Skip to main content
Journal of Medical Genetics logoLink to Journal of Medical Genetics
. 2006 Jul;43(7):e34. doi: 10.1136/jmg.2005.038331

CHEK2 I157T associates with familial and sporadic colorectal cancer

O Kilpivaara 1,2, P Alhopuro 1,2, P Vahteristo 1,2, L A Aaltonen 1,2, H Nevanlinna 1,2
PMCID: PMC2564563  PMID: 16816021

Abstract

Background

Recently, a functionally defective CHEK2 variant I157T has been proposed to associate with an increased risk of several types of cancer. We investigated the CHEK2 I157T variant for colorectal cancer (CRC) predisposition in a large population based study including a significant number of familial CRC cases.

Methods

We screened the CHEK2 I157T variant in a population based series of 1042 Finnish CRC patients using restriction fragment length polymorphism. Mutation status was studied for correlation with clinical characteristics and family history of CRC and other cancers.

Results

The frequency of CHEK2 I157T was significantly higher in CRC patients (7.8%, 76/972) than in healthy population controls (5.3%, 100/1885) (OR = 1.5, 95% CI 1.1 to 2.1, p = 0.008). The significant association of CHEK2 I157T with CRC was observed among patients with (10.4%, 14/135) and without (7.4%, 62/837) a family history of CRC (OR = 2.1, 95% CI 1.1 to 3.7, p = 0.01; OR = 1.4, 95% CI 1.0 to 2.0, p = 0.03; respectively). A trend towards higher variant frequency was also noted among patients with multiple primary tumours and a family history of any cancer.

Conclusions

CHEK2 I157T associates with an increased risk of CRC: the association was observed both among familial and sporadic CRC patients. Furthermore, the higher frequency of I157T among patients with multiple primary tumours as well as those with a family history of any cancer supports a role for CHEK2 I157T as a susceptibility allele for multiple cancer types.

Keywords: CHEK2, colorectal cancer, susceptibility


High penetrance mutations and low penetrance variants contribute to genetic predisposition to colorectal cancer (CRC). Rare cancer syndromes, such as familial adenomatous polyposis and Lynch syndrome (also known as HNPCC) affecting APC and mismatch repair (MMR) genes, respectively, only account for approximately 5% of CRC cases. A large proportion of genetic predisposition to CRC may be due to low penetrance variants in genes encoding proteins involved, for example, in carcinogen metabolism, methylation, DNA repair, or cell cycle control.

Cell cycle checkpoint kinase 2 (CHEK2) is a serine/threonine kinase which takes part in various cellular functions regulating cell cycle progression, apoptosis, and DNA damage repair (reviewed in Bartek and Lukas1). CHEK2 protein consists of three functional domains: SQ/TQ cluster domain (SCD), forkhead associated (FHA) domain, and kinase domain. The SCD is a target for (auto)phosphorylation and is thus important for activation and regulation of CHEK2 functions. The FHA domain is responsible for substrate specificity of CHEK2 through phosphorylation dependent protein‐protein interactions and is also involved in the activation process of CHEK2. The CHEK2 variant I157T, first associated with an increased risk of breast cancer2 and subsequently also with prostate cancer3 and a number of other cancers,4 resides in the FHA domain of CHEK2. Functional studies indicate that CHEK2 I157T protein is stable and becomes normally activated,5 but also that binding to its substrates p53,6 BRCA1,7 and Cdc25A8 is adversely affected. The CHEK2 I157T protein is capable of forming dimers in vivo with other CHEK2 I157T molecules, as well as with the wild type CHEK2 protein,2 although impaired CHEK2 oligomerisation and reduced autophosphorylation in I157T CHEK2 proteins has also been reported.9 Taken together, these impaired properties of CHEK2 I157T could result in a grossly reduced number of functional CHEK2 units in the cell, suggesting a molecular mechanism behind the cancer susceptibility associated with the I157T allele. The 1100delC allele of CHEK2, residing in the kinase domain and leading to a truncated protein product, has also been found as a low penetrance breast cancer predisposition allele, with a twofold increased breast cancer risk and significant contribution to familial breast cancer.10,11,12

We have previously found the CHEK2 I157T variant to be associated with a 1.4‐fold increased breast cancer risk among unselected Finnish breast cancer patients.2 In another study on a combined German and Belorussian breast cancer series, an even stronger association with breast cancer risk was found (OR = 4.1, 95% CI 1.8 to 9.2, p<0.001).13 Cybulski et al further reported an elevated frequency of CHEK2 I157T in breast, colon, kidney, prostate, and thyroid cancer patients as well as in non‐Hodgkin lymphoma patients.4 Their results on CHEK2 I157T and both breast and prostate cancers are similar to findings previously reported in Finland,2,3 and the association of CHEK2 I157T and hereditary prostate cancer is strong in both populations.3,14 The population frequencies in Finland and Poland are also very similar: 5.3%2 and 4.8%,4 respectively. The I157T variant is also present in German and Belorussian populations at comparable frequencies,13,14,15 while in other studied populations CHEK2 I157T is very rare or non‐existent.16

We have here elucidated the role of CHEK2 I157T in CRC predisposition in Finland by analysing the frequency of the I157T variant in a population based series of 1042 CRC patients, including a significant number of familial CRC cases. Association of the I157T variant with familial CRC has not been assessed previously.

Methods

Patients

CHEK2 I157T was screened in a Finnish population based series of 1042 CRC patients. The data were collected prospectively at nine Finnish central hospitals between 1994 and 1998 and have previously been described in detail.17,18 The patient series includes 135 familial CRC cases, defined as two or more first degree relative CRC cases in the same family, and 290 patients with a family history of any cancer (three or more cancer cases in first degree relatives including the index case). The clinical data collected for the patients include age at diagnosis, family history of cancer, pathology reports, and tumour grade. A complete data set was available for every CRC patient. Patient information and samples were obtained with full informed consent. The study was approved by the appropriate ethics review committee (Helsinki University Central Hospital Ethics Committee E8). The healthy Finnish population control subjects (n = 1885) were previously screened for CHEK2 I157T as described in Kilpivaara et al.2 The Finnish population frequency for I157T was 5.3%, with little or no geographical variation.

Detection of CHEK2 I157T

The CHEK2 I157T mutation was studied using restriction fragment length polymorphism (RFLP) analysis. The CHEK2 exons 2 and 3 were amplified from genomic DNA using CHEK2 specific primers 2–3F (5′‐GGCTATTTTCCTACAATTAGC) and 2–3R (5′‐CATATTCTGTAAGGACAGGAC) on genomic DNA. The PCR product was then digested with BtsI enzyme (New England Biolabs, Beverly, MA, USA) and resulting fragments were separated using 2% agarose gel electrophoresis. The BtsI enzyme digests the PCR product with a wild type allele once and a PCR product with the T470C (I157T) allele twice. All I157T positive findings were confirmed by independent analysis.

Statistical methods

The frequencies of the CHEK2 I157T variant between CRC patients and population controls were compared using χ2 test, and when required, Fisher's exact test. The ANOVA test was used for comparison of age at diagnosis between groups. A p value of <0.05 was considered statistically significant. SPSS version 12.0 for Windows (SPSS, Chicago, IL, USA) was used for the statistical analyses.

Results

A total of 972 CRC patient samples were successfully analysed for the CHEK2 I157T mutation, which is 93.3% of the whole patient cohort (972/1042). No results were obtained for 70 samples because of missing DNA or unsuccessful RFLP analysis due to poor DNA quality. The mutation frequency among unselected CRC patients was 7.8% (76/972), which is significantly higher than the Finnish population frequency of 5.3% (OR = 1.5, 95% CI 1.1 to 2.1, p = 0.008). In order to analyse the association between familial aggregation of CRC and CHEK2, the patients were grouped into familial cases, defined as two or more first degree CRC cases in the same family, and non‐familial cases. The frequencies of CHEK2 I157T separately for familial and non‐familial CRC cases were both significantly higher than the population frequency, with a carrier frequency of 10.4% (14/135, OR = 2.1, 95% CI 1.1 to 3.7, p = 0.01) among familial cases and 7.4% (62/837, OR = 1.4, 95% CI 1.0 to 2.0, p = 0.03) among non‐familial cases. Two patients were homozygous for CHEK2 I157T. These patients had no specific phenotypic features.

A slightly higher frequency of CHEK2 I157T was also observed among cases with a family history of any type of cancer, defined as three or more cancer cases in first degree relatives (including the index case), in comparison with cases having no family history of cancer (29/290, 10.0% v 47/679, 6.9%, p = 0.10). The I157T variant frequency among index CRC cases with a family history of other types of cancer (excluding familial CRC) was 8.9% (17/192). In addition, the CHEK2 I157T variant was more common among patients with multiple primary tumours than among those with only one primary tumour (16/140, 11.4% v 60/832, 7.2%, p = 0.09). It is noteworthy that multiple colorectal tumours do not explain the higher frequency among patients with multiple tumours since only one of those 16 CHEK2 I157T carriers belonged to that group because of another colorectal tumour. The frequencies of CHEK2 I157T in various subgroups are given in table 1.

Table 1 Frequency of CHEK2 I157T in colorectal cancer cases and controls.

Total Wild type I157T % p* OR* 95% CI
Controls 1885 1785 100 5.3 1.0
All CRC cases 972 896 76 7.8 0.008 1.5 1.1 to 2.1
Familial CRC cases 135 121 14 10.4 0.01 2.1 1.1 to 3.7
Non‐familial CRC cases 837 775 62 7.4 0.03 1.4 1.0 to 2.0
p† OR†
Female 483 449 34 7.0
Male 489 447 42 8.6 0.37 1.2 0.8 to 2.0
Cases with one colorectal tumour 832 772 60 7.2
Cases with multiple tumours 140 124 16‡ 11.4 0.09 1.7 0.9 to 3.0
No family history of cancer 679 632 47 6.9
Family history of cancer 290 261 29 10.0 0.10 1.5 0.9 to 2.4

*Versus population controls; †versus the other subgroup; ‡only one patient belonged to this group because of another colorectal tumour.

Family history of cancer is defined as three or more cancer cases in first degree family members including the index case. Family history of CRC is defined as two or more CRC cases in first degree family members including the index case.

No statistically significant association was observed between CHEK2 I157T status and tumour grade, tumour stage (Dukes), or replication error (RER) status (table 2). The ages at onset of CRC were very similar (67 years) for both CHEK2 I157T carriers and non‐carriers (data not shown), as also reported previously.4 In addition, there was no difference in frequencies between patients with tumours located distally (left) or proximally (right) to the splenic flexure.

Table 2 Characteristics of colorectal tumours from 972 unselected CRC patients analysed for CHEK2 I157T.

Characteristic Germline CHEK2 p
Wild type I157T
Tumour site
 Ascending colon 101 (93.5%) 7 (6.5%) ND
 Caecum 113 (91.9%) 10 (8.1%)
 Descending colon 36 (94.7%) 2 (5.3%)
 Flexura hepatic 19 (90.5%) 2 (9.5%)
 Flexura lienalis 17 (89.5%) 2 (10.5%)
 Rectum 353 (90.1%) 39 (9.9%)
 Rectosigma 20 (95.2%) 1 (4.8%)
 Sigma 178 (94.7%) 10 (5.3%)
 Transversum 53 (94.6%) 3 (5.4%)
Tumour grade, n = 953* 0.84
 1 179 (93.2%) 13 (6.8%)
 2 624 (92.0%) 54 (8.0%)
 3 76 (91.6%) 7 (6.4%)
Tumour stage (Dukes), n = 967
 A 180 (91.8%) 16 (8.2%) 0.95
 B 354 (92.7%) 28 (7.3%)
 C 244 (92.1%) 21 (7.9%)
 D 113 (91.1%) 11 (8.9%)
RER status, n = 972 0.60
 Negative 783 (92.0%) 68 (8.0%)
 Positive 113 (93.4%) 8 (6.6%)

*Two grade 4 tumours (wild type for the CHEK2 I157T) were not included in the statistics.

ND, not determined; RER, replication error.

Discussion

We have here analysed the incidence of CHEK2 I157T in Finnish CRC patients and found a significant association of CHEK2 I157T with CRC risk. Our results are in agreement with the suggested association between CHEK2 I157T and colon cancer among unselected Polish patients4 and indicate that CHEK2 I157T may be a risk allele for CRC in the Finnish population.

Association of I157T with familial CRC has not previously been assessed. We found here that CHEK2 I157T also significantly associates with the familial form of CRC. The I157T variant was also more frequent among CRC patients with a family history of any cancer (CRC or other cancers) as well as among those with multiple primary tumours, although these findings did not reach statistical significance due to the small number of cases. Similarly, among our series of 627 unselected breast cancer cases previously analysed for the I157T variant,2 a higher frequency of I157T was also seen among breast cancer patients with multiple cancers (other than breast) than among those with only one primary tumour (8/68, 11.8% v 36/518, 6.5%). The I157T variant has so far been found significantly associated with breast, prostate, kidney, colon, and thyroid cancers and non‐Hodgkin lymphoma.2,3,4,13 An elevated frequency has also been reported among bladder and pancreatic cancer patients as compared to population controls.4 Our findings of an increased risk for multiple cancers among CHEK2 I157T carriers as well as with a family history of any cancer support the suggested role of I157T as a risk allele for many different cancer types.4

These data on the increased cancer risk of the I157T variant are from northern or central/eastern European populations including Finns, Poles, Germans, and Belorussians, among whom CHEK2 I157T is present at fairly similar population frequencies, while it is very rare or absent in other studied populations. The absence or rarity of both the CHEK2 I157T and 1100delC variants in many studied populations limits the possibility of evaluating the cancer risks associated with these variants. The evidence for association of the 1100delC allele with breast cancer is strong and there is evidence for an increased risk of prostate cancer as well,3,10,11,12 but the role of CHEK2 1100delC in other cancer types remains so far unestablished. CHEK2 1100delC has also been suggested to associate with CRC, as the incidence of CHEK2 1100delC was observed to be higher in breast cancer families with than without CRC.19 However, recent results suggest that CHEK2 1100delC is not associated with increased risk of either familial or sporadic CRC or that the possible effect on risk is very low.20 Cybulski et al observed very low frequencies of CHEK2 1100delC among Polish colon cancer patients and controls (0.7% and 0.25%, respectively) and concluded that the 1100delC allele does not increase colon cancer risk.4 However, a low risk effect can not be ruled out based on these results. The 1100delC allele was not found associated with colorectal disease either.21 Altogether, the evidence for CRC risk conferred by 1100delC suggests a lower CRC risk than that conferred by I157T, or no elevated risk at all.20,22,23

While both CHEK2 1100delC and I157T confer increased risk for breast and prostate cancer, differences in tissue specificity or magnitude of cancer risk may also exist.

The CHEK2 I157T variant is likely to harm cells through defective binding of CHEK2 protein to its substrates6,7,8 in the process of mediating DNA damage induced cell cycle checkpoints, DNA repair, and apoptosis. Brown et al have reported that CHEK2 associates with MSH2,24 an MMR complex member, and a CRC susceptibility gene. Furthermore, they suggest that CHEK2 activation upon ionising radiation would be challenged in cells deficient in MMR. Whether interaction with MSH2 protein is also affected in the CHEK2 I157T cells remains to be established.

In conclusion, our results suggest that CHEK2 I157T is a risk allele for both familial and sporadic CRC. A higher frequency of I157T among patients with multiple primary tumours as well as those with a family history of any cancer supports a role for CHEK2 I157T as a susceptibility allele for multiple cancer types.

Acknowledgements

We would like to thank Professor Jiri Bartek (Institute of Cancer Biology, Danish Cancer Society) for critical review of the manuscript.

Abbreviations

CHEK2 - cell cycle checkpoint kinase 2

CRC - colorectal cancer

FHA - forkhead associated

MMR - mismatch repair

RER - replication error

RFLP - restriction fragment length polymorphism

SCD - SQ/TQ cluster domain

Footnotes

This study has been financially supported by the Helsinki University Central Hospital Research Fund, Academy of Finland, Finnish Cancer Society, Sigrid Juselius Foundation, Foundation of the Finnish Cancer Institute, Finnish Cultural Foundation Uusimaa, Ida Montin Foundation, and Emil Aaltonen Foundation

Competing interests: none declared

References

  • 1.Bartek J, Lukas J. Chk1 and Chk2 kinases in checkpoint control and cancer. Cancer Cell 20033421–429. [DOI] [PubMed] [Google Scholar]
  • 2.Kilpivaara O, Vahteristo P, Falck J, Syrjakoski K, Eerola H, Easton D, Bartkova J, Lukas J, Heikkila P, Aittomaki K, Holli K, Blomqvist C, Kallioniemi O P, Bartek J, Nevanlinna H. CHEK2 variant I157T may be associated with increased breast cancer risk. Int J Cancer 2004111543–547. [DOI] [PubMed] [Google Scholar]
  • 3.Seppala E H, Ikonen T, Mononen N, Autio V, Rokman A, Matikainen M P, Tammela T L, Schleutker J. CHEK2 variants associate with hereditary prostate cancer. Br J Cancer 2003891966–1970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cybulski C, Gorski B, Huzarski T, Masojc B, Mierzejewski M, Debniak T, Teodorczyk U, Byrski T, Gronwald J, Matyjasik J, Zlowocka E, Lenner M, Grabowska E, Nej K, Castaneda J, Medrek K, Szymanska A, Szymanska J, Kurzawski G, Suchy J, Oszurek O, Witek A, Narod S A, Lubinski J. CHEK2 is a multiorgan cancer susceptibility gene. Am J Hum Genet 2004751131–1135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wu X W S, Chen J. Characterization of tumor‐associated Chk2 mutations. J Biol Chem 20012762971–2974. [DOI] [PubMed] [Google Scholar]
  • 6.Falck J, Lukas C, Protopopkova M, Lukas J, Selivanova G, Bartek J. Functional impact of concomitant versus alternative defects in the Chk2‐p53 tumour suppressor pathway. Oncogene 2001205503–5510. [DOI] [PubMed] [Google Scholar]
  • 7.Li J, Williams B L, Haire L F, Goldberg M, Wilker E, Durocher D, Yaffe M B, Jackson S P, Smerdon S J. Structural and functional versatility of the FHA domain in DNA‐damage signaling by the tumor suppressor kinase Chk2. Mol Cell 200291045–1054. [DOI] [PubMed] [Google Scholar]
  • 8.Falck J, Mailand N, Syljuåsen R G, Bartek J, Lukas J. The ATM‐Chk2‐Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 2001410842–847. [DOI] [PubMed] [Google Scholar]
  • 9.Schwarz J K, Lovly C M, Piwnica‐Worms H. Regulation of the Chk2 protein kinase by oligomerization‐mediated cis‐ and trans‐phosphorylation. Mol Cancer Res 20031598–609. [PubMed] [Google Scholar]
  • 10.CHEK2 Breast Cancer Case‐Control Consortium CHEK2*1100delC and susceptibility to breast cancer: a collaborative analysis involving 10,860 breast cancer cases and 9,065 controls from 10 studies. Am J Hum Genet 2004741175–1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Meijers‐Heijboer H, van den Ouweland A, Klijn J, Wasielewski M, de Snoo A, Oldenburg R, Hollestelle A, Houben M, Crepin E, van Veghel‐Plandsoen M, Elstrodt F, van Duijn C, Bartels C, Meijers C, Schutte M, McGuffog L, Thompson D, Easton D, Sodha N, Seal S, Barfoot R, Mangion J, Chang‐Claude J, Eccles D, Eeles R, Evans D G, Houlston R, Murday V, Narod S, Peretz T, Peto J, Phelan C, Zhang H X, Szabo C, Devilee P, Goldgar D, Futreal P A, Nathanson K L, Weber B, Rahman N, Stratton M R. Low‐penetrance susceptibility to breast cancer due to CHEK2(*)1100delC in noncarriers of BRCA1 or BRCA2 mutations. Nat Genet 20023155–59. [DOI] [PubMed] [Google Scholar]
  • 12.Vahteristo P, Bartkova J, Eerola H, Syrjäkoski K, Ojala S, Kilpivaara O, Tamminen A, Kononen J, Aittomäki K, Heikkilä P, Holli K, Blomqvist C, Bartek J, Kallioniemi O ‐ P, Nevanlinna H. A CHEK2 genetic variant contributing to a substantial fraction of familial breast cancer. Am J Hum Genet 200271432–438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bogdanova N, Enssen‐Dubrowinskaja N, Feshchenko S, Lazjuk G I, Rogov Y I, Dammann O, Bremer M, Karstens J H, Sohn C, Dork T. Association of two mutations in the CHEK2 gene with breast cancer. Int J Cancer 200520263–266. [DOI] [PubMed] [Google Scholar]
  • 14.Cybulski C, Huzarski T, Gorski B, Masojc B, Mierzejewski M, Debniak T, Gliniewicz B, Matyjasik J, Zlowocka E, Kurzawski G, Sikorski A, Posmyk M, Szwiec M, Czajka R, Narod S A, Lubinski J. A novel founder CHEK2 mutation is associated with increased prostate cancer risk. Cancer Res 2004642677–2679. [DOI] [PubMed] [Google Scholar]
  • 15.Dufault M R, Betz B, Wappenschmidt B, Hofmann W, Bandick K, Golla A, Pietschmann A, Nestle‐Kramling C, Rhiem K, Huttner C, von Lindern C, Dall P, Kiechle M, Untch M, Jonat W, Meindl A, Scherneck S, Niederacher D, Schmutzler R K, Arnold N. Limited relevance of the CHEK2 gene in hereditary breast cancer. Int J Cancer 2004110320–325. [DOI] [PubMed] [Google Scholar]
  • 16.Schutte M, Seal S, Barfoot R, Meijers‐Heijboer H, Wasielewski M, Evans D G, Eccles D, Meijers C, Lohman F, Klijn J, Van Den Ouweland A, Futreal P A, Nathanson K L, Weber B L, Easton D F, Stratton M R, Rahman N. Variants in CHEK2 other than 1100delC do not make a major contribution to breast cancer susceptibility. Am J Hum Genet 2003721023–1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Aaltonen L A, Salovaara R, Kristo P, Canzian F, Hemminki A, Peltomaki P, Chadwick R B, Kaariainen H, Eskelinen M, Jarvinen H, Mecklin J P, de la Chapelle A. Incidence of hereditary nonpolyposis colorectal cancer and the feasibility of molecular screening for the disease. N Engl J Med 19983381481–1487. [DOI] [PubMed] [Google Scholar]
  • 18.Salovaara R, Loukola A, Kristo P, Kaariainen H, Ahtola H, Eskelinen M, Harkonen N, Julkunen R, Kangas E, Ojala S, Tulikoura J, Valkamo E, Jarvinen H, Mecklin J P, Aaltonen L A, de la Chapelle A. Population‐based molecular detection of hereditary nonpolyposis colorectal cancer. J Clin Oncol 2000182193–2200. [DOI] [PubMed] [Google Scholar]
  • 19.Meijers‐Heijboer H, Wijnen J, Vasen H, Wasielewski M, Wagner A, Hollestelle A, Elstrodt F, van den Bos R, de Snoo A, Fat G T, Brekelmans C, Jagmohan S, Franken P, Verkuijlen P, van den Ouweland A, Chapman P, Tops C, Moslein G, Burn J, Lynch H, Klijn J, Fodde R, Schutte M. The CHEK2 1100delC mutation identifies families with a hereditary breast and colorectal cancer phenotype. Am J Hum Genet 2003721308–1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kilpivaara O, Laiho P, Aaltonen L A, Nevanlinna H. CHEK2 1100delC and colorectal cancer. J Med Genet 200340e110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lipton L, Fleischmann C, Sieber O M, Thomas H J, Hodgson S V, Tomlinson I P, Houlston R S. Contribution of the CHEK2 1100delC variant to risk of multiple colorectal adenoma and carcinoma. Cancer Lett 2003200149–152. [DOI] [PubMed] [Google Scholar]
  • 22.Meijers‐Heijboer H, Wijnen J, Vasen H, Wasielewski M, Wagner A, Hollestelle A, Elstrodt F, Van Den Bos R, De Snoo A, Tjon A F G, Brekelmans C, Jagmohan S, Franken P, Verkuijlen P, Van Den Ouweland A, Chapman P, Tops C, Moslein G, Burn J, Lynch H, Klijn J, Fodde R, Schutte M. The CHEK2 1100delC mutation identifies families with a hereditary breast and colorectal cancer phenotype. Am J Hum Genet 2003721308–1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.de Jong M M, Nolte I M, Te Meerman G J, van der Graaf W T, Mulder M J, van der Steege G, Bruinenberg M, Schaapveld M, Niessen R C, Berends M J, Sijmons R H, Hofstra R M, de Vries E G, Kleibeuker J H. Colorectal cancer and the CHEK2 1100delC mutation. Genes Chromosomes Cancer 200543377–382. [DOI] [PubMed] [Google Scholar]
  • 24.Brown K D, Rathi A, Kamath R, Beardsley D I, Zhan Q, Mannino J L, Baskaran R. The mismatch repair system is required for S‐phase checkpoint activation. Nat Genet 20033380–84. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Medical Genetics are provided here courtesy of BMJ Publishing Group

RESOURCES