the modulation of biochemical markers of EMT in the co-cultures. The co-cultures exhibited reduced E-cadherin and loss of cell adhesion and extracellular matrix molecules. Although not definitive evidence of EMT, these changes are closely associated with the loss of cell adhesion and aberrant cell polarity that typify EMT (20). In fact, previous reports support the possibility that cells in the tumor stroma induce neighboring cancer cells to undergo EMT by secreting prostaglandins and cytokines (40, 41). Other findings presented here argue against EMT as a feature of these co-cultures. Analysis of their ability to invade through Matrigel revealed that LKR-13 cells did not exhibit enhanced invasive properties when co-cultured with stromal cells (data not shown). Furthermore, the abundance of proteases known to promote invasion (osteopontin and cathepsin H) clearly decreased in the co-cultures (Table 1). Collectively, these findings suggest that interactions with stromal cells did not induce LKR-13 cells to fully undergo EMT but raise the possibility that stromal cell interactions might facilitate this process.
We found that LKR-13 cells induced MEC tube formation in co-cultures. Several lines of evidence suggest that LKR-13 cells induced angiogenesis through a redundant network of cytokines. First, multiple pro-angiogenic cytokines (VEGF, IL18, and CXCL1) increased in the co-cultures. Second, treatment with recombinant IL18 was sufficient to induce MEC tube formation. Third, pretreatment of conditioned media samples with neutralizing antibodies against CXCR2 did not abrogate MEC tube formation, indicating that factors within the conditioned media samples could compensate for the loss of a single cytokine. Paradoxically, certain pro-angiogenic molecules derived from LKR-13 cells (CX3CL1, vascular cell adhesion molecule-1, and agrin) decreased in the co-cultures. This may be part of a negative feedback loop activated by stromal cells in response to the pro-angiogenic mediators of LKR-13 cells, which clearly increased the numbers of endothelial tubes when co-cultured with MECs.
Treatment strategies that target the tumor stroma have been implemented in NSCLC patients. For example, bevacisumab, an anti-VEGF neutralizing antibody, enhances tumor shrinkage and prolongs NSCLC patient survival when administered in combination with cytotoxic anti-cancer agents (42, 43). These findings lay the groundwork for clinical trials with agents that target other peptides in the tumor microenvironment. Findings presented here and previously in KrasLA1 mice (7) provide a compelling rationale to test the efficacy of inhibitors of CXCL1, IL18, and possibly other cytokines identified in the co-culture model. These inhibitors may be efficacious in patients with K-ras-mutant NSCLC alone or in combination with VEGF antagonists on the basis of a previous report that CXCR2 ligands drive angiogenesis in tumors that have been rendered VEGF-refractory (44).
Acknowledgments
This work was supported by R01 CA117965, P50 CA70907.
References
- 1.Sica A, Bronte V. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Investig. 2007;117(5):1155–66. doi: 10.1172/JCI31422. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mehrad B, Keane MP, Strieter RM. Chemokines as mediators of angiogenesis. Thrombosis Haemostasis. 2007;97(5):755–62. [PMC free article] [PubMed] [Google Scholar]
- 3.von der Thusen JH, Kuiper J, van Berkel TJ, Biessen EA. Interleukins in atherosclerosis: molecular pathways and therapeutic potential. Pharmacol Rev. 2003;55(1):133–66. doi: 10.1124/pr.55.1.5. [DOI] [PubMed] [Google Scholar]
- 4.Arenberg DA, Keane MP, DiGiovine B, et al. Epithelial-neutrophil activating peptide (ENA-78) is an important angiogenic factor in non-small cell lung cancer. J Clin Investig. 1998;102(3):465–72. doi: 10.1172/JCI3145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Huang M, Wang J, Lee P, et al. Human non-small cell lung cancer cells express a type 2 cytokine pattern. Cancer Res. 1995;55(17):3847–53. [PubMed] [Google Scholar]
- 6.Aviel-Ronen S, Blackhall FH, Shepherd FA, Tsao MS. K-ras mutations in non-small-cell lung carcinoma: a review. Clin Lung Cancer. 2006;8(1):30–8. doi: 10.3816/CLC.2006.n.030. [DOI] [PubMed] [Google Scholar]
- 7.Wislez M, Fujimoto N, Izzo JG, et al. High expression of ligands for chemokine receptor CXCR2 in alveolar epithelial neoplasia induced by oncogenic kras. Cancer Res. 2006;66(8):4198–207. doi: 10.1158/0008-5472.CAN-05-3842. [DOI] [PubMed] [Google Scholar]
- 8.Wislez M, Spencer ML, Izzo JG, et al. Inhibition of mammalian target of rapamycin reverses alveolar epithelial neoplasia induced by oncogenic K-ras. Cancer Res. 2005;65(8):3226–35. doi: 10.1158/0008-5472.CAN-04-4420. [DOI] [PubMed] [Google Scholar]
- 9.Ballin M, Gomez DE, Sinha CC, Thorgeirsson UP. Ras oncogene mediated induction of a 92 kDa metalloproteinase; strong correlation with the malignant phenotype. Biochem Biophys Res Commun. 1988;154(3):832–8. doi: 10.1016/0006-291x(88)90215-x. [DOI] [PubMed] [Google Scholar]
- 10.Okada F, Rak JW, Croix BS, et al. Impact of oncogenes in tumor angiogenesis: mutant K-ras up-regulation of vascular endothelial growth factor/vascular permeability factor is necessary, but not sufficient for tumorigenicity of human colorectal carcinoma cells. Proc Natl Acad Sci, USA. 1998;95(7):3609–14. doi: 10.1073/pnas.95.7.3609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sparmann A, Bar-Sagi D. Ras-induced interleukin-8 expression plays a critical role in tumor growth and angiogenesis. Cancer Cell. 2004;6(5):447–58. doi: 10.1016/j.ccr.2004.09.028. [DOI] [PubMed] [Google Scholar]
- 12.Watnick RS, Cheng YN, Rangarajan A, Ince TA, Weinberg RA. Ras modulates Myc activity to repress thrombospondin-1 expression and increase tumor angiogenesis. Cancer Cell. 2003;3(3):219–31. doi: 10.1016/s1535-6108(03)00030-8. [DOI] [PubMed] [Google Scholar]
- 13.Langley RR, Ramirez KM, Tsan RZ, Van Arsdall M, Nilsson MB, Fidler IJ. Tissue-specific microvascular endothelial cell lines from H-2K(b)-tsA58 mice for studies of angiogenesis and metastasis. Cancer Res. 2003;63(11):2971–6. [PubMed] [Google Scholar]
- 14.Mbawuike IN, Herscowitz HB. MH-S, a murine alveolar macrophage cell line: morphological, cytochemical, and functional characteristics. J Leukocyte Biol. 1989;46(2):119–27. doi: 10.1002/jlb.46.2.119. [DOI] [PubMed] [Google Scholar]
- 15.Yoshikura H, Hirokawa Y. Endogenous C-type virus of a mouse cell line and its defectiveness. J Virol. 1974;13(6):1319–25. doi: 10.1128/jvi.13.6.1319-1325.1974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Gronborg M, Kristiansen TZ, Iwahori A, et al. Biomarker discovery from pancreatic cancer secretome using a differential proteomic approach. Mol Cell Proteom. 2006;5(1):157–71. doi: 10.1074/mcp.M500178-MCP200. [DOI] [PubMed] [Google Scholar]
- 17.Amanchy R, Kalume DE, Iwahori A, Zhong J, Pandey A. Phosphoproteome analysis of HeLa cells using stable isotope labeling with amino acids in cell culture (SILAC) J Proteome Res. 2005;4(5):1661–71. doi: 10.1021/pr050134h. [DOI] [PubMed] [Google Scholar]
- 18.Amanchy R, Kalume DE, Pandey A. Stable isotope labeling with amino acids in cell culture (SILAC) for studying dynamics of protein abundance and posttranslational modifications. Sci STKE 2005. 2005;(267):pl2. doi: 10.1126/stke.2672005pl2. [DOI] [PubMed] [Google Scholar]
- 19.Schulze WX, Mann M. A novel proteomic screen for peptide-protein interactions. J Biol Chem. 2004;279(11):10756–64. doi: 10.1074/jbc.M309909200. [DOI] [PubMed] [Google Scholar]
- 20.Tse JC, Kalluri R. Mechanisms of metastasis: epithelial-to-mesenchymal transition and contribution of tumor microenvironment. J Cell Biochem. 2007;101(4):816–29. doi: 10.1002/jcb.21215. [DOI] [PubMed] [Google Scholar]
- 21.Park S, Cheon S, Cho D. The dual effects of interleukin-18 in tumor progression. Cell & Mol Immunol. 2007;4(5):329–35. [PubMed] [Google Scholar]
- 22.Novick D, Kim SH, Fantuzzi G, Reznikov LL, Dinarello CA, Rubinstein M. Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity. 1999;10(1):127–36. doi: 10.1016/s1074-7613(00)80013-8. [DOI] [PubMed] [Google Scholar]
- 23.Chen JJ, Yao PL, Yuan A, et al. Up-regulation of tumor interleukin-8 expression by infiltrating macrophages: its correlation with tumor angiogenesis and patient survival in non-small cell lung cancer. Clin Cancer Res. 2003;9(2):729–37. [PubMed] [Google Scholar]
- 24.Batmunkh E, Tatrai P, Szabo E, et al. Comparison of the expression of agrin, a basement membrane heparan sulfate proteoglycan, in cholangiocarcinoma and hepatocellular carcinoma. Human Pathol. 2007;38(10):1508–15. doi: 10.1016/j.humpath.2007.02.017. [DOI] [PubMed] [Google Scholar]
- 25.Chakraborty G, Jain S, Behera R, et al. The multifaceted roles of osteopontin in cell signaling, tumor progression and angiogenesis. Current Mol Med. 2006;6(8):819–30. doi: 10.2174/156652406779010803. [DOI] [PubMed] [Google Scholar]
- 26.Jedeszko C, Sloane BF. Cysteine cathepsins in human cancer. Biol Chem. 2004;385(11):1017–27. doi: 10.1515/BC.2004.132. [DOI] [PubMed] [Google Scholar]
- 27.Kim KE, Song H, Kim TS, et al. Interleukin-18 is a critical factor for vascular endothelial growth factor-enhanced migration in human gastric cancer cell lines. Oncogene. 2007;26(10):1468–76. doi: 10.1038/sj.onc.1209926. [DOI] [PubMed] [Google Scholar]
- 28.Kurzrock R. The role of cytokines in cancer-related fatigue. Cancer. 2001;92(6 Suppl):1684–8. doi: 10.1002/1097-0142(20010915)92:6+<1684::aid-cncr1497>3.0.co;2-z. [DOI] [PubMed] [Google Scholar]
- 29.Levy P, Ripoche H, Laurendeau I, et al. Microarray-based identification of tenascin C and tenascin XB, genes possibly involved in tumorigenesis associated with neurofibromatosis type 1. Clin Cancer Res. 2007;13(2 Pt 1):398–407. doi: 10.1158/1078-0432.CCR-06-0182. [DOI] [PubMed] [Google Scholar]
- 30.Mocellin S, Nitti D. TNF and cancer: the two sides of the coin. Front Biosci. 2008;13:2774–83. doi: 10.2741/2884. [DOI] [PubMed] [Google Scholar]
- 31.Moretti RM, Marelli MM, Mai S, et al. Clusterin isoforms differentially affect growth and motility of prostate cells: possible implications in prostate tumorigenesis. Cancer Res. 2007;67(21):10325–33. doi: 10.1158/0008-5472.CAN-07-0516. [DOI] [PubMed] [Google Scholar]
- 32.Ren T, Chen Q, Tian Z, Wei H. Down-regulation of surface fractalkine by RNA interference in B16 melanoma reduced tumor growth in mice. Biochem Biophys Res Comm. 2007;364(4):978–84. doi: 10.1016/j.bbrc.2007.10.124. [DOI] [PubMed] [Google Scholar]
- 33.Saad S, Gottlieb DJ, Bradstock KF, Overall CM, Bendall LJ. Cancer cell-associated fibronectin induces release of matrix metalloproteinase-2 from normal fibroblasts. Cancer Res. 2002;62(1):283–9. [PubMed] [Google Scholar]
- 34.Strieter RM, Burdick MD, Mestas J, Gomperts B, Keane MP, Belperio JA. Cancer CXC chemokine networks and tumour angiogenesis. Eur J Cancer. 2006;42(6):768–78. doi: 10.1016/j.ejca.2006.01.006. [DOI] [PubMed] [Google Scholar]
- 35.Takenaka Y, Fukumori T, Raz A. Galectin-3 and metastasis. Glycoconjugate J. 2004;19(7–9):543–9. doi: 10.1023/B:GLYC.0000014084.01324.15. [DOI] [PubMed] [Google Scholar]
- 36.Terpos E, Politou M, Viniou N, Rahemtulla A. Significance of macrophage inflammatory protein-1 alpha (MIP-1alpha) in multiple myeloma. Leuk & Lymphoma. 2005;46(12):1699–707. doi: 10.1080/10428190500175049. [DOI] [PubMed] [Google Scholar]
- 37.Toft DJ, Rosenberg SB, Bergers G, Volpert O, Linzer DI. Reactivation of proliferin gene expression is associated with increased angiogenesis in a cell culture model of fibrosarcoma tumor progression. Proc Natl Acad Sci, USA. 2001;98(23):13055–9. doi: 10.1073/pnas.231364798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Weber CK, Sommer G, Michl P, et al. Biglycan is overexpressed in pancreatic cancer and induces G1-arrest in pancreatic cancer cell lines. Gastroenterol. 2001;121(3):657–67. doi: 10.1053/gast.2001.27222. [DOI] [PubMed] [Google Scholar]
- 39.Wu TC. The role of vascular cell adhesion molecule-1 in tumor immune evasion. Cancer Res. 2007;67(13):6003–6. doi: 10.1158/0008-5472.CAN-07-1543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Dohadwala M, Yang SC, Luo J, et al. Cyclooxygenase-2-dependent regulation of E-cadherin: prostaglandin E(2) induces transcriptional repressors ZEB1 and snail in non-small cell lung cancer. Cancer Res. 2006;66(10):5338–45. doi: 10.1158/0008-5472.CAN-05-3635. [DOI] [PubMed] [Google Scholar]
- 41.Xu J, Wang R, Xie ZH, et al. Prostate cancer metastasis: role of the host microenvironment in promoting epithelial to mesenchymal transition and increased bone and adrenal gland metastasis. The Prostate. 2006;66(15):1664–73. doi: 10.1002/pros.20488. [DOI] [PubMed] [Google Scholar]
- 42.Sandler A, Gray R, Perry MC, et al. Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer. New Engl J Med. 2006;355(24):2542–50. doi: 10.1056/NEJMoa061884. [DOI] [PubMed] [Google Scholar]
- 43.Sandler AB, Gray R, Brahmer J, et al. Randomized phase II/III Trial of paclitaxel (P) plus carboplatin (C) with or without bevacizumab (NSC # 704865) in patients with advanced non-squamous non-small cell lung cancer (NSCLC): An Eastern Cooperative Oncology Group (ECOG) Trial - E4599. J Clin Oncol. 2005;23:16S. Part I of II (June 1 Supplement):4. [Google Scholar]
- 44.Mizukami Y, Jo WS, Duerr EM, et al. Induction of interleukin-8 preserves the angiogenic response in HIF-1alpha-deficient colon cancer cells. Nature Med. 2005;11(9):992–7. doi: 10.1038/nm1294. [DOI] [PubMed] [Google Scholar]