Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Oct 7.
Published in final edited form as: Cell Microbiol. 2005 Jun;7(6):887–897. doi: 10.1111/j.1462-5822.2005.00522.x

Trichomonas vaginalis adherence mediates differential gene expression in human vaginal epithelial cells

Ashwini Kucknoor 1, Vasanthakrishna Mundodi 1, John F Alderete 1,*
PMCID: PMC2562669  NIHMSID: NIHMS27898  PMID: 15888089

Summary

Trichomonas vaginalis, an ancient protist, colonizes the vaginal mucosa causing trichomonosis, a vaginitis that sometimes leads to severe health complications. Preparatory to colonization of the vagina is the adhesion to vaginal epithelial cells (VECs) by trichomonads. We hypothesized that VECs alter the gene expression to form a complex signalling cascade in response to trichomonal adherence. In order to identify the genes that are upregulated, we constructed a subtraction cDNA library after contact with parasites that is enriched for differentially expressed genes from the immortalized MS-74 VECs. Sixty cDNA clones were sequenced and to our knowledge for the first time, differentially regulated genes were identified in response to early trichomonal infection. The identified genes were found to encode functional proteins with specific functions associated with cell structure maintenance and extracellular matrix components, proinflammatory molecules and apoptosis. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) confirmed expression of selected genes. Further, cyclooxygenase 2 (COX-2) protein expression was analysed using Western blot and immunofluorescence assays. Data suggest that p38 mitogen-activated protein (MAP) kinase and tyrosine kinases play a role in COX-2 induction. Finally, T. vaginalis and Tritrichomonas foetus but not Pentatrichomonas hominis induce expression of COX-2. This is a first attempt at elucidating the basis of interaction of trichomonads with host cells and the corresponding host responses triggered by the parasites.

Introduction

Trichomonas vaginalis is the causal agent of trichomonosis, the number one non-viral sexually transmitted disease (STD) worldwide (World Health Organization, 1995), and infection with this parasite may bring about serious consequences to women’s health and occasionally in men. Women with symptoms will experience a foul-smelling discharge, abdominal pain, irritation and severe discomfort. In women, complications are associated with adverse pregnancy outcomes (Cotch et al., 1997), preterm birth (Minkoff et al., 1984), greater risk of tubal infertility (El-Shazly et al., 2001), atypical pelvic inflammatory disease (Moodley et al., 2002), amplified HIV transmission (Sorvillo et al., 2001) and increased risk of cervical cancer (Viikki et al., 2000). Some infected men present a non-chlamydial, non-gonococcal urethritis (Krieger et al., 1993) concomitant with increased risk of facilitating HIV transmission (Hobbs et al., 1999). Interestingly, however, a large proportion of men are asymptomatic to trichomonal infections, and the infection is believed to be self-limiting (Krieger and Riley, 2002). For women, an annual incidence in the USA alone is estimated at 8 million new cases of trichomonosis (Weinstock et al., 2004). The complications from trichomonosis coupled with the enhanced risk factor for HIV transmission and predisposition to cervical cancer means there is a need to understand the mechanisms of pathogenesis and the host responses to infection by T. vaginalis.

Adhesion of T. vaginalis to vaginal epithelial cells (VECs) plays an important role in pathogenesis of trichomonosis (Arroyo et al., 1992). Four different parasite surface proteins mediate adherence, and the adhesins are upregulated during attachment to VECs (Arroyo et al., 1993; Garcia et al., 2003). While overall immune responses during trichomonosis are largely unknown, high levels of interleukin-8 (IL-8) and leukotreine B4 (LTB4) have been found in the vaginal discharges from patients with symptomatic trichomonosis (Shaio et al., 1994; 1995; Shaio and Lin, 1995). There are also reports of IL-8 being produced by human neutrophils (Ryu et al., 2004) and human monocytes (Shaio et al., 1995) in response to T. vaginalis stimulation using in vitro assay systems. Further, in vitro studies have revealed that IL-8 production is regulated through NF-κB and mitogen-activated protein (MAP) kinase signalling pathways (Ryang et al., 2004). However, in vivo studies addressing the pathogenesis of T. vaginalis and host responses have for the most part been limited (Cudmmore et al., 2004).

Pathogen-induced host transcriptional changes in epithelial cells have been described for Chlamydia trachomatis (Xia et al., 2003), Helicobacter pylori (Cox et al., 2001), Pseudomonas aeruginosa (Ichikawa et al., 2000), Neisseria meningitidis and Neisseria gonorrhoeae (Plant et al., 2004) using the micro array technology. Differentially expressed gene profiling using cDNA subtraction has been used as an alternative and complementary tool to microarray analyses, especially in identifying novel genes and transcripts of low abundance (Cao et al., 2004). With the objective to identify the transcriptional changes in gene expression during the initial step of T. vaginalis adhesion to VECs, we report here our use of the subtraction cDNA library approach. To our knowledge, our data show for the first time that numerous host genes are upregulated upon parasite adherence. We show regulation of select genes using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). Further, protein expression analyses and cellular mechanisms of cyclooxygenase 2 (COX-2) expression were studied in more detail. This work has implications for future research directions.

Results

Adhesion of T. vaginalis T016 to MS-74 VECs

We optimized an in vitro adherence assay between T. vaginalis T016 and immortalized MS-74 VECs, as before (Garcia et al., 2003). Within 5 min, T. vaginalis parasites adhered to MS-74 VECs, and the binding kinetics gave maximum numbers of parasites adhering after 15 min. Figure 1 shows the pictomicrograph of parasites adhered to VECs at 15 min of incubation, and at this time point, the monolayer was intact and parasites had begun to change shape, as reported (Arroyo et al., 1993). As significant cytotoxicity and disruption of the monolayer was evident by 45 min, all experiments were carried out using a 30 min time of incubation.

Fig. 1.

Fig. 1

Open in a new tab

Adhesion of T. vaginalis to immortalized MS-74 vaginal epithelial cells (VECs). MS-74 VEC monolayers in eight-chamber culture slide were incubated with T. vaginalis at a parasite to VECs ratio of 5:1. Following 15 min incubation, unbound parasites were washed with PBS. The chambers were removed, and the slide was air dried for observation by microscopy (10× magnification). Trichomonads readily bound to MS-74 VECs (A). Black arrowheads depict some of the bound trichomonads. A control monolayer of MS-74 VECs is shown in (B).

Polymerase chain reaction (PCR)-based subtractive cDNA library

We next used a subtractive cDNA library to study the MA-74 VEC gene regulation induced by T. vaginalis. We constructed a cDNA library by subtracting the cDNA of MS-74 bound by T. vaginalis parasites (referred to as primed MS-74) from non-primed control MS-74 cDNA. The subtraction methodology involved suppression of polymerase chain reaction (PCR) amplification of the common sequences (Wang and Brown, 1991). The amplified cDNA were ligated to the TA vector to create the library. About 250 clones were obtained in the first round of plating from the transformed cDNA library. The average size of cDNA inserts was ∼200 bp. The subtraction efficiency was estimated by comparing the abundance of a known gene before and after subtraction. We amplified the housekeeping gene (glyceraldehyde-3-phosphate dehydrogenase, GAPDH) from subtracted and unsubtracted cDNA. Figure 2 shows that the GAPDH PCR product is detectable only after ≥25 cycles in the subtracted sample, while it is readily detectable after ≤15 cycles in the unsubtracted sample, indicating successful subtraction efficiency.

Fig. 2.

Fig. 2

Open in a new tab

PCR analysis of subtraction efficiency. PCR was performed on unsubtracted and subtracted cDNAs with GAPDH primers. Aliquots (5 μl) were removed at a predetermined number of cycles and analysed by agarose/ethidium bromide gels. The GAPDH product appeared after 15 cycles in unsubtracted sample but only after 25 cycles in subtracted sample.

MS-74 VEC gene expression regulated by T. vaginalis adherence

Sixty rescued plasmid clones were successfully sequenced, of which 85% of the genes were identified and shown in Table 1. Some clones were present in more than one copy. The VEC genes exhibited homologies with the EST or genomic sequences encoding various functional classes of proteins. Further, ∼9% were genes of unknown function, and the remaining 6% comprised repeat sequences. About 27% of the upregulated genes fall under the category of cell-cell adhesion, cell structure maintenance and extracellular matrix rearrangement genes, of which fibronectin (FN), plasminogen activator inhibitor (PAI-1) and tetraspan-1 are predominant. Among cytokine-related genes, monocyte chemotactic protein (MCP-1) and IL-8 were upregulated, suggesting that T. vaginalis infection induces proinflammatory responses in the host cells, consistent with the previous reports (Shaio et al., 1995; Ryu et al., 2004). Interestingly, among the upregulated apoptosis-related genes, the prominent ones were the anti-apoptotic members of Bcl2 gene family (defender against apoptotic cell death, DAD1) and COX-2. Two mitochondrial proteins, cytochrome c oxidase subunit protein and ATP synthase, were found to be upregulated. Other major upregulated genes include a homologue of cytidine deaminase (APOBEC3C), inflammation and malignancy-related lipocalin, oestrogen receptor-1, and genes involved in protein synthesis.

Table 1.

List of genes upregulated in MS-74 VECs upon early stages of Trichomonas vaginalis cytoadherence.

Gene namea Accession No. Description or function
Cell structure maintenance genes
 CD151 BT020132 Sphingolipid activator protein
 Fibronectin 15 (FN1) NM002026 Involved in cell adhesion and morphology
 Keratin 14 NM000526 Involved in cytoskeletal rearrangement
 KIAA0913 AB020720 Cell-surface protein
 Plasminogen activator inhibitor (PAI-1)3 AK129790 Serine protease inhibitor
 Prosaposin NM002778 Involved in actin and tubulin folding
 Seven transmembrane helix receptor AB065648 Cell-surface receptor
 T-complex polypeptide-1 (TCP-1) AF026293 Complex forming cell-surface protein
 Tetraspan13 NM198902 Transmembrane 4 superfamily gene
 Thymosin beta 10 NM021103 Actin-sequestering protein
 XB31alpha1 AF438482 Non-classical cadherin
Cytokine genes
 Interleukin 8 (IL-8) NM000584 Chemotactic and activating cytokine
 Monocyte chemotractant protein (MCP-1) AF519531 Recruitment of monocytes
Apoptosis-related genes
 N-terminal enhancer of split (AES) NM007005 Induces cell death by forming complexes
 Cycloxygenase-2 (COX-2)5 AF044206 Inducible form of prostaglandin synthase
 Defender against cell death (DAD1)2 BC009798 Gene involved in programmed cell death
 Dickkopf-3 (Dkk-3) homologue NM015881 Involved in cell morphological changes
Mitochondrial genes
 ATP synthase3 AY714047 Mitochondrial ATP synthase
 Cytochrome c oxidase2 NM144613 Involved in electron transport chain
Others
 Apolipoprotein B mRNA editing catalytic polypeptide (APOBEC3C)2 NM021822 Homologue of cytidine deaminase
 Oestrogen receptor 1 NM000125 Ligand-activated transcription factor
 HLA-B-associated transcript (BAT3) NM080703 Proline-rich protein
 Kallikrein 10 NM145888 Serine protease inhibitor
 Lipocalin 23 NM005564 Inflammation and malignancy related
 N-deacetylase NM008306 Involved in deacetylation of heparin
 Proactivator polypeptide precursor NM006287 Precursor protein
 Ras homologue BT019872 Small GTP-binding proteins
 Ribosomal protein2 BC019014 Protein synthesis
 rRNA AY570524 Protein synthesis
 Tissue factor pathway inhibitor (TFPI-2) NM000602 Serine protease inhibitor
 tRNA AF465979 Protein synthesis
Open in a new tab
a

Number of copies of the clone picked up out of total 60 clones sequenced.

RT-PCR confirmation of regulation of specific genes

To support the authenticity of the data obtained from the subtraction library, levels of transcripts of specific genes were analysed by quantitative RT-PCR. We selected four genes: (i) the gene for IL-8, a proinflammatory cytokine that has chemotactic and stimulatory effects on T-cells and is known to be stimulated by T. vaginalis in monocytes (Shaio et al., 1995) and neutrophils (Ryu et al., 2004), (ii) the gene for MCP-1, a cytokine capable of inducing T-cell response (Futagami et al., 2003), (iii) the gene for COX-2, a highly upregulated proinflammatory molecule known to inhibit apoptosis, promote angiogenesis and tumour invasion (Murata et al., 1999) and (iv) the gene for FN, an extracellular matrix glycoprotein implicated in inflammation and angiogenesis (Oyama et al., 1991). Fibronectin is known to be a ligand for T. vaginalis associations with basement membranes (Crouch and Alderete, 1999). We normalized expression of each gene to GAPDH and compared the expression of primed MS-74 VECs with the non-primed VECs. In addition, we analysed the expression of genes induced by T. vaginalis-conditioned medium alone. This was done to determine whether any trichomonad molecules in the conditioned medium induced gene expression in VECs.

RT-PCR products separated on 1% agarose/ethidium bromide gels are shown in Fig. 3A. All four genes had ≥2-fold increased amounts of RT-PCR products in primed MS-74 VECs compared with the controls, confirming the upregulation of genes identified by the subtraction library. Interestingly, except for the MCP-1 gene, the other three genes were induced in the presence of trichomonad conditioned medium alone, suggesting that soluble parasite factors possibly secreted during growth are involved in the upregulation of specific genes. Trypticase-yeast extractmaltose (TYM) alone gave a basal level expression of IL-8, COX-2 and FN1. However, the relative level of expression induced by the conditioned medium is up to threefold higher for these same genes. These data suggest that contact and/or soluble factors of T. vaginalis induce host cell responses. Figure 3B presents the levels of increased expression relative to GAPDH as quantified by the scion image beta program, further affirming the net increased expression compared with the controls.

Fig. 3.

Fig. 3

Open in a new tab

Confirmation of gene expression patterns in MS-74 VECs by semi-quantitative RT-PCR analyses. For a time period of 30 min, MS-74 VECs were primed with T. vaginalis (Tv) and with TYM medium alone or conditioned TYM medium (CM) in which trichomonads were previously grown. These samples were compared with untreated VECs as controls. Total RNA from the primed MS-74 VECs was isolated as detailed in Experimental procedures and RT-PCR was performed using gene-specific primers as shown in Table 2.

A. The RT-PCR products separated on 2% agarose ethidium bromide gel.

B. The gene expression pattern relative to GAPDH as a housekeeping control. The values were obtained by scanning the bands from pictures of agarose/ethidium bromide gels using Scion Image beta program, and the per cent expression was relative to baseline GAPDH densities plotted on the graph.

Trichomonas vaginalis induced COX-2 protein expression in MS-74 VECs

Cyclooxygenase 2 (COX-2) is an immediate-early response gene induced by growth factors, tumour promoters and oncogenes (Kulkarni et al., 2001). We felt that isolation of five COX-2 clones from the 60 selected for analysis was noteworthy. Therefore, we wanted to verify the COX-2 protein expression in primed MS-74 VECs. Figure 4A shows the immunoblot detection of COX-2 protein by anti-COX-2 monoclonal antibody (mAb) in the primed MS-74 cells but not the control VECs. We then performed indirect immunofluorescence studies to detect COX-2 protein localization in the primed MS-74 VECs as seen in Fig. 4B. Fluorescence was readily visualized in the perinuclear region in primed VECs, and all VECs visualized by fluorescence expressed COX-2, consistent with observations made by others (Murakami et al., 2003). Hoechst staining shows the alignment of cells in different microscopic fields. These data indicate that the upregulation of COX-2 gene expression is related to increased amounts of protein.

Fig. 4.

Fig. 4

Open in a new tab

Detection of COX-2 protein expression in MS-74 VECs in response to T. vaginalis adherence.

A. Western blot detection of protein with specific monoclonal antibody (mAb). A confluent monolayer of MS-74 VECs was incubated with trichomonads for 30 min. Cell lysates were prepared from equivalent numbers of primed and non-primed MS-74 VECs, separated by SDS-PAGE and transferred to nitrocellulose membrane for probing with an anti-COX-2 mAb. The molecular weight standards are indicated on the left hand side. The arrow shows the 70 kDa COX-2 protein. A negative control without mAb gave no detection of protein as seen for non-primed VECs.

B. Immunofluorescence detection of COX-2. MS-74 VECs were incubated with T. vaginalis parasites. After incubation of VECs with T. vaginalis parasites, cells were washed well and incubated with anti-COX-2 mAb followed by FITC-conjugated anti-mouse secondary antibody. The immunostained cells were observed by microscopy (100× magnification). The top panel represents the control non-primed VECs. No fluorescence was detected in the presence of COX-2 antibody. The bottom panel shows the perinuclear expression of COX-2 in VECs incubated with T. vaginalis parasites. Hoechst staining shows the alignment of cells.

Kinases are involved in the regulation of COX-2 gene expression

To study the intracellular mechanisms involved in the induction of COX-2 following T. vaginalis adherence to MS-74 VECs, we performed experiments inhibiting known protein kinases mediating COX-2 gene transcription (Mahboubi et al., 1998; Korhonen et al., 2004). Before isolation of RNA, VECs first treated with inhibitors were then interacted with parasites. The RT-PCR products of COX-2 were separated on a gel, and the band intensity was quantified using scion image beta program. The relative values are plotted on a graph, as seen in Fig. 5. For calculation purposes, COX-2 expression induced by T. vaginalis in the absence of inhibitors was normalized to 100%. The results indicate that SB203580, a p38 MAP kinase inhibitor and Genistein, a tyrosine kinase inhibitor, decreased levels of COX-2 expression by 41% and 31% respectively. In contrast, the p42/44 MAP kinase inhibitor (PD98059) and protein kinase C (PKC) inhibitor (Ro-31-8220) had little or no effect on COX-2 gene expression. These results suggest that p38 MAP kinase and protein tyrosine kinases play an important role in the expression of COX-2 in T. vaginalis-stimulated MS-74 VECs. In addition, above results also indicate that PKC is not involved in COX-2 expression in MS-74 VECs.

Fig. 5.

Fig. 5

Open in a new tab

Regulation of COX-2 expression in MS-74 VECs in the presence of pharmacological compounds. VECs were cultured as described in Experimental procedures and were exposed to different pharmacological compounds or without additions as a negative control, as indicated. VECs were then incubated with T. vaginalis for 30 min after which VECs were harvested for total RNA isolation. COX-2 expression was determined by RT-PCR. The PCR products were separated on 1% agarose/ethidium bromide gel. The bands were quantified using scion image beta program. The values were plotted on the graph. Expression in the absence of any compound was considered as 100% for comparison purposes. Identical results were obtained from three independent experiments performed identically.

COX-2 gene expression in response to different trichomonad species

To determine whether COX-2 gene expression was specific to T. vaginalis, we tested the related bovine trichomonad Tritrichomonas foetus and the non-pathogenic trichomonad Pentatrichomonas hominis. As shown in Fig. 6A, Tri. foetus also induced COX-2 expression in MS-74 VECs, although to a lesser extent than T. vaginalis. To our surprise, the non-pathogenic P. hominis showed poor, if any, induction of COX-2 gene expression (20%), when compared with that of T. vaginalis and Tri. foetus (65%) (Fig. 6B).

Fig. 6.

Fig. 6

Open in a new tab

Expression of COX-2 in MS-74 VECs in response to different trichomonad species. VECs were incubated with Trichomonas vaginalis (Tv), Pentatrichomonas hominis (Ph) or Tritrichomonas foetus (Tf) for 30 min. After washing for removal of the unbound trichomonads, VECs were used for RNA isolation. RT-PCR was performed on total RNA using COX-2 and GAPDH primers. The PCR products separated on 1% agarose gel and stained by ethidium bromide (A). The per cent expression of COX-2 relative to GAPDH is represented in (B) in a bar graph.

Discussion

In this study we used the suppression subtractive hybridization technique to evaluate any responses of the VECs to T. vaginalis adherence. We have identified several genes that are upregulated upon initial parasite adherence to host cells, which may have implications for understanding the early network of host responses operating in T. vaginalis infections. A high efficiency of subtraction was evidenced by the GAPDH housekeeping gene amplification (Fig. 2). We appreciate and were not surprised that a small fraction of GAPDH message was still retained, as can be the case for this subtraction procedure (Buchaille et al., 2000). From 60 cDNA clones we identified a set of genes with increased levels of transcription in response to contact with T. vaginalis (Table 1).

Interestingly, ∼27% of the genes were associated with cell structure maintenance and extracellular matrix (ECM) rearrangement, of which the major ones were FN and PAI-1. These data suggest that trichomonads may regulate cell interactions with ECM by co-ordinated induction of FN and PAI-1 (Liu et al., 2000) and result in a robust signal transduction process. Furthermore, T. vaginalis attaches to the basement membrane components FN and laminin in a receptor-mediated fashion (Crouch and Alderete, 1999). T. vaginalis also contains two fibronectin-like binding proteins, flp1 and flp2, that are regulated by iron (Crouch and Alderete, 2001). It is conceivable that trichomonads use FN-mediated binding after expression of FN by VECs as an alternative way of colonizing the vaginal epithelium. This mechanism would be in addition to the four well-characterized trichomonad adhesins (Arroyo et al., 1992; Garcia et al., 2003; Mundodi et al., 2004). In this study, we have shown that two major proinflammatory cytokines IL-8 and MCP-1 are upregulated upon parasite adherence to VECs. Consistent with our finding, we know that trichomonosis is characterized by severe inflammation and tissue cytotoxicity (Krieger, 1981) and that IL-8 is present in vaginal discharges from patients (Shaio et al., 1994; 1995). Also, recent reports show that human neutrophils and monocytes stimulated by T. vaginalis are induced to produce IL-8 (Shaio et al., 1995; Ryu et al., 2004). Similarly, IL-8 is also induced during the early stages of infection by Candida albicans (Nomanbhoy et al., 2002) and N. gonorrhoeae (Fichorova et al., 2001). MCP-1 is considered critical for migration of cells to sites of infection, and the expression levels are elevated in the vagina of mice during C. albicans infection (Fidel et al., 1999) and in human VECs infected with C. albicans (Nomanbhoy et al., 2002). MCP-1 is also upregulated in epithelial cells stimulated with other pathogens, such as H. pylori (Futagami et al., 2003) and Yersinia enterocolitica (Kampik et al., 2000).

Host cells often respond to pathogens by undergoing apoptosis as a self-defence mechanism to remove infected cells. The major upregulated apoptosis-related genes in our VEC subtraction library were DAD1, a member of Bcl2 gene family (Cory et al., 2003) and COX-2. These genes are anti-apoptotic in nature, suggesting that the trichomonads might resist the host cell apoptosis because of its self-limiting nature of infection. COX-2 is known to be induced in several cell types by bacterial lipopolysaccharide (LPS) (Yang et al., 1999; Dieter et al., 2002) and in presence of secreted proteins from N. meningitidis (Robinson et al., 2004). It is possible that T. vaginalis organisms possess some soluble factor to induce COX-2 gene expression (Fig. 3A). Alternatively, COX-2 may be induced by the upregulation of cytokines and other growth factors that are increased upon T. vaginalis adherence.

Other genes from the subtraction library include the mitochondrial-associated genes ATP synthase and cytochrome c oxidase subunit protein, indicating that mitochondrial dysfunction may be induced by T. vaginalis cytoadherence. This is also seen in Streptococcus pyogenes-infected epithelial cells (Nakagawa et al., 2004). Other major upregulated genes include apolipoprotein B mRNA editing polypeptide (APOBEC3C), lipocalin 2 and oestrogen receptor 1(ESR). Importantly, APOBEC3C is known to exhibit potent DNA mutator activity in an Escherichia coli assay (Harris et al., 2002). ESR is a transcription factor that is activated in the presence of oestrogen, which is known to play a role in the progression of breast cancer in humans (Wang et al., 1997).

We confirmed the expression of selected genes using semi-quantitative RT-PCR and tested whether upregulation at the transcriptional level reflected increased protein expression. IL-8, MCP-1, COX-2 and FN were selected for RT-PCR analysis, and highly upregulated expression of the four genes was seen (Fig. 3). Interestingly, the soluble factors secreted into the conditioned medium also induced upregulation of IL-8, COX-2 and FN. That MCP-1 was not induced under this condition suggests specificity in that trichomonad contact with VECs is prerequisite for the induction. The relative COX-2 gene expression value was the highest when compared with the rest of the genes, which reaffirmed the relative abundance of COX-2 clones in the subtraction library. That COX-2 protein was indeed induced by MS-74 VECs upon T. vaginalis adherence (Fig. 4) was further confirmed by the possible role of p38 MAP kinase inhibitor and to a lesser extent by tyrosine kinase inhibitor (Fig. 5). It has been shown that p38 MAP kinase inhibition leads to decreased COX-2 expression in Lactobacillus rhamnosus-stimulated epithelial cells (Korhonen et al., 2004) and in LPS-treated human monocytes (Dean et al., 1999). Interestingly in a recent study, p38 MAP kinase was implicated in T. vaginalis-induced activation of human macrophages (Ryang et al., 2004).

The response to the bovine trichomonad Tri. foetus in the reproductive tract is similar to the response to T. vaginalis (Corbeil et al., 1998). We found significant but unequal upregulation of COX-2 expression in VECs stimulated by T. vaginalis and Tri. foetus (Fig. 6). We believe the lower extent of COX-2 increase by Tri. foetus may be attributable to the lower levels of adherence to human VECs (Singh et al., 2004). In contrast, the non-pathogenic P. hominis showed very low upregulation of COX-2, suggesting that COX-2 induction is important for the pathogenesis of T. vaginalis. The result using P. hominis may reflect the specific tropism for the intestinal tract and the absence of adherence to VECs by this parasite.

Several studies have linked T. vaginalis pathogenesis with cervical cancer (Yap et al., 1995; Zhang et al., 1995; Sayed el-Ahl et al., 2002). COX-2 is an inducible form of the enzyme involved in the production of prostanoids and is often upregulated in many inflammatory diseases. Enhanced synthesis of prostaglandins induced by COX-2 stimulates cancer cell proliferation (Tsuji et al., 2001), inhibits apoptosis and promotes angiogenesis (Tsujii et al., 1998; Gupta et al., 2003) in various cell types. COX-2 is consistently overexpressed in all primary and meta-static epithelial cancers, including prostate (Gupta et al., 2000) and cervical cancers (Kulkarni et al., 2001). COX-2 is upregulated during the pathogenesis of H. pylori infections (Akhtar et al., 2001), which is in turn linked to gastric cancer. It is also noteworthy that tobacco smoking results in increased upregulation of FN, which in turn is responsible for lung cell carcinoma progression. Moreover, upregulation of FN is associated with increased amounts of COX-2 mRNA and protein (Han et al., 2004). A similar scenario might be envisioned during trichomonosis.

Experimental procedures

Parasites and host cells

Trichomonas vaginalis isolate T016 was grown in TYM medium supplemented with 10% heat-inactivated donor horse serum at 37°C (Diamond, 1957). Immortalized MS-74 human VECs (Klumpp et al., 2002) were used for adherence experiments and were grown in Dulbecco’s modified Eagle medium (D-MEM) (Invitrogen) supplemented with 10% fetal bovine serum, at 37°C, in the presence of 5% CO2.

Adherence assay and isolation of total RNA

The MS-74 VECs were used for adherence as recently detailed (Garcia et al., 2003). Briefly, 6 × 105 VECs were seeded onto T75 culture flasks and allowed to form a monolayer for 2 days. VECs were then washed with a medium mixture of D-MEM:TYM (2:1, v/v) without serum. Parasites at mid-logarithmic phase of growth were added to the MS-74 monolayer at a parasite:VEC ratio of 10:1 and incubated at 37°C to allow for parasite adherence. Unbound and loosely adhered parasites were washed, and the monolayer was incubated on ice for an additional 1 h. The monolayer was washed thoroughly with ice-cold PBS to remove all bound parasites until no parasites were detected by microscopy (Alderete and Garza, 1985). The monolayer of primed VECs were collected, washed with PBS and used for RNA isolation. Total RNA from control non-primed VECs and primed VECs after contact with T. vaginalis was isolated using Trizol reagent (Invitrogen).

For isolation of RNA from MS-74 VECs treated with different kinase inhibitors (Sigma Aldrich), the monolayer was grown to confluency in individual wells of 24-well culture plates. Before incubation with T. vaginalis, the monolayer was incubated for 4 h with SB203580 (1 μmol l-1, an inhibitor of p38 MAP kinase), genistein (100 μmol l-1, an inhibitor of protein tyrosine kinase), PD98095 (10 μmol l-1, an inhibitor of p42/44 MAP kinase) and Ro 31-8220 (1 μmol l-1, an inhibitor of protein kinase C). Trichomonads were then added, and after 30 min of incubation VECs were used for RNA isolation.

Synthesis of cDNA and construction of subtractive cDNA library

cDNA from primed MS-74 VECs (tester cDNA) and non-primed VECs (driver cDNA) were prepared using a cDNA synthesis system (Roche Diagnostics). Briefly, 1 μg of total RNA was reverse transcribed using an oligo (dT)15 primer and AMV reverse transcriptase according to manufacturer’s protocol. The subtractive cDNA library was constructed according to the standard protocol (Wang and Brown, 1991). Briefly, each set of cDNA was digested with Alul and Rsal, to generate shorter, blunt-ended cDNA fragments. The tester DNA and driver DNA were ligated with different sets of adaptors. Ligated cDNA was amplified by PCR using the adaptor primers to obtain large amounts of cDNA. The tester cDNA was labelled with [32P]-dCTP and the driver cDNA was biotinylated using 0.5 mM bio-11-dUTP (Biotium). A first hybridization between an excess of driver and tester was carried out to enrich the differentially expressed sequences. Tracer/driver and driver/driver hybrids and biotinylated single-stranded driver cDNA were removed by addition of streptavidin and extraction with phenol/chloroform. The per cent of tracer cDNA removed was determined by the radioactive counts remaining after phenol/chloroform extraction. Further rounds of subtraction were performed using the cDNAs from the previous round as template for PCR synthesis of tracer and driver cDNAs. After 10 rounds of alternating long and short hybridizations, the subtracted cDNA fraction was cloned into a TA vector and transformed into E. coli to create a primed MS-74 cDNA library.

Polymerase chain reaction analysis of the subtraction efficiency

Polymerase chain reaction was performed on subtracted and unsubtracted cDNA with the housekeeping gene GAPDH primers (Table 2). Each reaction was amplified for 30 cycles and 5 μl aliquots were removed after 15, 20 and 25 cycles. The PCR products were electrophoresed on a 1% agarose/ethidium bromide gel. The efficiency of subtraction was reflected by the difference in the number of cycles required for equal amplification of the PCR product in subtracted and unsubtracted samples.

Table 2.

List of primers used for RT-PCR analyses.

Gene name Primer sequence (5′-3′) Annealing temperature (°C) Amplicon size (bp)
GAPDH Sense CCATGGAGAAGGCTGGGG 60 200
Antisense CAAAGTTGTCATGGATGACC
IL-8 Sense ATGACTTCCAAGCTGGCCGTGGCT 56 265
Antisense TCTCAGCCCTCTTCAAAAACTTCTC
MCP-1 Sense TCCTGTGCCTGCTGCTCATAG 57 565
Antisense TTCTGAACCCACTTCTGCTTGG
COX-2 Sense CAGCACTTCACGCATCAGTT 60 756
Antisense TCTGGTCAATGGAAGCCTGT
FN1 Sense TGGATCCATGAACTTTCTGCTGTC 48 250
Antisense TCACCGCCTTGGCTTGTCACAT
Open in a new tab

Sequencing and analysis

Colonies were randomly selected and plasmids were prepared using a miniprep kit (Qiagen). cDNA inserts were verified by restriction digestion, and the clones were sequenced in our institutional DNA sequencing facility. Sequence data were compared with data in GenBank using a BLAST program.

RT-PCR analysis of selected genes

Total RNA from non-primed VECs, primed VECs, and VECs incubated with TYM alone or T. vaginalis-conditioned medium was isolated using Trizol reagent. Total RNA (1 μg) was reverse transcribed with oligo (dT) primer using Superscript II reverse transcriptase (Invitrogen), according to the manufacturer’s protocol. PCR amplification of cDNA was carried out using genespecific primers (Table 2). GAPDH was used as an internal control. PCR products were separated on 2% agarose/ethidium bromide gels, and the band intensity was quantified using the Scion image beta program.

SDS-PAGE and Western blotting

Equal amounts of lysate from primed and non-primed VECs were separated on 10% SDS-PAGE, and the proteins were transferred onto nitrocellulose membranes (Bio-Rad). The nitrocellulose blots were blocked in 0.1% Tween 20 and 5% BSA and subsequently probed with anti-COX-2 mAb (Cayman chemicals). The blot was further incubated with anti-mouse secondary antibody conjugated with horseradish peroxidase (Bio-Rad). The blot was washed well and incubated in horseradish peroxidase substrate (Bio-Rad) to visualize the reactive band.

Immunofluorescent staining

MS-74 VECs were seeded on Falcon 8 chamber culture slides (Becton Dickinson) and allowed for monolayer formation. Trichomonads were added to the monolayer at a parasite to cell ratio of 10:1 and incubated for 30 min at 37°C. The monolayer was then washed to remove free and unbound trichomonads. The monolayer on the slide was incubated in blocking buffer of PBS containing 5% BSA followed by the addition of 1:1000 dilution of COX-2 mAb for 1 h. Fluoresceine isothiocyante-conjugated anti-mouse antibody was then added for 30 min at 4°C. The monolayer was washed with PBS and incubated with Hoechst stain (0.1 mg ml-1) for 10 min and again washed with PBS. Finally, the chambers on the slide were removed, and slides were processed for observation using an Olympus BX41 microscope.

Acknowledgements

This work was supported by Public Health Service Grants AI43940 and AI45429 from the National Institutes of Health. Members of the laboratory are also acknowledged for their suggestions and discussion of our work.

References

  1. Akhtar M, Cheng Y, Magno RM, Ashktorab H, Smoot DT, Meltzer SJ, Wilson KT. Promoter methylation regulates Helicobacter pylori-stimulated cyclooxygenase-2 expression in gastric epithelial cells. Cancer Res. 2001;61:2399–2403. [PubMed] [Google Scholar]
  2. Alderete JF, Garza GE. Specific nature of Trichomonas vaginalis parasitism of host cell surfaces. Infect Immun. 1985;50:701–708. doi: 10.1128/iai.50.3.701-708.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arroyo R, Engbring J, Alderete JF. Molecular basis of host epithelial cell recognition by Trichomonas vaginalis. Mol Microbiol. 1992;6:853–862. doi: 10.1111/j.1365-2958.1992.tb01536.x. [DOI] [PubMed] [Google Scholar]
  4. Arroyo R, Gonzalez-Robles A, Martinez-Palomo A, Alderete JF. Signalling of Trichomonas vaginalis for amoeboid transformation and adhesion synthesis follows cytoadherence. Mol Microbiol. 1993;7:299–309. doi: 10.1111/j.1365-2958.1993.tb01121.x. [DOI] [PubMed] [Google Scholar]
  5. Buchaille R, Couble ML, Magloire H, Bleicher F. A substractive PCR-based cDNA library from human odontoblast cells: identification of novel genes expressed in tooth forming cells. Matrix Biol. 2000;19:421–430. doi: 10.1016/s0945-053x(00)00091-3. [DOI] [PubMed] [Google Scholar]
  6. Cao W, Epstein C, Liu H, DeLoughery C, Ge N, Lin J, et al. Comparing gene discovery from Affymetrix GeneChip microarrays and Clontech PCR-select cDNA subtraction: a case study. BMC Genomics. 2004;5:26. doi: 10.1186/1471-2164-5-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Corbeil LB, Anderson ML, Corbeil RR, Eddow JM, BonDurant RH. Female reproductive tract immunity in bovine trichomoniasis. Am J Reprod Immunol. 1998;39:189–198. doi: 10.1111/j.1600-0897.1998.tb00353.x. [DOI] [PubMed] [Google Scholar]
  8. Cory S, Huang DC, Adams JM. The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene. 2003;22:8590–8607. doi: 10.1038/sj.onc.1207102. [DOI] [PubMed] [Google Scholar]
  9. Cotch MF, Pastorek JG, II, Nugent RP, Hillier SL, Gibbs RS, Martin DH, et al. Trichomonas vaginalis associated with low birth weight and preterm delivery. The Vaginal Infections and Prematurity Study Group. Sex Transm Dis. 1997;24:353–360. doi: 10.1097/00007435-199707000-00008. [DOI] [PubMed] [Google Scholar]
  10. Cox JM, Clayton CL, Tomita T, Wallace DM, Robinson PA, Crabtree JE. cDNA array analysis of cag pathogenicity island-associated Helicobacter pylori epithelial cell response genes. Infect Immun. 2001;69:6970–6980. doi: 10.1128/IAI.69.11.6970-6980.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Crouch ML, Alderete JF. Trichomonas vaginalis interactions with fibronectin and laminin. Microbiology. 1999;145(Pt 10):2835–2843. doi: 10.1099/00221287-145-10-2835. [DOI] [PubMed] [Google Scholar]
  12. Crouch MV, Alderete JF. Trichomonas vaginalis has two fibronectin-like iron-regulated genes. Arch Med Res. 2001;32:102–107. doi: 10.1016/s0188-4409(01)00262-4. [DOI] [PubMed] [Google Scholar]
  13. Cudmmore SL, Delgaty KL, Hayward-McClelland SF, Petrin DP, Garber GE. Treatment of infections caused by metronidazole-resistant Trichomonas vaginalis. Clin Microbiol Rev. 2004;17:783–793. doi: 10.1128/CMR.17.4.783-793.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dean JL, Brook M, Clark AR, Saklatvala J. p38 mitogen-activated protein kinase regulates cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J Biol Chem. 1999;274:264–269. doi: 10.1074/jbc.274.1.264. [DOI] [PubMed] [Google Scholar]
  15. Diamond LS. The establishment of various trichomonads of animals and man in axenic cultures. J Parasitol. 1957;43:488–490. [PubMed] [Google Scholar]
  16. Dieter P, Scheibe R, Kamionka S, Kolada A. LPS-induced synthesis and release of PGE2 in liver macrophages: regulation by CPLA2, COX-1, COX-2, and PGE2 synthase. Adv Exp Med Biol. 2002;507:457–462. doi: 10.1007/978-1-4615-0193-0_71. [DOI] [PubMed] [Google Scholar]
  17. El-Shazly AM, El-Naggar HM, Soliman M, El-Negeri M, El-Nemr HE, Handousa AE, Morsy TA. A study on Trichomoniasis vaginalis and female infertility. J Egypt Soc Parasitol. 2001;31:545–553. [PubMed] [Google Scholar]
  18. Fichorova RN, Desai PJ, Gibson FC, III, Genco CA. Distinct proinflammatory host responses to Neisseria gonorrhoeae infection in immortalized human cervical and vaginal epithelial cells. Infect Immun. 2001;69:5840–5848. doi: 10.1128/IAI.69.9.5840-5848.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Fidel PL, Jr, Vazquez JA, Sobel JD. Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans. Clin Microbiol Rev. 1999;12:80–96. doi: 10.1128/cmr.12.1.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Futagami S, Hiratsuka T, Tatsuguchi A, Suzuki K, Kusunoki M, Shinji Y, et al. Monocyte chemoattractant protein 1 (MCP-1) released from Helicobacter pylori stimulated gastric epithelial cells induces cyclooxygenase 2 expression and activation in T cells. Gut. 2003;52:1257–1264. doi: 10.1136/gut.52.9.1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Garcia AF, Chang TH, Benchimol M, Klumpp DJ, Lehker MW, Alderete JF. Iron and contact with host cells induce expression of adhesins on surface of Trichomonas vaginalis. Mol Microbiol. 2003;47:1207–1224. doi: 10.1046/j.1365-2958.2003.03366.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gupta S, Srivastava M, Ahmad N, Bostwick DG, Mukhtar H. Over-expression of cyclooxygenase-2 in human prostate adenocarcinoma. Prostate. 2000;42:73–78. doi: 10.1002/(sici)1097-0045(20000101)42:1<73::aid-pros9>3.0.co;2-g. [DOI] [PubMed] [Google Scholar]
  23. Gupta RA, Tejada LV, Tong BJ, Das SK, Morrow JD, Dey SK, DuBois RN. Cyclooxygenase-1 is overexpressed and promotes angiogenic growth factor production in ovarian cancer. Cancer Res. 2003;63:906–911. [PubMed] [Google Scholar]
  24. Han S, Sidell N, Roser-Page S, Roman J. Fibronectin stimulates human lung carcinoma cell growth by inducing cyclooxygenase-2 (COX-2) expression. Int J Cancer. 2004;111:322–331. doi: 10.1002/ijc.20281. [DOI] [PubMed] [Google Scholar]
  25. Harris RS, Petersen-Mahrt SK, Neuberger MS. RNA editing enzyme APOBEC1 and some of its homologs can act as DNA mutators. Mol Cell. 2002;10:1247–1253. doi: 10.1016/s1097-2765(02)00742-6. [DOI] [PubMed] [Google Scholar]
  26. Hobbs MM, Kazembe P, Reed AW, Miller WC, Nkata E, Zimba D, et al. Trichomonas vaginalis as a cause of urethritis in Malawian men. Sex Transm Dis. 1999;26:381–387. doi: 10.1097/00007435-199908000-00003. [DOI] [PubMed] [Google Scholar]
  27. Ichikawa JK, Norris A, Bangera MG, Geiss GK, van’T Wout AB, Bumgarner RE, Lory S. Interaction of Pseudomonas aeruginosa with epithelial cells: identification of differentially regulated genes by expression microarray analysis of human cDNAs. Proc Natl Acad Sci USA. 2000;97:9659–9664. doi: 10.1073/pnas.160140297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kampik D, Schulte R, Autenrieth IB. Yersinia enterocolitica invasin protein triggers differential production of interleukin-1, interleukin-8, monocyte chemoattractant protein 1, granulocyte-macrophage colony-stimulating factor, and tumor necrosis factor alpha in epithelial cells: implications for understanding the early cytokine network in Yersinia infections. Infect Immun. 2000;68:2484–2492. doi: 10.1128/iai.68.5.2484-2492.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Klumpp DJ, Forrestal SG, Karr JE, Mudge CS, Anderson BE, Schaeffer AJ. Epithelial differentiation promotes the adherence of type 1-piliated Escherichia coli to human vaginal cells. J Infect Dis. 2002;186:1631–1638. doi: 10.1086/345557. [DOI] [PubMed] [Google Scholar]
  30. Korhonen R, Kosonen O, Korpela R, Moilanen E. The expression of COX2 protein induced by Lactobacillus rhamnosus GG, endotoxin and lipoteichoic acid in T84 epithelial cells. Lett Appl Microbiol. 2004;39:19–24. doi: 10.1111/j.1472-765X.2004.01531.x. [DOI] [PubMed] [Google Scholar]
  31. Krieger JN. Urologic aspects of trichomoniasis. Invest Urol. 1981;18:411–417. [PubMed] [Google Scholar]
  32. Krieger JN, Riley DE. Prostatitis: what is the role of infection. Int J Antimicrob Agents. 2002;19:475–479. doi: 10.1016/s0924-8579(02)00086-9. [DOI] [PubMed] [Google Scholar]
  33. Krieger JN, Jenny C, Verdon M, Siegel N, Springwater R, Critchlow CW, Holmes KK. Clinical manifestations of trichomoniasis in men. Ann Intern Med. 1993;118:844–849. doi: 10.7326/0003-4819-118-11-199306010-00003. [DOI] [PubMed] [Google Scholar]
  34. Kulkarni S, Rader JS, Zhang F, Liapis H, Koki AT, Masferrer JL, et al. Cyclooxygenase-2 is overexpressed in human cervical cancer. Clin Cancer Res. 2001;7:429–434. [PubMed] [Google Scholar]
  35. Liu C, Yao J, Mercola D, Adamson E. The transcription factor EGR-1 directly transactivates the fibronectin gene and enhances attachment of human glioblastoma cell line U251. J Biol Chem. 2000;275:20315–20323. doi: 10.1074/jbc.M909046199. [DOI] [PubMed] [Google Scholar]
  36. Mahboubi K, Young W, Ferreri NR. Tyrosine phosphatase-dependent/tyrosine kinase-independent induction of nuclear factor-kappa B by tumor necrosis factor-alpha: effects on prostaglandin endoperoxide synthase-2 mRNA accumulation. J Pharmacol Exp Ther. 1998;285:862–868. [PubMed] [Google Scholar]
  37. Minkoff H, Grunebaum AN, Schwarz RH, Feldman J, Cummings M, Crombleholme W, et al. Risk factors for prematurity and premature rupture of membranes: a prospective study of the vaginal flora in pregnancy. Am J Obstet Gynecol. 1984;150:965–972. doi: 10.1016/0002-9378(84)90392-2. [DOI] [PubMed] [Google Scholar]
  38. Moodley P, Wilkinson D, Connolly C, Moodley J, Sturm AW. Trichomonas vaginalis is associated with pelvic inflammatory disease in women infected with human immunodeficiency virus. Clin Infect Dis. 2002;34:519–522. doi: 10.1086/338399. [DOI] [PubMed] [Google Scholar]
  39. Mundodi V, Kucknoor AS, Klumpp DJ, Chang TH, Alderete JF. Silencing the ap65 gene reduces adherence to vaginal epithelial cells by Trichomonas vaginalis. Mol Microbiol. 2004;53:1099–1108. doi: 10.1111/j.1365-2958.2004.04192.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Murakami M, Das S, Kim YJ, Cho W, Kudo I. Perinuclear localization of cytosolic phospholipase A(2)alpha is important but not obligatory for coupling with cyclooxygenases. FEBS Lett. 2003;546:251–256. doi: 10.1016/s0014-5793(03)00596-9. [DOI] [PubMed] [Google Scholar]
  41. Murata H, Kawano S, Tsuji S, Tsuji M, Sawaoka H, Kimura Y, et al. Cyclooxygenase-2 overexpression enhances lymphatic invasion and metastasis in human gastric carcinoma. Am J Gastroenterol. 1999;94:451–455. doi: 10.1111/j.1572-0241.1999.876_e.x. [DOI] [PubMed] [Google Scholar]
  42. Nakagawa I, Nakata M, Kawabata S, Hamada S. Transcriptome analysis and gene expression profiles of early apoptosis-related genes in Streptococcus pyogenes-infected epithelial cells. Cell Microbiol. 2004;6:939–952. doi: 10.1111/j.1462-5822.2004.00412.x. [DOI] [PubMed] [Google Scholar]
  43. Nomanbhoy F, Steele C, Yano J, Fidel PL., Jr Vaginal and oral epithelial cell anti-Candida activity. Infect Immun. 2002;70:7081–7088. doi: 10.1128/IAI.70.12.7081-7088.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Oyama F, Hirohashi S, Shimosato Y, Titani K, Sekiguchi K. Qualitative and quantitative changes of human tenascin expression in transformed lung fibroblast and lung tumor tissues: comparison with fibronectin. Cancer Res. 1991;51:4876–4881. [PubMed] [Google Scholar]
  45. Plant L, Asp V, Lovkvist L, Sundqvist J, Jonsson AB. Epithelial cell responses induced upon adherence of pathogenic Neisseria. Cell Microbiol. 2004;6:663–670. doi: 10.1111/j.1462-5822.2004.00393.x. [DOI] [PubMed] [Google Scholar]
  46. Robinson K, Taraktsoglou M, Rowe KS, Wooldridge KG, Ala’Aldeen DA. Secreted proteins from Neisseria meningitidis mediate differential human gene expression and immune activation. Cell Microbiol. 2004;6:927–938. doi: 10.1111/j.1462-5822.2004.00410.x. [DOI] [PubMed] [Google Scholar]
  47. Ryang YS, Chang JH, Park JY. Involvement of MAP kinases in apoptosis of macrophage treated with Trichomonas vaginalis. Yonsei Med J. 2004;45:751–754. doi: 10.3349/ymj.2004.45.4.751. [DOI] [PubMed] [Google Scholar]
  48. Ryu JS, Kang JH, Jung SY, Shin MH, Kim JM, Park H, Min DY. Production of interleukin-8 by human neutrophils stimulated with Trichomonas vaginalis. Infect Immun. 2004;72:1326–1332. doi: 10.1128/IAI.72.3.1326-1332.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sayed el-Ahl SA, el-Wakil HS, Kamel NM, Mahmoud MS. A preliminary study on the relationship between Trichomonas vaginalis and cervical cancer in Egyptian women. J Egypt Soc Parasitol. 2002;32:167–178. [PubMed] [Google Scholar]
  50. Shaio MF, Lin PR. Leucotriene B4 levels in the vaginal discharges from cases of trichomoniasis. Ann Trop Med Parasitol. 1995;89:85–88. doi: 10.1080/00034983.1995.11812934. [DOI] [PubMed] [Google Scholar]
  51. Shaio MF, Lin PR, Liu JY, Tang KD. Monocyte-derived interleukin-8 involved in the recruitment of neutrophils induced by Trichomonas vaginalis infection. J Infect Dis. 1994;170:1638–1640. doi: 10.1093/infdis/170.6.1638. [DOI] [PubMed] [Google Scholar]
  52. Shaio MF, Lin PR, Liu JY, Yang KD. Generation of interleukin-8 from human monocytes in response to Trichomonas vaginalis stimulation. Infect Immun. 1995;63:3864–3870. doi: 10.1128/iai.63.10.3864-3870.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Singh BN, Lucas JJ, Hayes GR, Kumar I, Beach DH, Frajblat M, et al. Tritrichomonas foetus induces apoptotic cell death in bovine vaginal epithelial cells. Infect Immun. 2004;72:4151–4158. doi: 10.1128/IAI.72.7.4151-4158.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sorvillo F, Smith L, Kerndt P, Ash L. Trichomonas vaginalis, HIV, and African-Americans. Emerg Infect Dis. 2001;7:927–932. doi: 10.3201/eid0706.010603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Tsujii M, Kawano S, Tsuji S, Sawaoka H, Hori M, DuBois RN. Cyclooxygenase regulates angiogenesis induced by colon cancer cells. Cell. 1998;93:705–716. doi: 10.1016/s0092-8674(00)81433-6. [DOI] [PubMed] [Google Scholar]
  56. Tsuji S, Tsujii M, Kawano S, Hori M. Cyclooxygenase-2 upregulation as a perigenetic change in carcinogenesis. J Exp Clin Cancer Res. 2001;20:117–129. [PubMed] [Google Scholar]
  57. Viikki M, Pukkala E, Nieminen P, Hakama M. Gynaecological infections as risk determinants of subsequent cervical neoplasia. Acta Oncol. 2000;39:71–75. doi: 10.1080/028418600431003. [DOI] [PubMed] [Google Scholar]
  58. Wang Z, Brown DD. A gene expression screen. Proc Natl Acad Sci USA. 1991;88:11505–11509. doi: 10.1073/pnas.88.24.11505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wang M, Dotzlaw H, Fuqua SA, Murphy LC. A point mutation in the human estrogen receptor gene is associated with the expression of an abnormal estrogen receptor mRNA containing a 69 novel nucleotide insertion. Breast Cancer Res Treat. 1997;44:145–151. doi: 10.1023/a:1005753117205. [DOI] [PubMed] [Google Scholar]
  60. Weinstock H, Berman S, Cates W., Jr Sexually transmitted diseases among American youth: incidence and prevalence estimates, 2000. Perspect Sex Reprod Health. 2004;36:6–10. doi: 10.1363/psrh.36.6.04. [DOI] [PubMed] [Google Scholar]
  61. World Health Organization . Global Programme on AIDS Report. WHO; Geneva: 1995. An Overview of Selected Curable Sexually Transmitted Diseases. [Google Scholar]
  62. Xia M, Bumgarner RE, Lampe MF, Stamm WE. Chlamydia trachomatis infection alters host cell transcription in diverse cellular pathways. J Infect Dis. 2003;187:424–434. doi: 10.1086/367962. [DOI] [PubMed] [Google Scholar]
  63. Yang T, Sun D, Huang YG, Smart A, Briggs JP, Schnermann JB. Differential regulation of COX-2 expression in the kidney by lipopolysaccharide: role of CD14. Am J Physiol. 1999;277:F10–F16. doi: 10.1152/ajprenal.1999.277.1.F10. [DOI] [PubMed] [Google Scholar]
  64. Yap EH, Ho TH, Chan YC, Thong TW, Ng GC, Ho LC, Singh M. Serum antibodies to Trichomonas vaginalis in invasive cervical cancer patients. Genitourin Med. 1995;71:402–404. doi: 10.1136/sti.71.6.402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhang ZF, Graham S, Yu SZ, Marshall J, Zielezny M, Chen YX, et al. Trichomonas vaginalis and cervical cancer. A prospective study in China. Ann Epidemiol. 1995;5:325–332. doi: 10.1016/1047-2797(94)00101-x. [DOI] [PubMed] [Google Scholar]

RESOURCES