Skip to main content
NCBI home page
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2008 Aug 11;52(10):3795–3800. doi: 10.1128/AAC.00464-08

Fluoroquinolone Enhances the Mutation Frequency for Meropenem-Selected Carbapenem Resistance in Pseudomonas aeruginosa, but Use of the High-Potency Drug Doripenem Inhibits Mutant Formation▿

Koichi Tanimoto 2, Haruyoshi Tomita 1, Shuhei Fujimoto 1, Katsuko Okuzumi 3, Yasuyoshi Ike 1,2,*
PMCID: PMC2565900  PMID: 18694945

Abstract

The mutation frequency for carbapenem resistance in Pseudomonas aeruginosa strains that were selected with carbapenems was enhanced in the presence of subinhibitory concentrations of fluoroquinolones. The mutants showed either a loss of OprD activity or increased mexAB-oprM expression. The highest mutant isolation frequency was obtained by selection with meropenem, while doripenem inhibited mutant growth.

The carbapenem group of β-lactam antibiotics is highly active against Pseudomonas aeruginosa. In the absence of the carbapenem-hydrolyzing enzyme metallo-β-lactamase, carbapenem resistance mechanisms include reduced expression of OprD (3, 24, 32, 33) and increased expression of mexAB-oprM (6, 11, 13, 17, 23) or AmpC cephalosporinase (14, 15, 23). The interplay between AmpC cephalosporinase and the loss of OprD is an essential element of carbapenem resistance (14). The reduction in OprD expression found in P. aeruginosa is the result of a spontaneous mutation lacking the D2 (OprD) porin outer membrane protein (3, 24, 32, 33). The isolation frequency of carbapenem resistance in P. aeruginosa clinical iso-lates in Japan is about 40%. The MICs of meropenem (MEPM) are ≧16 μg/ml (i.e., full resistance) and 8 μg/ml (i.e., intermediate resistance) for about 20% and 20% of isolates, respectively (22, 27), and about 0.4% of the fully resistant isolates produce metallo-β-lactamase (21).

Many cancer centers administer prophylactic fluoroquinolone to neutropenic patients after chemotherapy (2, 9, 30). Fluoroquinolones are mutagenic in bacteria, and their usage might enhance the frequency of mutations resulting in bacterial drug resistance (4, 10, 16, 28). We have shown that fluoroquinolone enhanced the carbapenem resistance mutation rate in P. aeruginosa and that carbapenem-resistant mutants were selected in the presence of carbapenems. We have also shown that the highest frequency of mutant isolation occurred during selection with MEPM, while doripenem (DRPM) inhibited mutant growth.

We used P. aeruginosa PAO1 and four other P. aeruginosa clinical isolates susceptible to carbapenems (Table 1). The agar dilution method was used to determine MICs according to CSLI guidelines. All cultures were incubated for 18 h at 37°C. The carbapenem-resistant mutants were isolated on AB3 agar plates containing each carbapenem (26). A culture of each strain was diluted 106-fold with fresh AB3 broth in either the presence or absence of the representative fluoroquinolones ciprofloxacin and ofloxacin (16). After incubation, 0.1 ml of each culture or its 10−1 dilution was spread onto an agar plate containing a carbapenem. Colony growth was then examined. Ten colonies selected at random from each selective agar plate were examined for drug resistance (MIC), and representative mutant strains were used for further analysis. In this study, “resistance” was defined as an increased MIC for the antibiotic in the mutant strain compared to its parent strain, as the mutant strains showed reduced susceptibility or resistance to carbapenems by CSLI criteria.

TABLE 1.

Drug susceptibilities and genotypes of the P. aeruginosa strains and its derivatives in this study

Straina Genotype or phenotype MIC (μg/ml)b
DRPM MEPM IPM CAZ PIPC GM CPFX OFLX
PAO1 Parent 0.2 0.2 0.8 1.6 3.1 1.6 0.2 0.8
PAO1KTL oprD 0.8 1.6 12.5 1.6 3.1 1.6 0.2 0.8
PAO1KTL1 oprD mexAB(Hy)-oprM(Hy) 1.6 6.3 12.5 6.3 12.5 1.6 0.8 3.1
PAO1KTS mexAB(Hy)-oprM(Hy) 0.4 1.6 0.8 6.3 12.5 1.6 0.8 3.1
PAO1IPM46 oprD 0.8 1.6 12.5 1.6 3.1 1.6 0.2 0.8
PAO1SO20 mexAB(Hy)-oprM(Hy) 0.4 1.6 0.8 6.3 12.5 1.6 0.8 3.1
GP4 Wild type 0.2 0.2 0.8 1.6 100 100 0.2 1.6
GP4KT11 oprD 1.6 3.1 12.5 1.6 100 100 0.2 1.6
GP4KT111 oprD mexAB(Hy)-oprM(Hy) 3.1 12.5 12.5 6.3 200 100 0.8 6.3
GP20 Wild type 0.2 0.2 0.8 1.6 100 3.1 0.2 1.6
GP20KT21 oprD 1.6 3.1 12.5 1.6 100 3.1 0.2 1.6
GP37 Wild type 0.2 0.2 0.8 1.6 100 100 0.2 1.6
GP37KT31 oprD 1.6 3.1 12.5 1.6 100 100 0.2 1.6
GP62 Wild type 0.1 0.2 0.8 1.6 100 1.6 0.2 1.6
GP62KT41 oprD 0.8 3.1 12.5 1.6 100 1.6 0.2 1.6
GP61 Wild type, oprD 0.8 1.6 6.3 3.1 3.1 1.6 0.2 1.6
GP61KT51 oprD mexAB(Hy)-oprM(Hy) 1.6 6.3 6.3 12.5 12.5 1.6 0.8 6.3
Open in a new tab
a

PAO1IPM46 and PAO1SO20 are reported PAO1 mutants with decreased oprD expression and increased mexAB-oprM expression, respectively (18). P. aeruginosa GP4, GP20, GP37, and GP62 are carbapenem-susceptible clinical isolates. The clinical strain GP61 was used as the representative wild-type strain with a higher imipenem MIC. The reduced expression of oprD in GP61 is shown in Fig. 1. During this study, the drug susceptibilities of the mutant strains isolated on the agar plates containing the selective carbapenem drugs DRPM, MEPM, and IPM, respectively, were examined and representative strains are shown. The representative mutant strains PAO1KTL and PAO1KTS were isolated from PAO1, and GP4KT11, GP20KT21, GP37KT31, and GP62KT41 were isolated from GP4, GP20, GP37, and GP62, respectively. The representative mutant strains PAO1KTL1, GP4KT111, and GP61KT51 were isolated from the oprD mutants of PAO1KTL, GP4KT11, and clinical isolate GP61, respectively.

b

DRPM is a new carbapenem that has been developed by Shionogi Pharmaceuticals, Osaka, Japan) (7, 8, 19). Abbreviations for the other antibiotics used are as follows: CAZ, ceftazidime; PIPC, piperacillin; GM, gentamicin; CPFX, ciprofloxacin; and OFLX, ofloxacin.

Carbapenem-resistant PAO1 mutants were obtained on agar containing drug concentrations equivalent to twice the MIC of MEPM and IPM (Table 2). The highest frequencies of mutant isolation were obtained by selection on MEPM. The presence of ciprofloxacin or ofloxacin at a subinhibitory concentration increased the number of mutants obtained by about seven- or sixfold, respectively, during MEPM selection. The results indicated that the highest frequency of mutant cells was obtained in the presence of MEPM, while DRPM inhibited mutant growth (25, 26).

TABLE 2.

Isolation frequency of carbapenem-resistant mutants of P. aeruginosa strains in broth culture with and without ciprofloxacin or ofloxacin

Strain no.a Drug MIC (μg/ml) for parent Drug concn in selective agar (μg/ml) Isolation frequencyb (10−7)
Ciprofloxacin (0.03 μg/ml) in broth culture
Ofloxacin (0.25 μg/ml) in broth culture
− + Factorc − + Factorc
PAO1 DRPM 0.2 0.4 <0.053 <0.053 <0.053 <0.053
MEPM 0.2 0.4 3.8 ± 0.70 26 ± 5.0 6.8 2.5 ± 0.50 15 ± 1.2 6.0
IPM 0.8 1.6 0.18 ± 0.07 1.0 ± 0.20 5.6 0.43 ± 0.07 0.82 ± 0.01 1.9
GP4 DRPM 0.2 0.4 1.8 ± 0.31 5.6 ± 0.61 3.1 1.2 ± 0.22 3.8 ± 0.27 3.2
MEPM 0.2 0.4 7.6 ± 0.51 29 ± 3.5 3.8 8.3 ± 0.54 41 ± 3.7 4.9
IPM 0.8 1.6 2.0 ± 0.11 9.4 ± 0.81 4.7 1.8 ± 0.32 6.7 ± 0.49 3.7
GP20 DRPM 0.2 0.4 2.7 ± 0.13 7.0 ± 0.91 2.6 2.2 ± 0.15 5.9 ± 0.55 2.7
MEPM 0.2 0.4 11 ± 1.8 65 ± 6.4 5.9 7.8 ± 0.95 25 ± 3.6 3.9
IPM 0.8 1.6 4.0 ± 0.65 16 ± 2.5 4.0 3.6 ± 0.27 12 ± 4.0 3.3
GP37 DRPM 0.2 0.4 2.6 ± 0.21 5.0 ± 0.40 1.9 2.8 ± 0.19 6.7 ± 0.73 2.4
MEPM 0.2 0.4 13 ± 1.9 31 ± 3.5 2.4 11 ± 1.7 40 ± 3.6 3.6
IPM 0.8 1.6 4.6 ± 0.39 16 ± 2.1 3.5 4.7 ± 0.52 23 ± 2.6 4.9
GP62 DRPM 0.1 0.2 1.6 ± 0.21 4.2 ± 0.37 2.6 2.7 ± 0.26 11 ± 2.0 4.1
MEPM 0.2 0.4 7.1 ± 0.68 24 ± 1.1 3.4 3.6 ± 0.24 18 ± 1.2 5.0
IPM 0.8 1.6 1.8 ± 0.26 6.8 ± 0.56 3.8 1.7 ± 0.23 9.0 ± 0.79 5.3
PAO1 DRPM 0.2 0.8 <0.053 <0.053 <0.053 <0.053
MEPM 0.2 0.8 <0.053 <0.053 <0.053 <0.053
IPM 0.8 3.1 <0.053 <0.053 <0.053 <0.053
GP4 DRPM 0.2 0.8 <0.053 <0.053 <0.020 <0.021
MEPM 0.2 0.8 3.1 ± 0.46 21 ± 2.6 6.8 5.4 ± 0.61 38 ± 3.2 7.0
IPM 0.8 3.1 0.44 ± 0.030 1.6 ± 0.11 3.6 0.43 ± 0.051 2.2 ± 0.29 5.1
GP20 DRPM 0.2 0.8 <0.045 <0.14 <0.020 <0.020
MEPM 0.2 0.8 6.7 ± 0.40 37 ± 3.0 5.5 4.1 ± 0.41 14 ± 2.1 3.5
1.6 0.59 ± 0.054 1.7 ± 0.23 2.9 0.12 ± 0.040 0.33 ± 0.056 2.8
IPM 0.8 3.1 0.97 ± 0.061 4.0 ± 0.37 4.1 0.64 ± 0.043 1.7 ± 0.12 2.7
GP37 DRPM 0.2 0.8 <0.045 <0.057 <0.020 <0.021
MEPM 0.2 0.8 7.5 ± 0.70 23 ± 2.9 3.1 6.1 ± 0.50 28 ± 3.3 4.6
1.6 <0.045 1.0 ± 0.08 ≤10 <0.021 0.10 ± 0.018 4.8<
IPM 0.8 3.1 0.35 ± 0.023 0.87 ± 0.041 2.5 0.35 ± 0.061 1.5 ± 0.11 4.3
GP62 DRPM 0.1 0.4 <0.084 <0.056 <0.021 <0.020
MEPM 0.2 0.8 4.7 ± 0.36 44 ± 4.6 9.4 1.9 ± 0.21 13 ± 1.5 6.8
IPM 0.8 3.1 0.26 ± 0.027 0.70 ± 0.055 2.7 0.28 ± 0.031 1.5 ± 0.19 5.4
PAO1KTL DRPM 0.8 1.6 <0.068 <0.109
MEPM 1.6 3.1 0.74 ± 0.12 6.12 ± 0.66 8.3
IPM 12.5 25 <0.068 <0.109
GP4KT11 DRPM 1.6 3.1 <0.038 <0.049
MEPM 3.1 6.3 1.04 ± 0.26 4.44 ± 0.38 4.3
IPM 12.5 25 <0.038 <0.049
GP61 DRPM 0.8 1.6 <0.099 <0.213
MEPM 1.6 3.1 0.20 ± 0.04 2.08 ± 0.22 10.4
IPM 6.3 12.5 <0.099 <0.213
PAO1KTL DRPM 0.8 3.1 <0.068 <0.109
MEPM 1.6 6.3 <0.068 <0.109
IPM 12.5 50 <0.068 <0.109
GP4KT11 DRPM 1.6 6.3 <0.038 <0.049
MEPM 3.1 12.5 <0.038 <0.049
IPM 12.5 50 <0.038 <0.049
GP61 DRPM 0.8 3.1 <0.099 <0.213
MEPM 1.6 6.3 <0.099 <0.213
IPM 6.3 25 <0.099 <0.213
Open in a new tab
a

Note that for comparison, strains are grouped by 1× and 2× the drug concentration in selective agar.

b

The isolation frequency of the carbapenem-resistant mutant was determined by the number of colonies grown on a selective agar plate per number of inoculated cells, and the averages of the results of 10 independent experiments ± standard deviations are shown here.

c

The factor indicates the ratio of the number of strain mutants in broth culture with fluoroquinolone to the number obtained without fluoroquinolone.

Of the cultures grown with a concentration equivalent to 2× the MIC of MEPM, 55 of the 57 colonies (96.5%) obtained from cultures grown in the absence of ciprofloxacin and 151 of the 156 colonies (96.8%) grown in the presence of ciprofloxacin only showed resistance to carbapenems, as illustrated by the representative strain PAO1KTL (Table 1). The remaining colonies from both groups showed identical drug resistance patterns to a range of antibiotics, as seen in the representative strain PAO1KTS (Table 1).

When the concentration of the selective drug was increased by successive doubling from 2× the MIC to 16× the MIC for each drug, MEPM produced the highest frequency of carbapenem-resistant mutations in the four clinical strains (Table 2). DRPM inhibited growth of the mutants at the concentration used (26). The mutants only showed resistance to carbapenem-type antibiotics when grown in the presence of carbapenem drugs (Table 1).

The presence of fluoroquinolones in the cultures enhanced the mutation rate in all strains (Table 2).

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of the outer membrane proteins (OMPs) from each strain indicated that the carbapenem-resistant mutant had a marked reduction in the concentration of OMP with a molecular mass of about 46 kDa, indicating that the mutant resulted from the reduced production of OprD (3, 24, 32, 33). The PAO1KTS mutant showed an increase in the concentration of the 48-kDa OMP, indicating that the mutant resulted from an increased production of the MexAB-OprM protein (11, 13, 15, 23). These results indicated that in P. aeruginosa, carbapenem predominantly selects for the carbapenem-resistant mutant with a reduced production of OprD. Figure 1 shows the results obtained with representative strains.

FIG. 1.

FIG. 1.

Open in a new tab

SDS-PAGE of OMPs from carbapenem-susceptible P. aeruginosa strains and the carbapenem-resistant mutants. The OMPs of each strain were prepared as the Sarkosyl-insoluble fraction of the membrane preparation (29), and samples were subjected to SDS-PAGE (11% polyacrylamide) at a constant current of 25 mA (12). (A) P. aeruginosa PAO1 and its mutants. Lane M, protein molecular mass markers purchased from Bio-Rad (Hercules, CA); lane 1, PAO1; lane 2, PAO1IPM46 (oprD); lane 3, carbapenem-resistant mutant of PAO1 (PAO1KTL); lane 4, PAO1SO20 [mexAB(Hy)-oprM(Hy)]; lane 5, carbapenem-resistant mutant of PAO1 (PAO1KTS). (B) P. aeruginosa GP20 and its mutant. Lane 1, carbapenem-susceptible GP20; lane 2, carbapenem-resistant mutant of GP20KT21 isolated from selective agar plate containing MEPM. (C) P. aeruginosa PAO1 and its mutants. Lane 1, PAO1; lane 2, PAO1KTL; lane 3, PAO1KTL1. (D) P. aeruginosa GP61 and its mutant. Lane 1, IPM-resistant GP61 (i.e., higher IPM MIC); lane 2, MEPM-resistant mutant of GP61 isolated from selective agar plate containing MEPM. The numbers on the left side of panel A indicate the molecular mass of each marker in kilodaltons. The arrows in lanes 1 of panels A and C indicate the positions of proteins of about 46 kDa and 48 kDa, respectively. The arrows on the left side of lane 4 of panel A, lane 1 of panel B, lane 3 of panel C, and lane 2 of panel D indicate the positions of proteins of about 48 kDa, 46 kDa, 48 kDa, and 48 kDa, respectively.

DNA sequence analysis of the oprD gene showed that the mutants had one of the following: an insertion of one nucleotide, an IS407 insertion, a one-nucleotide substitution, or a one-nucleotide or multiple-nucleotide deletions (Table 3 and 4). The mutants resulted in a frameshift mutation resulting in either premature termination of translation or translation beyond the original stop codon (Table 4). There is no mutation within oprD of GP62KT41, which implies that there might be a mutation in the regulation of the oprD expression that has not yet been elucidated.

TABLE 3.

Primers for real-time PCR and PCR amplification

Gene and primer Sequence (5′→3′) Position (5′→3′)a Product size (bp) Source or reference
ampC
    ampC1 CGGCTCGGTGAGCAAGACCTTC 264-285 218 5
    ampC2 AGTCGCGGATCTGTGCCTGGTC 481-460
blaOXA
    OXA-F CGMGCAAAWAMAGMWTAT 457 20
    OXA-R1bio ARABCCATTSCCCADCCA
blaOXA-51
    Oxa-51/F CIYTIISIMGIGCIAAYAMIGARTAYG 498 1
    Oxa-51/R CAICCIGTIARCCAICCIACYTG
mexA
    mexA/F GTTCCCCAACCCGAACAAC 792-810 68 This study
    mexA/R TGACGCCTTCCTGCAACTG 859-841
oprD
    oprD/F CTACGGCTACGGCGAGGAT 1143-1161 58 This study
    oprD/R CACGTACTTGGCTTCGAGGTT 1200-1130
    oprD/F1 CACCTACGCAGATGCGAC 1045629-1045646b 1,640 This study
    oprD/R1 CAGAGTAATGAGGAAGAC 1047268-1047251b
rpoD
    rpoD/F CCTGCCGGAGGATATTTCC 96-114 70 This study
    rpoD/R GATCCCCATGTCGTTGATCAT 165-145
Open in a new tab
a

The positions given are from the first base of the coding sequences of the genes.

b

The positions given are the map coordinates of the P. aeruginosa PAO1 genome sequence.

TABLE 4.

DNA sequence and genetic analysis of the carbapenem-resistant mutants

Straina Genotype or phenotype Characteristic of DNA sequence of oprD geneb
Transcript forc:
Detection of blaOXAd
Parent gene/protein size (bp/aa) Mutant
Insertion or deletion Deduced peptide size (aa) oprD mexA ampC
PAO1 Parent 1,332/443 1 1 1 ND
PAO1KTL oprD Deletion of 129CCTG132 and 134TGCTCCGCA142 89 NTe 1.14 1.22 NT
PAO1KTL1 oprD mexAB(Hy)-oprM(Hy) NT NT 7.21 1.06 NT
PAO1KTS mexAB(Hy)-oprM(Hy) 0.914 10.26 0.81 NT
PAO1IPM46 oprD Substitution of C199 to T 66 NT 1.2 1.15 NT
PAO1SO20 mexAB(Hy)-oprM(Hy) 0.964 8.19 0.75 NT
GP4 Wild type 1,329/442 NT 1.00 1.00 ND
GP4KT11 oprD Insertion of (T) between bp 927 (C) and 928 (G) 308 NT 0.95 1.20 NT
GP4KT111 oprD mexAB(Hy)-oprM(Hy) NT NT 14.16 0.76 NT
GP20 Wild type 1,323/440 NT 1.00 1.00 ND
GP20KT21 oprD Insertion of IS407 (1,236 bp) between bp 1216 and 1217 416 NT 0.90 0.96 NT
GP37 Wild type 1,329/442 NT 1.00 1.00 ND
GP37KT31 oprD Insertion of C between bp 1205 and 1206 >442 NT 0.92 0.94 NT
GP37KT32 oprD Insertion of C between bp 1205 and 1206 >442 NT 0.98 1.10 NT
GP62 Wild type 1,332/443 1.00 1.00 1.00 ND
GP62KT41 OprD− No mutation in open reading frame of oprD 0.095 0.98 1.20 NT
GP62KT43 oprD Insertion of C between bp 147 and 148 52 NT 0.86 0.97 NT
GP62KT44 oprD Deletion of A at bp 902 343 NT 1.10 1.17 NT
GP62KT45 oprD Deletion of A at bp 902 343 NT 0.96 1.10 NT
GP61 Wild type, oprD NT NT NT 1.00 1.00 ND
GP61KT51 oprD mexAB(Hy)-oprM(Hy) NT NT NT 5.75 0.83 NT
Open in a new tab
a

GP37KT32, GP62KT44, and GP62KT45 were isolated on selective agar containing MEPM after broth culture with ciprofloxacin. Other mutant strains including PAOKTL and PAO1KTS were selected on agar containing MEPM after broth culture without fluoroquinolone.

b

DNA fragments 1,640 bp long containing the oprD gene were amplified by PCR using total DNA from each strain with specific primers (Table 3) and were sequenced.

c

cDNA synthesis and real-time PCR were performed according to the manufacturer's protocols. The amount of rpoD (σ70) transcript was monitored as an endogenous control to normalize the level of the transcript of interest (31). Specific primers for ampC, mexA, oprD, rpoD, and blaOXA are listed in Table 3.

d

The presence of blaOXA was examined by PCR analysis with a specific primer (Table 3). ND, not detected.

e

NT, not tested.

Compared to the parent strains, the PAO1KTS and PAO1SO20 mutants had almost identical levels of oprD transcript, but the level was reduced to one-tenth in the mutant GP62KT41. The level of mexA transcript was increased by about 10-fold in the mutants PAO1KTS and PAO1SO20 (18) compared to their parent strain, PAO1, indicating that the increased expression of the 48-kDa OMP resulted from the increased expression of mexA (Table 4). ampC expression by the mutants was similar to that of their parent strains (Table 4). It is known that ampC expression plays a role in carbapenem resistance when OprD is lost (14). PCR analysis did not detect the blaOXA genes in any strain (Table 4).

Highly resistant mutants to MEPM were also obtained from cultures of oprD mutants of PAO1KTL, GP4KT11, and GP61 grown on selective agar containing 2× the MIC of MEPM, but were not selected with DRPM and IPM. The fluoroquinolones in the cultures enhanced the mutation rate (Table 2). These mutant strains showed high levels of resistance to MEPM, ceftazidime, piperacillin, and fluoroquinolones (Table 1) and increased production of both the 48-kDa OMP (Fig. 1) and the mexA transcript (Table 4), indicating that these mutants resulted from the increased expression of mexAB-oprM in addition to an oprD mutation. These highly resistant MEPM-resistant mutants were predominantly obtained by selection with MEPM. Thus, MEPM was highly effective in selecting carbapenem-resistant mutants that had either lost oprD from the sensitive strain or had increased expression of mexAB-oprM in the oprD-deficient strain.

Acknowledgments

This work was supported by the grants from the Japanese Ministry of Education, Culture, Sport, Science and Technology [Tokutei-ryoiki (Matrix of Infection Phenomena), Kiban (B), Kiban (C)] and the Japanese Ministry of Health, Labor and Welfare (H15-Shinko-9 and H18-Shinko-11).

We thank Elizabeth Kamei for helpful advice and discussions.

Footnotes

▿

Published ahead of print on 11 August 2008.

REFERENCES

  • 1.Brown, S., H. K. Young, and S. G. Amyes. 2005. Characterisation of OXA-51, a novel class D carbapenemase found in genetically unrelated clinical strains of Acinetobacter baumannii from Argentina. Clin. Microbiol. Infect. 11:15-23. [DOI] [PubMed] [Google Scholar]
  • 2.Bucaneve, G., A. Micozzi, F. Menichetti, P. Martino, M. S. Dionisi, G. Martinelli, B. Allione, D. D'Antonio, M. Buelli, A. M. Nosari, D. Cilloni, E. Zuffa, R. Cantaffa, G. Specchia, S. Amadori, F. Fabbiano, G. L. Deliliers, F. Lauria, R. Foa, and A. D. Favero. 2005. Levofloxacin to prevent bacterial infection in patients with cancer and neutropenia. N. Engl. J. Med. 353:977-987. [DOI] [PubMed] [Google Scholar]
  • 3.Büscher, K.-H., W. Cullmann, W. Dick, and W. Opferkuch. 1987. Imipenem resistance in Pseudomonas aeruginosa resulting from diminished expression of an outer membrane protein. Antimicrob. Agents Chemother. 31:703-708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Carratala, J., A. Fernandez-Sevilla, F. Tubau, M. Callis, and F. Gudiol. 1995. Emergence of quinolone-resistant Escherichia coli bacteremia in neutropenic patients with cancer who have received prophylactic norfloxacin. Clin. Infect. Dis. 20:557-560. [DOI] [PubMed] [Google Scholar]
  • 5.Dumas, J. L., C. van Delden, K. Perron, and T. Köhler. 2006. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol. Lett. 254:217-225. [DOI] [PubMed] [Google Scholar]
  • 6.Evans, K., L. Adewoye, and K. Poole. 2001. MexR repressor of the mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa: identification of MexR binding sites in the mexA-mexR intergenic region. J. Bacteriol. 183:807-812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ge, Y., M. A. Wikler, D. F. Sahm, R. S. Blosser-Middleton, and J. A. Karlowsky. 2004. In vitro antimicrobial activity of doripenem, a new carbapenem. Antimicrob. Agents Chemother. 48:1384-1396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Iso, Y., T. Irie, T. Iwaki, M. Kii, Y. Sendo, K. Motokawa, and Y. Nishitani. 1996. Synthesis and modification of a novel 1 β-methyl carbapenem antibiotic, S-4661. J. Antibiot. 49:478-484. [DOI] [PubMed] [Google Scholar]
  • 9.Karp, J. E., W. G. Merz, C. Hendricksen, B. Laughon, T. Redden, B. J. Bamberger, J. G. Bartlett, R. Saral, and P. J. Burke. 1987. Oral norfloxacin for prevention of gram-negative bacterial infections in patients with acute leukemia and granulocytopenia. Ann. Intern. Med. 106:1-7. [DOI] [PubMed] [Google Scholar]
  • 10.Kern, W. V., E. Andriof, M. Oethinger, P. Kern, J. Hacker, and R. Marre. 1994. Emergence of fluoroquinolone-resistant Escherichia coli at a cancer center. Antimicrob. Agents Chemother. 38:681-687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Köhler, T., M. Michea-Hamzehpour, S. F. Epp, and J.-C. Pechere. 1999. Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrob. Agents Chemother. 43:424-427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. [DOI] [PubMed] [Google Scholar]
  • 13.Li, X.-Z., D. Ma, D. M. Livermore, and H. Nikaido. 1994. Role of efflux pump(s) in intrinsic resistance of Pseudomonas aeruginosa: active efflux as a contributing factor to β-lactam resistance. Antimicrob. Agents Chemother. 38:1742-1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Livermore, D. M. 1992. Interplay of impermeability and chromosomal β-lactamase activity in imipenem-resistant Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 36:2046-2048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Livermore, D. M. 2001. Of Pseudomonas, porins, pumps, and carbapenems. J. Antimicrob. Chemother. 47:247-250. [DOI] [PubMed] [Google Scholar]
  • 16.Mamber, S. W., B. Kolek, K. W. Brookshire, D. P. Bonner, and J. Fung-Tomc. 1993. Activity of quinolones in the Ames Salmonella TA102 mutagenicity test and other bacterial genotoxicity assays. Antimicrob. Agents Chemother. 37:213-217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Masuda, N., E. Sakagawa, and S. Ohya. 1995. Outer membrane proteins responsible for multiple drug resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 39:645-649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Miwa, H., Y. Kimura, Y. Jinushi, T. Fujimura, T. Nishikawa, T. Munekage, N. Kuroda, Y. Yamano, M. Tsuji, K. Okazaki, T. Sato, and H. Matsuda. 2005. Antipseudomonal activety of doripenem, a novel parenteral carbapenem antibiotic. Jpn. J. Chemother. 53(S-1):80-91. [Google Scholar]
  • 19.Mushtaq, S., Y. Ge, and D. M. Livermore. 2004. Doripenem versus Pseudomonas aeruginosa in vitro: activity against characterized isolates, mutants, and transconjugants and resistance selection potential. Antimicrob. Agents Chemother. 48:3086-3092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Naas, T., L. Poirel, and P. Nordmann. 2006. Pyrosequencing for rapid identification of carbapenem-hydrolysing OXA-type β-lactamases in Acinetobacter baumannii. Clin. Microbiol. Infect. 12:1236-1240. [DOI] [PubMed] [Google Scholar]
  • 21.Nishio, H., M. Komatsu, N. Shibata, K. Shimakawa, N. Sueyoshi, T. Ura, K. Satoh, M. Toyokawa, T. Nakamura, Y. Wada, T. Orita, T. Kofuku, K. Yamasaki, M. Sakamoto, S. Kinoshita, M. Aihara, and Y. Arakawa. 2004. Metallo-β-lactamase-producing gram-negative bacilli: laboratory-based surveillance in cooperation with 13 clinical laboratories in the Kinki region of Japan. J. Clin. Microbiol. 42:5256-5263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ozaki, S., M. Nagasawa, T. Sato, Y. Mure, and K. Inuzuka. 2007. Nation wide survey of bacterial drug susceptibilities of clinical isolates between 2004 and 2006 in Japan. In Y. Arakawa (ed.), Report of Research Project on Bacterial Drug Resistance. Japanese Ministry of Health Labor and Welfare, Tokyo, Japan.
  • 23.Pai, H., J.-W. Kim, J. Kim, J. H. Lee, K. W. Choe, and N. Gotoh. 2001. Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 45:480-484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Quinn, J. P., E. J. Dudek, C. A. di Vincenzo, D. A. Lucks, and S. A. Lerner. 1986. Emergence of resistance to imipenem during therapy for Pseudomonas aeruginosa infections. J. Infect. Dis. 154:289-294. [DOI] [PubMed] [Google Scholar]
  • 25.Sakyo, S., K. Tanimoto, S. Fujimoto, and Y. Ike. 1997. Carbapenem-induced resistance in Pseudomonas aeruginosa clinical strains to carbapenems including S4661, meropenem and imipenem, abstr. F-215, p. 183. Abstr. 37th Intersci. Conf. Antimicrob. Agents Chemother.
  • 26.Sakyo, S., H. Tomita, K. Tanimoto, S. Fujimoto, and Y. Ike. 2006. Potency of carbapenems for the prevention of carbapenem-resistant mutants of Pseudomonas aeruginosa. J. Antibiot. 59:220-228. [DOI] [PubMed] [Google Scholar]
  • 27.Shimojima, M. 2007. Bacterial drug susceptibilities of clinical isolates between April 2006 and March 2007 in Japan. Med. Consult. New Remedies 43:697-753. (In Japanese.) [Google Scholar]
  • 28.Somolinos, N., R. Arranz, M. C. Del Rey, and M. L. Jimenez. 1992. Superinfections by Escherichia coli resistant to fluoroquinolones in immunocompromised patients. J. Antimicrob. Chermother. 30:730-731. [DOI] [PubMed] [Google Scholar]
  • 29.Spratt, B. G. 1977. Properties of the penicillin-binding proteins of Escherichia coli K12. Eur. J. Biochem. 72:341-352. [DOI] [PubMed] [Google Scholar]
  • 30.Talbot, G. H., P. A. Cassileth, L. Paradiso, R. Correa-Coronas, L. Bond, and The Enoxacin Prophylaxis Study Group. 1993. Oral enoxacin for infection prevention in adults with acute nonlymphocytic leukemia. Antimicrob. Agents Chemother. 37:474-482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tanaka, K., and H. Takahashi. 1991. Cloning and analysis of the gene (rpoDA) for the principal σ factor of Pseudomonas aeruginosa. Biochim. Biophys. Acta 1089:113-119. [DOI] [PubMed] [Google Scholar]
  • 32.Trias, J., J. Dufresne, R. C. Levesque, and H. Nikaido. 1989. Decreased outer membrane permeability in imipenem-resistant mutants of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 33:1201-1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Trias, J., and H. Nikaido. 1990. Outer membrane protein D2 catalyzes facilitated diffusion of carbapenems and penems through the outer membrane of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 34:52-57. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES