On the Mechanism of Quinol Oxidation at the Q_P Site in the Cytochrome bc₁ Complex

Abstract

To elucidate the mechanism of bifurcated oxidation of quinol in the cytochrome bc₁ complex, Rhodobacter sphaeroides mutants, H198N and H111N, lacking heme b_L and heme b_H, respectively, were constructed and characterized. Purified mutant complexes have the same subunit composition as that of the wild-type complex, but have only 9-11% of the electron transfer activity, which is sensitive to stigmatellin or myxothiazol. The E_m values for hemes b_L and b_H in the H111N and H198N complexes are -95 and -35 mV, respectively. The pseudo first-order reduction rate constants for hemes b_L and b_H in H111N and H198N, by ubiquiniol, are 16.3 and 12.4 s^-1, respectively. These indicate that the Q_p site in the H111N mutant complex is similar to that in the wild-type complex. Pre-steady state reduction rates of heme c₁ by these two mutant complexes decrease to a similar extent of their activity, suggesting that the decrease in electron transfer activity is due to impairment of movement of the head domain of reduced iron-sulfur protein, caused by disruption of electron transfer from heme b_L to heme b_H. Both mutant complexes produce as much superoxide as does antimycin A-treated wild-type complex. Ascorbate eliminates all superoxide generating activity in the intact or antimycin inhibited wild-type or mutant complexes.

The cytochrome bc₁ complex, also known as complex III or ubiquinol-cytochrome c oxidoreductase, is an essential segment of the electron transfer chain in mitochondria and photosynthetic bacteria (1). The complex catalyzes electron transfer from quinol to cytochrome c (c₂ in some bacteria) with concomitant translocation of protons across the inner membrane of mitochondria or cytoplasmic membrane of bacteria. Intensive biochemical and biophysical studies on this complex (2-4) have led to the formulation of the “protonmotive Q-cycle” mechanism for electron and proton transfer in this complex (5-7). The key step of the Q-cycle mechanism is the bifurcated oxidation of quinol at the quinol oxidation site (Q_P). In the Q-cycle mechanism, it was postulated that the first electron of quinol is transferred to the “high potential chain,” consisting of iron-sulfur protein (ISP)2 and cytochrome c₁. Then the second electron of quinol, via a transient semiquinone, is passed through the “low potential chain” consisting of cytochromes b_L and b_H, to reduce ubiquinone or ubisemiquinone bound at the quinol reduction site (Q_N). One drawback of this sequential scheme is the lack of a “functional” semiquinone at the Q_P site (8-10), even though some radicals have been reported under abnormal conditions (11, 12). Recently, pre-steady state kinetic analysis of the reduction of cytochrome b_L and ISP in a same sample using fast quenching coupled with EPR (13) indicates that both iron-sulfur cluster (ISC) and heme b_L are reduced by quinol at the same rate, suggesting a concerted scheme for the bifurcated oxidation of quinol at the Q_P site (13, 14).

Although the concerted mechanism explains why the proposed semiquinone at the Q_P site is not detected (13), the proponents of sequential mechanism argue that similar reduction rates observed in heme b_L and ISC is due to the low (60 μs) time resolution of the instrument used. They attribute the missing semiquinone to its low stability and the fast electron transfer to heme b_L (15). One way to confirm the existence of semiquinone at the Q_P site is using a mutant complex lacking heme b_L. If the sequential mechanism exists, one should expect to see some Q_p site semiquinone in this mutant complex, due to the lack of its electron acceptor, heme b_L.

The first cytochrome bc₁ complex crystallographic structure from bovine heart mitochondria was reported in 1997 (16). Since then, more x-ray crystallographic structures of bc₁ complexes from different species have become available (17-20). Based on the poor electron density of ISP and the larger than expected distance between ISC and heme c₁ in the first crystallographic structure, a need for head domain movement and flexibility of the neck region of ISP were proposed (16-18) and confirmed experimentally (21-27). The head domain of ISP is considered to have two docking positions: b-position and c₁-position (17). Reduction of ISP by quinol takes place when the head domain of ISP is located at the b-position. It then moves to the c₁-position to reduce cytochrome c₁. Although few investigators question the requirement for movement of the ISP head domain during bc₁ catalysis (17, 21-27), there is no consensus for what the driving force for this movement is (8, 13, 28-31).

One proposed mechanism suggests that movement of reduced ISP head domain from the b-to c₁-position is regulated by protein conformational changes induced by electron transfer from heme b_L to heme b_H (13, 31). Recent results (32, 33) of analyses of the binding affinity and inhibitory efficacies of P_m and P_f inhibitors, at different redox states of the cytochrome bc₁ complex, are consistent with this proposal. One way to further substantiate this proposal is to determine the electron transfer activity and pre-steady state reduction rates of hemes c₁, b_L, and b_H, by quinol, in the presence and absence of inhibitors, in mutant complexes lacking heme b_L or heme b_H and compared with those obtained from the wild-type complex. If this proposal is correct, one would expect to see a decrease in electron transfer activity and the rate of heme c₁ reduction in b_H and b_L knock-out mutant complexes.

Formation of superoxide anion is a well established side reaction during the oxidation of quinol by cytochrome bc₁ complex. Addition of antimycin to the intact bc₁ complex increases superoxide production (34-36). The electron leakage (or superoxide production) site can be at the semiquinone (37) of the Q_p site or reduced heme b_L (34, 38), depending on the mechanism by which bifurcation of ubiquinol proceeds. If bifurcation of quinol at the Q_p site proceeds by the sequential mechanism, semiquinone formed at the Q_P site and reduced heme b_L would both be the electron leakage sites during bc₁ catalysis. Thus, one would expect to see at least some increase in superoxide production in the mutant complex lacking heme b_L, due to the possible increase of semiquinone. If bifurcation of ubiquinol at the Q_p site proceeds by the concerted mechanism, reduced heme b_L would be the only electron leakage site, because there will be no semiquinone at the Q_P site during bc₁ catalysis.

The mechanism for superoxide production by the bc₁ complex is unclear. Comparing superoxide production by wild-type and mutant complexes lacking either heme b_L or heme b_H, under various conditions, should provide insight into the superoxide production mechanism.

Herein we report detailed procedures for generating Rhodobacter sphaeroides mutants expressing cytochrome bc₁ complex lacking either heme b_L (H198N) or heme b_H (H111N), purifying cytochrome bc₁ complexes from intra-cytoplasmic membranes (ICM) of both mutants, and characterizing the purified mutant complexes in subunit composition, electron transfer activity, absorption spectral properties, redox protential, presteady state reduction kinetics of hemes (b_L, b_H, and c₁), and superoxide production of purified complexes.

EXPERIMENTAL PROCEDURES

Materials—Cytochrome c (horse heart, type III), stigmatellin, myxothiazol, antimycin A, and xanthine oxidase were purchased from Sigma. n-Dodecyl-β-d-maltopyranoside (DM) and n-octyl-β-d-glucopyranoside were from Anatrace. Proteinase K was purchased from Invitrogen. Nickel-nitrilotriacetic acid gel and a Qiaprep spin Miniprep kit were from Qiagen. 2-Methyl-6-(4-methoxyphenyl)-3,7-dihydroimidazol[1,2-α]pyrazin-3-one, hydrochloride (MCLA) was from Molecular Probes, Inc. 2,3-Dimethoxy-5-methyl-6-(10-bromodecyl)-1,4-benzoquinol (Q₀C₁₀BrH₂) was prepared as reported previously (39). All other chemicals were of the highest purity commercially available.

Generation of R. sphaeroides Cytochrome bc₁ Mutants—Mutations were constructed by the QuikChange site-directed mutagenesis kit from Stratagene using a supercoiled doublestranded pGEM7Zf(+)-fbcB as template. Forward and reverse primers were used for PCR amplification (Table 1). The pGEM7Zf(+)-fbcB plasmid (40) was constructed by ligating the NsiI-XbaI fragment from pRKDfbcFBC_6HQ into NsiI and XbaI sites of the pGEM7Zf(+) plasmid. The NsiI-XbaI fragment from the pGEM7Zf(+)-fbcB_m plasmid was ligated into the NsiI and XbaI sites of the pRKD418-fbcFB_KmC_6HQ plasmid to generate the pRKD418-fbcFB_mC_6HQ plasmid. A plate-mating procedure (41) was used to mobilize the pRKD418-fbcFB_mC_6HQ plasmid in Escherichia coli S17 cells into R. sphaeroides BC17 cells. The presence of engineered mutations was confirmed by DNA sequencing of the NsiI-XbaI fragment as previously reported (41). DNA primers were purchased from Invitrogen. DNA sequencing was performed by the Recombinant DNA/Protein Core Facility at Oklahoma State University.

TABLE 1.

Oligonucleotides used for site-directed mutagenesis

The underlined bases correspond to the genetic codes for the amino acid(s) to be mutated.

	Sequence
H198N(F)a	CGGTTCTTCTCGCTGAACTACCTGCTGCCCTTCG
H198N(R)	CGAAGGGCAGCAGGTAGTTCAGCGAGAAGAACCG
H111N(F)	CGCGGTCTATCTGAACATCTTCCGCGGCCTC
H111N(R)	GAGGCCGCGGAAGATGTTCAGATAGACCGCG

^aF and R in parentheses denote forward and reverse primers, respectively.

Enzyme Preparations and Activity Assays—Chromatophores, intracytoplasmic membrane, and the His₆-tagged cytochrome bc₁ complexes were prepared as previously reported (21). To assay cytochrome bc₁ complex activity, chromatophores or purified cytochrome bc₁ complexes were diluted with 50 mm Tris-Cl, pH 8.0, containing 200 mm NaCl and 0.01% DM to a final concentration of cytochrome c₁ of 1 μm. Appropriate amounts of the diluted samples were added to 1 ml of assay mixture containing 100 mm Na⁺/K⁺ phosphate buffer, pH 7.4, 300 μm EDTA, 100 μm cytochrome c, and 25 μm Q₀C₁₀BrH₂. Activities were determined by measuring the reduction of cytochrome c (the increase of absorbance at 550 nm) in a Shimadzu UV 2401 PC spectrophotometer at 23 °C, using a millimolar extinction coefficient of 18.5 for calculation. The non-enzymatic oxidation of Q₀C₁₀BrH₂, determined under the same conditions in the absence of enzyme, was subtracted from the assay.

Determination of Heme Content in bc₁ Complexes—To determine the concentrations of hemes c₁ and b in wild-type and mutant complexes of H111N and H198N, purified cytochrome bc₁ samples were diluted to a concentration of 5 μm cytochrome c₁ in 1.0 ml of aqueous solution containing 200 mm NaOH and 40% pyridine. An appropriate amount of K₃Fe(CN)₆ was added to assure bc₁ complexes were fully oxidized. Spectra of oxidized bc₁ samples were recorded in a Shimadzu UV-2401 PC spectrophotometer at 23 °C. Solid sodium dithionite (a few grains) was then added, and several successive spectra of the reduced pyridine hemochromes were recorded (every 20 s) until there were no significant differences between two consecutive spectra. Table 2 lists the extinction coefficients (42) of pyridine hemochromes used to calculate the concentration of hemes b and c₁. To calculate the concentration of hemes b and c₁ in a bc₁ sample, the equation pair below was employed. In these equations ε stands for the extinction coefficient. The subscript numbers of ε indicate the corresponding wavelengths. C stands for concentration.

TABLE 2.

Difference of millimolar extinction coefficients of reduced pyridine hemochromogen of hemes b and c₁ at the selected wavelengths

Hemochromogen
Heme c1	21.13	4.28
Heme b	9.98	32.86

Potentiometric Titrations of the Cytochrome b of Mutant Cytochrome bc₁ Complexes—Redox titrations of cytochromes b in wild-type and mutant bc₁ complexes were essentially according to the published method (43, 44). 3-ml aliquots of the bc₁ complex (2 μm cytochrome b) in 0.1 m Na⁺/K⁺ phosphate buffer, pH 7.0, containing 25 μm 1,4-benzoquinone (E_m, 293 mV), 2,3,5,6-tetramethyl-p-phenylenediamine (E_m, 260 mV), 1,2-naphthoquinone (E_m, 143 mV), phenazine methosulfate (E_m, 80 mV), phenazine ethosulfate (E_m, 55 mV), 1,4-naphthoquinone (E_m, 36 mV), duroquinone (E_m, 5 mV), pyocyanine (E_m, -34 mV), indigo carmine (E_m, -125 mV), and anthraquinone-2-sulfonic acid (E_m, -225 mV) were used. Reductive titrations were carried out by addition of sodium dithionite solution to the ferricyanide-oxidized samples and oxidative titrations by addition of ferricyanide solution to the dithionite-reduced samples. At indicated E_h values during the redox titration, absorption spectra from 600 to 500 nm were taken. The optical absorbance at 560 nm, minus that at 580 nm, was used for determination of cytochrome b reduction. Midpoint potentials of cytochrome b_L and b_H were calculated by fitting the redox titration data, using the Nernst equation for a one-electron carrier (n = 1), by Kaleidagraph (44).

Fast Kinetics Study—To determine electron transfer rates between the quinol and heme b or heme c₁, the cytochrome bc₁ complex was mixed with ubiquinol (Q₀C₁₀BrH₂) in equal volume at room temperature in an Applied Photophysics stopped-flow reaction analyzer SX.18MV (Leatherhead, United Kingdom). The concentration of bc₁ complex was 12 μm (based on cytochrome c₁) in 50 mm Tris-Cl, pH 8.0, at 4 °C, containing 200 mm NaCl and 0.01% DM. For use in the stopped-flow, Q₀C₁₀BrH₂ in ethanol was diluted to 240 μm in the same buffer. Reductions of cytochrome b and cytochrome c₁ in wild-type were monitored by the increase of absorption difference of A_560-580 and A_551-539, respectively, with a photodiode array scan between 600 and 500 nm. Reductions of cytochrome b_L in H111N and b_H in H198N were determined from the increase in A_565-580 and A_560-580. When an inhibitor was used, the cytochrome bc₁ complex was treated with 5-fold molar excess of inhibitor over heme c₁, for 5 min at 4 °C, prior to the experiment. Because the concentration of ubiquinol used was 20 times higher than that of the cytochrome bc₁ complex, the reactions between bc₁ and quinol were treated as pseudo first-order reactions. Time traces of the reaction were fitted with a first-order rate equation to obtain the pseudo first rate constants k₁ by Kaleidagraph.

Detection of Q Radical at the Q_P Site with EPR—300 μl of 150 μm purified cytochrome bc₁ complexes were treated with 10-fold excess of ubiquinol to fully reduce cytochrome c₁ in 10 s and frozen in liquid nitrogen. EPR spectra were recorded at -170 °C with the following instrument settings: microwave frequency, 9.4 GHz; microwave power, 2.2 milliwatts; modulation amplitudes, 6.3 G; modulation frequency, 100 kHz; time constant, 655.4 ms; sweep time, 167.8 s; conversion time, 163.8 ms.

Determination of Superoxide Production—Superoxide anion generation was determined by measuring the chemiluminescence of the MCLA- adduct (45), in an Applied Photophysics stopped-flow reaction analyzer SX.18MV (Leatherhead, United Kingdom), by leaving the excitation light off and registering light emission (46, 47). Reactions were carried out at 23 °C by mixing 1:1 solutions A and B. Solution A contained 100 mm Na⁺/K⁺ phosphate buffer, pH 7.4, 1 mm EDTA, 1 mm KCN, 1 mm NaN₃, 0.1% bovine serum albumin, 0.01% DM, and 5.0 μm wild-type or mutant bc₁ complex. Solution B was the same as A with the bc₁ complex being replaced with 125 μm Q₀C₁₀BrH₂ and 4 μm MCLA. Once the reaction starts, the produced chemiluminescence in voltage was consecutively monitored for 2 s.

RESULTS AND DISCUSSION

Characterization of Mutants Lacking Either Heme b_L (H198N) or Heme b_H (H111N)—In the cytochrome b subunit of cytochrome bc₁ complex from the R. sphaeroides, His⁹⁷ and His¹⁹⁸ are the ligands of heme b_L, whereas His¹¹¹ and His²¹² are the ligands of heme b_H. Two mutants, H198N and H111N, in which histidine 198 and histidine 111 of cytochrome b were, respectively, substituted with Asn were constructed and selected for the present study. The H198N mutant knocks out heme b_L, whereas the H111N mutant knocks out heme b_H. Because the cytochrome bc₁ complex is absolutely required for photosynthetic growth of this bacterium, and hemes b_L and b_H constitute the low potential electron transfer chain in the proposed Q-cycle mechanism, it is important to see whether or not these two mutants can support photosynthetic growth. Cultures of wild-type and mutants were placed in a light tank after 4 h of dark grow. Photosynthetic growth was followed by the increase of cell intensity. None of the mutants show any evidence of growth in 6-8 days. To grow cells for the preparation of mutated bc₁ complexes, H198N and H111N were grown semi-aerobically. These two mutants can grow semiaerobically at a rate comparable with that of the wild-type cells. ICM were prepared from semiaerobically grown cells and used for preparation of corresponding mutant complexes.

ICMs prepared from mutants H198N and H111N contain subunits cytochrome b, cytochrome c₁, ISP, and subunit IV in the same concentrations as those detected in the wild-type ICM, determined by Western blot using antibodies against these four individual proteins. This result indicates that lacking heme b_L in the H198N mutant and lacking heme b_H in the H111N mutant does not impair the complex assembly into the ICM membrane. This finding is contradictory to the previous report (48) that ICMs from mutants lacking heme b_H (H111N, H111D, and H212D) have subunits of cytochromes b and c₁, whereas no such subunits were detected in ICMs from mutants lacking heme b_L (H97N, H97D, H198N, and H198Y). While constructing mutants lacking heme b_L or heme b_H we observed that some heme b_L knocked out mutants, such as H97F and H97N, are unstable, purification attempts were not successful. The structural stability of H198N and H111N mutant complexes in their ICMs enables us to purify and characterize these two mutant complexes with methods similar to those used for the wild-type complex.

Fig. 1 compares SDS-PAGE patterns of purified wild-type and mutant cytochrome bc₁ complexes. The purification procedure involves DM solubilization followed by nickel-affinity gel column chromatography (21). The yields and subunit compositions of purified mutant complexes are comparable with those of the wild-type.

FIGURE 1.

SDS-PAGE of purified cytochrome bc₁ complexes from wild-type and mutants H198N and H111N. Lanes 1-4 are for polypeptide standard, wild-type, mutant H198N, and mutant H111N, respectively. Aliquots of purified bc₁ complexes were incubated with 1% SDS and 0.4% β-mercaptoethanol at 37 °C for 20 min. Digested samples containing about 200 pmol of cytochrome c₁ were subjected to electrophoresis. The molecular masses of standard polypeptides are: 10, 15, 20, 25, 30, 40, 50 and 60 kDa.

Fig. 2 shows absorption spectra of purified wild-type (A) and mutant complexes of H198N (B) and H111N (C). The presence of cytochromes b_H and b_L in the wild-type complex is revealed by a difference spectrum of dithionite-partially reduced minus ascorbate reduced and a difference spectrum of dithionite-fully reduced minus dithionite-partially reduced, respectively (49). If a catalytic amount of succinate-Q reductase is added to a purified wild-type complex, b_H is observed from a difference spectrum of succinate-reduced minus ascorbate-reduced and b_L from a difference spectrum of dithionite-reduced minus succinate-reduced (50). Ascorbate reduces cytochrome c₁; succinate reduces cytochromes c₁ and b_H; dithionite reduces cytochromes c₁, b_H, and b_L. Cytochrome b_H has an α absorption peak at 560 nm, whereas cytochrome b_L has a double-α peak with absorption at 565 nm and a shoulder at 558 nm (see Fig. 2A). The α absorption peak of cytochrome b in the H198N mutant complex (Fig. 2B), which is obtained from a difference spectrum of dithionite-reduced minus ascorbate-reduced, is at 560 nm, indicating that only cytochrome b_H is present in this mutant complex. The α peak of cytochrome b in the H111N mutant complex is at 565 nm with a shoulder at 558 nm (Fig. 2C), indicating that only cytochrome b_L is present in this mutant complex.

FIGURE 2.

Absorption spectra of wild-type and mutant bc₁ complexes. A-C are for the wild-type (WT), mutants H198N and H111N complexes, respectively. The cytochrome c₁ concentration of complexes used was 1 μm for A, 1.5 μm for B and C. The gray spectrum stands for ascorbate-reduced sample; and black solid spectrum for the dithionite-fully reduced sample. The black dotted and black dot-dash spectra in B and C, respectively, are difference spectra of the dithionite-fully reduced minus ascorbate reduced samples. Black dotted and black dot-dash spectra in A are the difference spectra of the dithionite-partially reduced (∼-50 mV) minus ascorbate reduced and of the dithionite-fully reduced minus the dithionite-partially reduced, respectively.

To detect the presence of trace amounts of other cytochrome b in a given mutant, the complex was titrated with dithionite solution to reduce cytochromes b gradually (data not shown). In the mutant H198N complex, the last reduced heme b showed a heme b_H absorption spectrum, the same as that of the very first reduced one, suggesting that the H198N mutant complex contains only heme b_H. If there is some heme b_L in this mutant complex, the difference spectrum of the last dithionite reduced minus the second to last dithionite reduced should differ from that of the first dithionite reduced minus ascorbate reduced, because heme b_L is expected to be reduced last due to its low redox potential. In the H111N mutant complex, the difference spectrum of the first dithionite reduced minus ascorbate reduced is the same as the difference spectrum obtained from the last dithionite reduced minus the second to the last dithionite reduced. These two difference absorption spectra are identical to those of heme b_L in the wild-type complex, suggesting that the H111N mutant complex contains only heme b_L.

In general, for bc₁ complexes, hemes b, including heme b_L and b_H, are calculated from the difference extinction coefficient of 28.5/mm·cm between 560 and 580 nm in the difference spectrum of dithionite reduced minus ascorbate reduced samples. The heme c₁ is calculated from a difference spectrum of ascorbate reduced minus ferricyanide-oxidized complex using a difference extinction coefficient of 17.5/mm·cm between 551 and 539 nm. Because the extinction coefficient of individual heme b_L and heme b_H is not firmly established, we used the alkaline pyridine hemochromogen spectrum to determine the concentrations of hemes b and c₁ in mutant complexes of H198N and H111N. The equations used for calculation are listed under “Experimental Procedures.” In the wild-type bc₁ complex the b/c₁ molar ratio is about 1.65. In mutant complexes of H198N and H111N, b/c₁ molar ratios are close to 1.0 (see Table 3). Based on the heme b contents determined by pyridine hemochrome and the difference absorption spectra of dithionite reduced minus ascorbate reduced mutant complexes, the difference extinction coefficients for hemes b_L and b_H were calculated to be 12.0/mm·cm between 565 and 580 nm and 24.5/mm·cm between 560 and 580 nm, respectively. The lower than expected b/c₁ ratio in the wild-type complex is probably due to the presence of excess cytochrome c₁ in the complex, as the His tag is located at the C terminus of cytochrome c₁ protein. The presence of excess cytochrome c₁ in the wild-type complex was confirmed by protein crystallization (51, 52). In the crystalline bc₁ complex, the b/c₁ molar ratio is 2. The excess cytochrome c₁ is found in the mother liquid after crystallization.

TABLE 3.

Characterization of mutant H198N and H111N bc₁ complexes

	Wild-type	H198N	H111N
Photosynthetic growth	Yes	No	No
Cytochrome b/cytochrome c1 ratio	1.65	1.0	0.98
Specific activitya	3.5	0.4	0.32
Antimycin sensitivity	Yes	36.4%b	No
Stigmatellin sensitivity	Yes	Yes	Yes
Myxothiazol sensitivity	Yes	Yes	Yes

^aThe unit of specific activity is μmol of cytochrome c reduced/min/nmol of cytochrome c₁.

^bThe 36.4% means the loss of 36.4% of its bc₁ activity upon antimycin treatment.

Effect of Mutations on the Electron Transfer Activity and the Redox Potential of b Hemes—Specific activities of purified mutant complexes were determined and compared with the wild-type complex. Mutant complexes of H198N and H111N have low bc₁ activities, about 9-11% of that in the wild-type complex (Table 3). The bc₁ activity detected in these two mutant complexes is inhibited by stigmatellin and myxothiazol, indicating ubiquinol can bind and be oxidized at the Q_P site in both complexes. As expected, the H111N mutant complex is completely resistant to antimycin. However, it is somewhat surprising that H198N is partially sensitive to antimycin.

To see if these substitutions have any effect on the E_m of heme b_L or heme b_H, E_m values of heme b_L and b_H in mutants H111N and H198N were determined, respectively. As shown in Fig. 3, heme b_H in the H198N mutant complex has an E_m of -35 mV, significantly lower than the E_m of heme b_H in the wild-type complex (50 mV). The E_m of heme b_L in the H111N mutant complex is -95 mV, comparable with that in the wild-type complex (-93 mV). However, this value is lower than that reported by others (48) using ICM of the same mutant. Thus the substitution in mutant H198N has some effect on the E_m of heme b_H, whereas the substitution in mutant H111N has little effect on the E_m of heme b_L. These results seem contradictory to the columbic interaction between hemes b_L and b_H reported in the literature (15, 48).

FIGURE 3.

Redox potential titration of heme b in wild-type (A), H198N (B), and H111N (C) mutant cytochrome bc₁ complexes. Oxidative and reductive titrations were performed using potassium ferricyanide and sodium dithionite, respectively, as described under “Experimental Procedures.”

Effect of Mutations on the Rate of Heme c₁ Reduction by Quinol—The loss of heme b_L and heme b_H in the mutant complexes of H198N and H111N, respectively, provides us an opportunity to study the effect of the low potential chain on c₁ reduction and movement of the ISP head domain. The fast-kinetics study is carried out on the stop-flow instrument of Applied Photophysics Ltd. Fig. 4 shows the time traces of heme c₁ reduction, for 1.2 s, in wild-type and mutant complexes of H198N and H111N. Heme c₁ reduction rates in the two mutant complexes are much lower than that in the wild-type complex. Assuming heme c₁ reduction is a pseudo first-order reaction, the k₁ values are determined to be 11.6, 1.7, and 1.4 s^-1 for the wild-type and mutant complexes of H198N and H111N, respectively. The heme c₁ reduction rates in the H198N and H111N mutant complexes are only about 15-12% of that in the wild-type complex. Despite of low reduction rates of heme c₁ in the two mutant complexes, maximum levels of heme c₁ reduction are the same as that of the wild-type complex. 50% of the total heme c₁ is reduced by ubiquinol as reported (53). Because the Q_P sites in the H198N and H111 mutant complexes are similar to that in the wild-type complex, as both mutant complexes are sensitive to stigmatellin and myxothiazol (the Q_P site inhibitor), the decrease in rate of heme c₁ reduction is not due to the initial bifurcated oxidation of quinol. Likely, this decrease results from impairment of movement of the head domain of reduced ISP, from the b-position to c₁-position, caused by disruption of electron transfer from heme b_L to heme b_H in these mutant complexes.

FIGURE 4.

Time trace of heme c₁ reduction by Q₀C₁₀BrH₂ in wild-type (WT) and mutant complexes. Experiments were performed with the Applied Photophysics stopped-flow reaction analyzer SX 18MV. Reactions and measurements were performed as described under “Experimental Procedures.” The final concentrations of complexes and Q₀C₁₀BrH₂ were 6 and 120 μm, respectively. Solid lines represent fitted curves.

Fig. 5 shows the effect of antimycin A and stigmatellin on the reduction rates of heme c₁ in the wild-type and mutant complexes. Antimycin A is a Q_N site inhibitor and stigmatellin is a Q_P site inhibitor. In the wild-type complex antimycin A decreases heme c₁ reduction pseudo first-order rate constant from 11.6 to 4.7 s^-1 (Fig. 5A). This is consistent with the previous report (14) that antimycin A has a significant effect on the reduction rate of heme c₁ in cytochrome bc₁ complexes. In the H198N mutant complex, the rate constant decreases from 1.7 to 1.1 s^-1. In the H111N mutant complex, the rate constant decreases from 1.4 to 1.0 s^-1. Because both mutant complexes, in which no intact low potential chain is available, also show a decreased rate of heme c₁ reduction in the presence of antimycin A, similar to that observed in the wild-type complex, this inhibitor effect cannot be due to blocking of electron transfer in the low potential chain. It is probably due to the long range effect of antimycin on the Q_p site binding to the Q_N site. In other words, the effect of antimycin A on the heme c₁ reduction rate is not through the low potential redox component but through the cytochrome b protein subunit.

FIGURE 5.

Time trace of cytochrome c₁ reduction by Q₀C₁₀BrH₂ in the wild-type (A) and mutants H198N (B) and H111N (C) complexes in the presence of inhibitors. Experimental conditions were the same as that in Fig. 4 except for the presence of inhibitors. Solid lines represent fitted curves.

Addition of stigmatellin to the wild-type and mutant complexes abolishes heme c₁ reduction. These results further confirm that the Q_P site in these two mutant complexes is functional.

Effect of Mutations on the Rates of Heme b_L and Heme b_H Reductions by Quinol—Fig. 6 shows hemes b reduction by quinol, in the presence and absence of antimycin and stigmatellin, in wild-type and mutant bc₁ complexes. In the H198N mutant complex (Fig. 6B), a small portion of heme b_H is reduced by quinol, in the absence of inhibitors, and the reduction is biphasic. The rate constants for the fast and slow reduction phases are 12.4 and 0.86 s^-1, respectively. Fast phase reduction is abolished when antimycin is present. As expected, the presence of stigmatellin has little effect because heme b_H is reduced by quinol through the Q_N site, not the Q_P site.

FIGURE 6.

Time trace of cytochrome b reduction by Q₀C₁₀BrH₂ in wild-type (A) and H198N (B) and H111N (C) mutant complexes. Reactions and measurements were performed as described under “Experimental Procedures.” The reaction was monitored by photodiode array scanning for 1.26 s. Reductions of cytochromes b_L and b_H, were determined from the increase in A_565-580 and A_560-580. Cytochrome b (including b_L and b_H) was determined from the increase in A_560-580.

In the H111N mutant complex (Fig. 6C), a small portion of heme b_L is rapidly reduced by quinol, in the absence of inhibitors, with a reduction rate constant of about 16.3 s^-1, followed by a slow reoxidation. It is likely that the reoxidation of heme b_L will lead to superoxide formation. The slower decay rate of superoxide formed in the H111N complex as compared with that formed in the H198N complex, as will be described in Fig. 8, B and C, supports this speculation. Addition of stigmatellin abolishes this reduction. Addition of antimycin affects the rate and extent of heme b_L reduction: the rate constant decreases from 16.3 to 11.1 s^-1 and the extent of b_L reduction decreases by 30%. In the wild-type complex antimycin also affects both the rate and extent of heme b reduction by quinol (see Fig. 6A): it decreases the rate but increases the extent (14, 54-58). It should be noted that heme b reduction observed in the wild-type complex, in the absence of inhibitor, is mostly heme b_H. The input of electron for reduction could come from the Q_p site via heme b_L, and less likely, directly from quinol at the Q_N site, because the reduction rate of heme b_L (k₁ = 16.3 s^-1) is larger than that of heme b_H (k₁ = 12.4 s^-1) (Fig. 6, B and C). These results seem contradictory to a report indicating that the rate of heme b_H reduction is larger than that of heme b_L in the yeast cytochrome bc₁ complex (59). The observation that the reduction rate of heme b_L in the H111N mutant complex is similar to, albeit higher than, that of the wild-type complex (see Fig. 6A) indicates that the Q_P site in this mutant complex is functional. This finding further supports the idea that antimycin has a long range effect on the Q_p site to decrease the rates of heme c₁ and heme b_L reduction.

FIGURE 8.

Superoxide production of wild-type and mutant H198N and H111N cytochrome bc₁ complexes. Superoxide production was measured as described under “Experimental Procedures.” Red tracings represent complexes without any treatment. Blue and black tracings are for complexes with antimycin, and ascorbate treatment, respectively.

Attempt to Detect Q Radical at the Q_P Site with Mutant H198N—Because H198N has no heme b_L, and thus no electron acceptor for semiquinone, more semiquinone radical would have increased if the sequential mechanism for bifurcated quinol oxidation is functioning. Fig. 7 shows EPR spectra from wild-type and mutant bc₁ complexes. In the absence of antimycin a strong signal at g = 2.00 is observed in the quinol-reduced cytochrome bc₁ complexes from wild-type (Fig. 7A, curve 1) and mutant H198N (Fig. 7B, curve 1). This signal decreases significantly when antimycin is added (Fig. 7, A and B, curve 2). Apparently the portion of signal that disappears (Fig. 7, A and B, curve 4) is the signal of semiquinone radical at the Q_N site. However, the signal portion that is insensitive to antimycin is not the long missing semiquinone at the Q_P site, because it is also present in fully oxidized complexes of wild-type and mutant H198N (Fig. 7, A and B, curve 3). It should be noted that this free radical, of unknown origin, is much more concentrated in the H198N complex than in the wild-type complex. Its origin is currently under investigation.

FIGURE 7.

EPR spectra of ISP and free radical (semiquinone) under different conditions. Purified wild-type (WT) (A), H198N (B), and H111N (C) bc₁ complexes were treated with 10-fold excess of Q₀C₁₀BrH₂ solution, to fully reduce cytochrome c₁, and frozen in liquid nitrogen. EPR spectra were recorded at -170 °C with the following instrument settings: microwave frequency, 9.4 GHz; microwave power, 2.2 milliwatts; modulation amplitudes, 6.3 G; modulation frequency, 100 kHz; time constant, 655.4 ms; sweep time, 167.8 s; conversion time, 163.8 ms. Curve 1 is the spectrum for cytochrome bc₁ complexes reduced by Q₀C₁₀BrH₂; curve 2 for those reduced by Q₀C₁₀BrH₂ in the presence of antimycin; curve 3 for ferricyanide-oxidized cytochrome bc₁ complexes; curve 4 for the spectrum derived from curve 1 minus curve 2. The absence of signals of reduced ISP defines the fully oxidized state of the complex. For mutant H111N, the signal intensities were reduced to one-third to fit in the figure.

The EPR spectra for mutant H111N bc₁ complex (Fig. 7C) were also determined. Oxidized H111N has an unusual EPR spectrum that is not due to contamination. This spectrum appears to be a characteristic of mutants lacking heme b_H, because another heme b_H-deficient mutant, H212N, has a similar EPR spectrum (data not shown). The concentrations of ISP in all three complexes were about the same, as indicated by the g = 1.89 signal. The g = 1.89 signal in Fig. 7C looks smaller because the intensity of the spectrum was reduced to one-third of the original to compare the signals in the g = 2.00 region, of the three complexes.

Superoxide Production in Mutant bc₁ Complexes during Catalysis—Because there is no heme b_L in the H198N and no heme b_H in the H111N, it should be easier for oxygen to get electrons, from either semiquinone or the reduced heme b_L, in these mutant complexes than in the wild-type. Fig. 8 shows superoxide production by mutant and wild-type complexes under different conditions. In the absence of antimycin (red tracings), production of superoxide anion by mutant complexes of H198N (Fig. 8B) and H111N (Fig. 8C) is much greater than by the wild-type (Fig. 8A). At the point of strongest chemiluminescence output, superoxide production by H198N and H111N is about 5 times that of the wild-type complex. Antimycin significantly increases superoxide production but slightly decreases its production rate in the wild-type complex (blue tracing in Fig. 8A). Antimycin has little effect on the superoxide production in mutants H198N and H111N (blue tracings in Fig. 8, B and C). This lack of effect of antimycin on superoxide production by H198N and H111N indicates that superoxide is produced at the Q_P site, not at the Q_N site. Thus during bc₁ catalysis, oxygen can only get electrons from reduced heme b_L or from semiquione at the Q_P site.

In bc₁ complexes with fully reduced ISP and cytochrome c₁, no chemiluminescence () is observed upon the addition of quinol (black tracings in Fig. 8), indicating that superoxide production is dependent on ISP reduction by quinol. Therefore, quinol at the Q_P site transfers its first electron to ISC; the second electron, either transferred to heme b_L or retained as semiquinone, reacts with oxygen to produce superoxide. Because there is no detectable semiquinone radical at the Q_P site, molecular oxygen may share quinol electrons with ISP when heme b_L is not available. Normally reduced heme b_L may leak its electron to oxygen. This leakage increases when the low potential electron transfer chain is blocked by antimycin. Because reduction of ISC is the first reaction in both superoxide generation and cytochrome c reduction catalyzed by bc₁ complex, the similar activation energy (60) for these reactions seems reasonable, if the reduction of ISC is rate-limiting.