Genetic Tools for Studying Capnocytophaga canimorsus

Manuela Mally; Guy R Cornelis

doi:10.1128/AEM.01218-08

. 2008 Aug 22;74(20):6369–6377. doi: 10.1128/AEM.01218-08

Genetic Tools for Studying Capnocytophaga canimorsus^▿

Manuela Mally ¹, Guy R Cornelis ^1,^*

PMCID: PMC2570293 PMID: 18723653

Abstract

Capnocytophaga canimorsus, a commensal bacterium from canine oral flora, has been isolated throughout the world from severe human infections caused by dog bites. Due to the low level of evolutionary relationship to Proteobacteria, genetic methods suitable for the genus Capnocytophaga needed to be established. Here, we show that Tn4351, derived from Bacteroides fragilis, could be introduced by conjugation into C. canimorsus and conferred resistance to erythromycin. By mapping and sequencing a naturally occurring plasmid isolated from a clinical isolate of C. canimorsus, we identified a repA gene that allowed us to construct Escherichia coli-Capnocytophaga shuttle vectors. Most commonly used antibiotic markers were not functional in C. canimorsus, but cefoxitin (cfxA), tetracycline (tetQ), and erythromycin (ermF) resistances could be used as markers for plasmid maintenance in C. canimorsus and even in some other Capnocytophaga spp. Shuttle vectors were introduced into C. canimorsus either by conjugation using the origin of transfer (oriT) of RP4 or by electrotransformation. Taking advantage of the promoter of ermF, an expression vector was constructed. Finally, a method that allows site-directed mutagenesis is described. All these genetic tools pave the way, not only for molecular studies of the pathogenesis of C. canimorsus, but also for studies of other oral Capnocytophaga species.

Capnocytophaga canimorsus is a commensal bacterium found in the oral cavities of dogs and cats. Since its discovery in a patient who had developed septicemia and meningitis after a dog bite in 1976 (4), more than 160 cases of severe human infections by C. canimorsus have been reported (33). Human infections can result in septicemia or meningitis, with mortality rates of 30% and 5%, respectively (17). Bacteria from the genus Capnocytophaga form part of the resident oral flora of humans and domestic animals (6). Seven species, including Capnocytophaga ochracea and Capnocytophaga gingivalis, are found in the normal human oral flora, whereas the dog's oral flora contains C. canimorsus and Capnocytophaga cynodegmi. In spite of this diversity, C. canimorsus is the only Capnocytophaga species that has been associated with severe human infections. Recently, we started to unravel the molecular mechanisms underlying C. canimorsus infections (22, 28), but we had to establish genetic methods adapted to this group of bacteria. The genus Capnocytophaga belongs to the family Flavobacteriaceae in the phylum Bacteroidetes. Many genetic methods that function in Proteobacteria have been shown to fail in Bacteroidetes (26), and commonly used broad-host-range plasmids did not result in ampicillin-resistant (Ap^r), tetracycline-resistant (Tc^r), or kanamycin-resistant (Km^r) colonies of Flavobacterium johnsoniae (20). However, transposons and selectable markers identified and used in Bacteroides spp. (30, 32) have been successfully adapted for the family Flavobacteriaceae (2, 19, 20).

In the present work, we describe the tools necessary to genetically manipulate Capnocytophaga spp. Taking advantage of genetic methods originating from Bacteroides spp., we established ways to introduce DNA using functional selection markers and to perform transposon mutagenesis. Finally, we identified an endogenous plasmid in a clinical isolate of C. canimorsus, and we generated the first shuttle vectors that allow plasmid replication in Capnocytophaga spp. Taken together, these tools will facilitate studies of bacteria in the genus Capnocytophaga.

MATERIALS AND METHODS

Bacterial strains, growth conditions, and selective agents.

The strains and plasmids used in this study are shown in Table 1. Escherichia coli strains were routinely grown in LB broth at 37°C. Capnocytophaga spp. were grown on plates of heart infusion agar (Difco) supplemented with 5% sheep blood (Oxoid) (SB plates) for 2 days at 37°C in the presence of 5% CO₂. Bacteria were harvested by gently scraping colonies off the agar surface, washed, and resuspended in phosphate-buffered saline (PBS). Alternatively, C. canimorsus was grown in 50 ml heart infusion broth (HIB) (Difco) supplemented with 10% (vol/vol) fetal bovine serum (FBS) (Invitrogen) for approximately 24 h without shaking in a 37°C incubator with 5% CO₂ using Erlenmeyer flasks. To select for plasmids or transposons, antibiotics were added at the following concentrations: 10 μg/ml erythromycin (Em), 10 μg/ml cefoxitin (Cf), 20 μg/ml gentamicin (Gm), 100 μg/ml Ap, 5 μg/ml Tc, 50 μg/ml Km, and 10 μg/ml chloramphenicol (Cm).

TABLE 1.

Strains and plasmids

Species and/or strain or plasmid	Genotype or description	Reference or source
Bacterial strains
E. coli
BW19851	S17-1 derivative, RP4-2-tet:Mu-1kan::Tn7 recA1 creC510 hsdR17 endA1 zbf-5 uidA::pir⁺thi; Sm^r	ATCC 47083
		21
S17-1	hsdR17 recA1 RP4-2-tet::Mu-1kan::Tn7; Sm^r	31
Top10	F⁻mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(araleu)7697 galU galK rpsL endA1 nupG; Sm^r	Invitrogen
C. canimorsus
2	Human septicemia 1989	28
3	Human septicemia 1990	28
5	Human septicemia 1995	28
5 siaC	C. canimorsus 5 siaC::Tn4351; Em^r	18
5 siaC::ermF	Site-directed mutation of siaC by replacement of an internal part by ermF; Em^r	This study
7	Human septicemia 1998	28
9	Human septicemia 1965	28
10	Human septicemia	28
11	Human septicemia	28
12	Human septicemia	28; ATCC 35979
C. cynodegmi	Dog's mouth; Virginia 1979	ATCC 49044
C. cynodegmi 2	Hand wound; United States	LMG 11538.34
C. gingivalis	Human isolate	G. Wauters, University of Louvain, Belgium
C. ochracea	Human isolate	G. Wauters, University of Louvain, Belgium
Plasmids^a
pBBR1MCS3	Broad-host-range ori from Bordetella bronchiseptica S87; Tc^r	15
pBBR1MCS4	Broad-host-range ori from B. bronchiseptica S87; Ap^r	15
pBSIIKS(+)	ColE1 ori; Ap^r	Stratagene
pCC7	Endogenous plasmid of C. canimorsus 7	This study
pCP23	ColE1 ori; (pCP1 ori); Ap^r (Tc^r); E. coli-F. johnsoniae shuttle plasmid	1
pCP29	ColE1 ori (pCP1 ori); Ap^r (Cf^r Em^r); E. coli-F. johnsoniae shuttle plasmid	14
pEP4351	pir requiring R6K oriV; RP4 oriT; Cm^r Tc^r (Em^r); vector used for Tn4351 mutagenesis	7
pK18	ColE1 ori; Km^r	23
pLYL001	ColE1 ori; Ap^r (Tc^r)	25
pLYL03	ColE1 ori; Ap^r (Em^r)	16
pMM2	pBBR ori; Ap^r; random 650-bp Sau3A chromosomal fragment of C. canimorsus 5 inserted in BamHI site of pBBR1MCS4	This study
pMM3	pBBR ori; Ap^r; random 500-bp Sau3A chromosomal fragment of C. canimorsus 5 inserted in BamHI site of pBBR1MCS4	This study
pMM5	pBBR ori; Ap^r (Em^r); ermF from pEP4351 amplified by PCR using primers 3505 and 3506 cut with EcoRI/PstI and inserted into the corresponding sites of pBBR1MCS4	This study
pMM7	ColE1 ori; Ap^r; 1.95-kb EcoRI/HindIII fragment of pCC7 inserted into corresponding sites of pBSIIKS(+)	This study
pMM12	ColE1 ori; Km^r (Cf^r); cfxA gene from pCP29 cloned as a BamHI/SpeI fragment into corresponding sites of pK18	This study
pMM13	ColE1 ori; Ap^r (Em^r); ermF from pEP4351 amplified by PCR as a 1.95-kb fragment using primers 3505 and 3506, cut with EcoRI/PstI, and inserted into the corresponding sites of pBSIIKS(+)	This study
pMM25	ColE1 ori; Km^r (Cf^r); suicide vector for C. canimorsus; RP4 oriT amplified by PCR using primers 4416 and 4417 and inserted into BamHI site of pMM12	This study
pMM40.A	ColE1 ori (pCC7 ori); Km^r (Cf^r); E. coli-C. canimorsus shuttle plasmid. The repA gene from pCC7 was amplified by PCR using primers 3601 and 4274, digested with PstI, and inserted into the corresponding site of pMM12.	This study
pMM41.A	ColE1 ori (pCC7 ori); Ap^r (Cf^r); E. coli-C. canimorsus shuttle plasmid. The cfxA and repA genes as a BamHI/SphI fragment from pMM40.A were inserted into corresponding sites of pUC19.	This study
pMM45.A	ColE1 ori (pCC7 ori); Km^r (Cf^r); E. coli-C. canimorsus shuttle plasmid, RP4 oriT; the 1.58-kb PstI fragment of pMM47.A containing repA inserted into PstI site of pMM25	This study
pMM47.A	ColE1 ori (pCC7 ori); Ap^r (Cf^r); E. coli-C. canimorsus expression shuttle plasmid. −33 and −7 of the ermF promoter were amplified from pEP4351 as a 257-bp fragment by PCR using 3868 and 4128. Unique NcoI, XhoI, and XbaI sites and six histidine codons were incorporated by reverse primer 4128. SalI/SpeI digested PCR fragment inserted into corresponding sites of pMM41.A	This study
pMM52	ColE1 ori (pCC7 ori); Ap^r (Cf^r); promoterless siaC full-length fragment inserted into NcoI/XbaI sites of pMM47.A in frame with a C-terminal His tag	18
pMM104.A	ColE1 ori (pCC7 ori); Ap^r (Tc^r); E. coli-C. canimorsus shuttle plasmid, RP4 oriT. PstI fragment of pMM47.A containing repA inserted into PstI site of pLYL001	This study
pMM105.A	ColE1 ori (pCC7 ori); Ap^r (Em^r); E. coli-C. canimorsus shuttle plasmid, RP4 oriT. PstI fragment of pMM47.A containing repA inserted into PstI site of pLYL03.	This study
pMM106	ColE1 ori; Km^r (Cf^r). To create siaC::ermF, three initial PCR products were amplified with 4783 plus 4784 and 4787 plus 4788 from C. canimorsus 5 chromosomal DNA and 4785 plus 4786 from pEP4351. siaC::ermF was then amplified by overlapping PCR using external primers 4783 and 4788, cut with PstI/SpeI, and inserted into corresponding sites of pMM25.	This study
pMR20	Tc^r derivative of pGLlO; RK2-based broad-host-range vector; IncP	12 (Chris Mohr and Rick Roberts)
pUC19	ColE1 ori; Ap^r	35

Open in a new tab

Antibiotic resistance phenotypes and other features listed in parentheses are those expressed by the secondary host (F. johnsoniae or C. canimorsus), but not by E. coli.

Conjugation.

E. coli strains BW19581 and S17-1, used for conjugative transfer of mobilizable plasmids, were grown without antibiotics to early exponential phase in LB broth. C. canimorsus, which is naturally resistant to Gm, was grown for 2 days on SB plates at 37°C and harvested by scraping. Bacteria were washed and resuspended in PBS. Donor and recipient were mixed at a 1:10 ratio, centrifuged for 2 min at 8,000 × g, and resuspended in 50 μl of PBS, and 2.2 × 10⁸ CFU were spotted on 22-μm mesh nitrocellulose filters (Millipore) laid on the surface of an SB plate. The plates were incubated overnight in 5% CO₂ at 37°C. Each filter was washed with 2 ml of HIB and 10% FBS containing Gm and kept for 1 h at room temperature, and the bacteria were diluted and plated on selective SB plates containing Gm and the appropriate antibiotic to select for plasmid or transposon transfer. The plates were incubated for 2 to 3 days.

Electroporation.

C. canimorsus was grown in HIB and 10% FBS overnight to early or mid-exponential phase without shaking, cooled to 4°C, harvested by centrifugation at 5,500 × g for 15 min at 4°C, washed three times in ice-cold double-distilled H₂O and twice in double-distilled H₂O plus 10% glycerol, and resuspended to a cell density of approximately 1 × 10¹⁰/ml in 10% glycerol. After being shock frozen in liquid nitrogen, the bacteria were either thawed and used for transformation or stored at −80°C. Plasmid DNA was added to 100 μl of bacterial suspension in Bio-Rad Genepulser cuvettes with 0.2-cm electrodes and pulsed with 2.5 kV. After electroporation, the bacteria were transferred to 900 μl prewarmed HIB and 10% FBS and incubated at 37°C for 2 to 3 h to allow expression of antibiotic resistance. The bacteria were plated on SB plates with the appropriate antibiotic and incubated for 2 to 3 days.

Analysis of Tn4351 insertions.

Tn4351 was introduced into C. canimorsus by conjugation as described above. Genomic DNA from Em^r colonies was isolated with the GenElute bacterial genomic DNA kit (Sigma) following the manufacturer's instructions, digested with HindIII, and analyzed by Southern hybridization using standard procedures (27). IS4351 probes were prepared by PCR amplification using primers 3505 and 3506, plasmid pEP4351 DNA as a template, and digoxigenin (DIG)-11-dUTP (Roche) according to the manufacturer's recommendations. To test for vector cointegration, the Cm acetyltransferase gene (cat), which is present on the Tn4351 delivery vector pEP4351, was amplified as a 633-bp PCR product from genomic DNA using primers 3576 and 3577. All primers used are listed in Table 2.

TABLE 2.

Oligonucleotides used in this study

Collection no.	Sequence
3505	GCAACAGAATTCTGATTAATAA
3506	TTTTCTGCAGCTACGAAGGATGAA
3574	TTCAAATCTCTTAAAACCCCAG
3575	TCTAAGGCGAATAGGGAATATC
3576	CACTGGATATACCACCG
3577	TGCCACTCATCGCAGTA
3601	TTTTCTGCAGGTTAAAATCGGCCGCC
3623	ATGTAGATATACAAATGCCTG
3625	ACCCACCATTTCCTTTCCCTAAC
3626	CAGCCACTTCCTTGAAGAAATG
3639	GAAGTATTTTTGTTCGATACCAAGG
3641	TAATACTGGCATCGACCTTTACGCC
3675	CATTTCGGTTACATCCCATAATAGC
3676	AATTTCTAATGTCAAGGAAAAACCG
3677	TTACCTTCTTGTTGGTTTTAACTG
3678	TTTATCGTGCACAGGTCTCATTAG
3868	TCATGTCGACGCTCATCGGTATTTGCAACA
4128	TTACTAGTTCAATGATGATGATGATGATGCTCGAGTTCTAGAGCCATGGGG
4274	ATGGCTGCAGAGTTCCTACGATTGCCATA
4416	CCGGATCCCTTGGTTTCATCAGCCATC
4417	GCGGATCCATCAGTAATTTCCTGCATTTG
4783	CCCTGCAGATTTGTCGGCTTGTGGAAGCC
4784	GAGTAGATAAAAGCACTGTTGTGCTTCGACTCATTCCTAC
4785	AGATGTAAACGTAGGAATGAGTCGAAGCACAACAGTGCTTTTATCTACTCCGATAGCTTC
4786	AGCTCCCGTTCCACAATGCCACGTTTTTCCCTACGAAGGATGAAATTTTTCAGGGACAAC
4787	AAAAATTTCATCCTTCGTAGGGAAAAACGTGGCATTGTGG
4788	CCACTAGTTTAGTTCTTGATAAATTCCTCAACTGG

Open in a new tab

Isolation and identification of naturally occurring plasmids in C. canimorsus.

Plasmids were isolated from Capnocytophaga spp. by hot alkaline lysis (13) or alkaline lysis in combination with Qiagen columns (Qiaprep spin miniprep kit; Qiagen). For analysis of pCC7, a 1.95-kb HindIII-EcoRI fragment was inserted into the corresponding restriction sites of the cloning vector pBSIIKS(+), resulting in pMM7, which was subsequently sequenced. Based on the sequence information obtained, the native pCC7 plasmid was sequenced by primer walking, using the BigDye Terminator ready reaction kit (PE Biosystems) and primers (3574, 3575, 3601, 3623, 3625, 3626, 3639, 3641, 3675, 3676, 3677, and 3678) described in Table 2. The results were analyzed using Vector NTI 10.0 software (Invitrogen) (Fig. 1A).

FIG. 1. — Engineering of an expression shuttle vector from a natural *C. canimorsus* plasmid. (A) Genetic and restriction map of the endogenous plasmid pCC7 showing the primer binding sites used for amplification of the replicon (3601 and 4274). (B) Map of the shuttle expression vector pMM47.A containing the *cfxA* gene (Cf^r) for selection in *C. canimorsus*, the *repA* replicon of pCC7, and the promoter of *ermF* (−33 and −7 boxes) upstream from the NcoI, XbaI, and XhoI restriction sites that allow the insertion of a coding sequence in frame or out of frame with six histidine codons. Unique restriction sites are shown in red. (C) Partial nucleotide sequence of pMM47.A showing the promoter with its −33 and −7 boxes (boldface and underlined), the transcription initiation site (TIS) (boldface italics), and the Shine-Dalgarno sequence (boldface) (24). Restriction sites (italics) that are unique are shown in red. The ATG codon within the NcoI site can be used as the start codon, giving the translation shown below the nucleotide sequence.

Directed gene replacement by allelic exchange.

The replacement cassette with flanking regions spanning approximately 500 bp homologous to the siaC gene (accession number EU329392) was constructed with a three-fragment overlapping-PCR strategy (see Fig. 4A). First, two PCRs were performed on 100 ng of genomic DNA of C. canimorsus 5 with primers 4783 and 4784 for the upstream flanking region of siaC and with primers 4787 and 4788 for the downstream regions homologous to siaC. Primer 4784 for the upstream siaC region and primer 4787 for amplification of the downstream siaC region contained 20 bp of sequence homology to the ermF insertion cassette as a 5′ extension. The ermF resistance cassette was amplified from pEP4351 with primers 4785 and 4786, which contained as 5′ extensions 30 bp of the siaC gene. All three PCR products were cleaned and then mixed in equal amounts for PCR using Phusion polymerase (Finnzymes). The initial denaturation was at 98°C for 2 min, followed by 12 cycles without primers to allow annealing and elongation of the overlapping fragments (98°C for 30 s, 50°C for 40 s, and 72°C for 2 min). After the addition of external primers (4783 and 4788), the program was continued with 20 cycles (98°C for 30 s, 50°C for 40 s, and 72°C for 2 min 30 s) and finally 10 min at 72°C. The final PCR product linking the three initial fragments led to the siaC::ermF insertion cassette and was then digested with PstI and SpeI for cloning into the appropriate sites of the C. canimorsus suicide vector pMM25. The resulting plasmid, pMM106, was transferred by RP4-mediated conjugative DNA transfer from E. coli S17-1 to C. canimorsus 5 as previously described to allow integration of the insertion cassette by its homologous regions to siaC.

FIG. 4. — Generation of a *C. canimorsus* 5 sialidase knockout and complementation in *trans* by *siaC*_His cloned in the expression shuttle vector pMM47.A. (A) Schematic representation of the deletion strategy. The upstream flanking region was amplified from genomic *C. canimorsus* 5 DNA with primers 4783 (PstI; black) and 4784 containing an additional 5′ 20-nucleotide extension homologous to the resistance cassette *ermF* (magenta) (PCR 1). The same was done for the downstream flanking region with primers 4787, including 20 nucleotides complementary to the resistance cassette in 5′ (magenta), and 4788, including an SpeI restriction site (black) (PCR 2). The *ermF* resistance cassette (magenta) was amplified with primer 4785, which included the 30-bp homology to the end of the upstream flanking region at the 5′ end (green), and primer 4786, with 30-bp homology to the downstream flanking region (green) (PCR 3). All three PCR products were subjected in equal amounts to another PCR after the addition of external primers (4783 and 4788). The final PCR product linking the three initial fragments was digested with PstI and SpeI and cloned into the suicide vector pMM25, giving pMM106. (B) Immunoblot analysis of crude cell extracts of the wild type (*C. canimorsus* 5 [*Cc5*]), an *siaC*-deficient Tn4351 mutant (*siaC*), the site-directed mutant of *siaC* (*siaC*::*ermF*), and both mutants (*siaC* and *siaC*::*ermF*) complemented in *trans* with pMM52 (psiaC_His), using a polyclonal serum against SiaC (top) and a monoclonal antibody against the C-terminal His tag encoded by pMM52 (psiaC_His) (bottom). (C) Sialidase activity was measured by monitoring the fluorescence at 445 nm generated by the cleavage of 2′-(4-methylumbelliferyl)-α-d-N-acetylneuraminic acid (means plus standard deviations of the results for a representative experiment).

Immunoblotting.

Total cell extracts were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotted according to standard procedures. Monoclonal antibody against C-terminal His was purchased from Invitrogen, and polyclonal anti-SiaC serum is described elsewhere (18).

Nucleotide sequence accession number.

The sequence of pCC7, which is reported here, has been deposited in the GenBank database under accession number EU741249.

RESULTS

Conjugative DNA transfer.

We first tried to introduce IncP and pBBR1 broad-host-range vectors into C. canimorsus 5 (Table 1) by conjugative DNA transfer. Conjugation-proficient E. coli strains (Table 1) were used to mobilize pMR20 (IncP; Tc^r), pBBR1MSC3 (Tc^r), or pBBR1MSC4 (Ap^r), but no C. canimorsus transconjugant could be isolated. Next we constructed pBBR1 derivatives (pMM2 and pMM3) with randomly cloned genomic DNA (500 to 650 bp) of C. canimorsus 5 in order to allow plasmid integration by crossover, but no Ap^r colonies were found, hinting either that conjugation did not occur or that the selection marker was not expressed in C. canimorsus. Since C. canimorsus belongs to the family Flavobacteriaceae, we tested plasmid pCP29 derived from a natural plasmid of Flavobacterium psychrophilum and containing the Em^r gene ermF. This plasmid, which has been shown to replicate in F. johnsoniae, was transferred by an RP4-mediated system from E. coli S17-1 to E. coli recipient strains and to F. johnsoniae, but no Em^r C. canimorsus transconjugant colony could be obtained. To ensure that this failure was due to the replication origin and not to the selection marker or the DNA transfer itself, we turned to transposon Tn4351. Tn4351, carrying the ermF gene, was isolated in 1985 from pBF4, a self-transmissible plasmid from Bacteroides fragilis (30). As a delivery vector for Tn4351, we used plasmid pEP4351, which can be mobilized from E. coli BW19851 by the chromosome-encoded RP4 conjugation machinery but which was not replicating in C. canimorsus. Em^r transconjugants of C. canimorsus 5 could be isolated in this way, showing first that conjugation works as a method to transfer DNA into C. canimorsus and, second, that ermF is expressed and can be used as a selection marker. This result also suggested that pCP29 from F. psychrophilum did not replicate in C. canimorsus 5. We then cloned the ermF gene, including its own promoter, into pBBR1MCS4, giving pMM5, and used E. coli S17-1 as a donor strain to transfer pMM5 to C. canimorsus 5. No Em^r colonies of C. canimorsus appeared after conjugation, demonstrating that the pBBR replicon is not functional in C. canimorsus.

Generation of replicating shuttle vectors for C. canimorsus.

As we identified a functional selection marker, we next aimed to construct plasmids that could replicate in C. canimorsus. We screened eight C. canimorsus strains (Table 1) for the presence of endogenous plasmids. Two plasmids were identified in C. canimorsus strain 7 (not shown). The smaller plasmid, designated pCC7, was sequenced (4,579 bp) (Fig. 1A). A BLAST homology search (nonredundant database; July 2008) revealed a gene encoding a putative replication protein with homology to replicases of C. ochracea (AAY78540; score, 304; E value, 5e−81), Bacteroides vulgatus (CAA60389; score, 300; E value, 1e−79), and B. fragilis (CAA60390; score, 299; E value, 3e−79) (repA; 1,074 bp).

The gene product of a 1,125-bp-long open reading frame (designated ORF CC7p_3) showed homology to an ISPg1 transposase from Porphyromonas gingivalis (NP_904520).

We then generated shuttle vectors by amplifying this repA gene, including 408 bp of its upstream region, and inserting it into pLYL03, which contains ermF and the origin of transfer of RK2. The resulting vector, pMM105.A, could be mobilized by the RP4-mediated conjugation machinery from E. coli S17-1 to C. canimorsus 5 with transfer frequencies of around 10⁻⁴ per recipient (Table 3). This plasmid could also be transferred to C. canimorsus 12, but the frequency of transfer was significantly lower than in C. canimorsus 5 (Table 3). The replicase gene and upstream region that we isolated were thus sufficient for autonomous plasmid replication in C. canimorsus.

TABLE 3.

Frequencies of transfer of E. coli-Capnocytophaga shuttle vectors in matings with E. coli S17-1

Species and/or strain	Frequency of transfer (no. of transconjugants per recipient)
	pMM45.A		pMM104.A		pMM105.A
	Mean^a	SD	Mean	SD	Mean	SD
C. canimorsus 5	4.8 × 10⁻⁴	4.1 × 10⁻⁴	1.1 × 10⁻³	9.6 × 10⁻⁴	5.9 × 10⁻⁴	4.3 × 10⁻⁴
C. canimorsus 12	2.7 × 10⁻⁷	2.5 × 10⁻⁷	2.0 × 10⁻⁶	1.8 × 10⁻⁶	4.4 × 10⁻⁸	6.8 × 10⁻¹⁰
C. cynodegmi	1.7 × 10⁻⁴	2.7 × 10⁻⁴	9.1 × 10⁻⁵	6.2 × 10⁻⁵	5.8 × 10⁻⁵	8.0 × 10⁻⁵
C. cynodegmi 2	3.8 × 10⁻⁵	1.0 × 10⁻⁵	5.4 × 10⁻⁶	2.8 × 10⁻⁶	2.3 × 10⁻⁵	3.2 × 10⁻⁵
C. ochracea	<2.7 × 10⁻⁷		1.9 × 10⁻⁴	2.7 × 10⁻⁴	1.4 × 10⁻¹	1.8 × 10⁻¹
C. gingivalis	3.9 × 10⁻⁶	3.3 × 10⁻⁶	1.4 × 10⁻⁵	8.4 × 10⁻⁶	<4.5 × 10⁻⁸

Open in a new tab

Mean values from at least three independent experiments.

Finally, we constructed similar shuttle vectors for C. canimorsus with a Tc selection marker (tetQ; pMM104.A) or a Cf^r marker (cfxA; pMM45.A) (Fig. 2 and Table 3).

Construction of an E. coli-C. canimorsus shuttle expression vector.

To generate an expression vector for C. canimorsus, a 257-bp fragment upstream of ermF containing the canonical −33 and −7 boxes of Bacteroides promoters was amplified by PCR. Additionally, the primers used for amplification of the promoter region incorporated unique NcoI, XbaI, and XhoI restriction sites for cloning purposes, as well as six histidine codons, which allow the insertion of a coding sequence in or out of frame with a C-terminal His tag (Fig. 1B and C). The PCR product was digested with appropriate restriction enzymes and inserted into pMM41.A, creating the shuttle expression vector pMM47.A (Fig. 1B). To test this vector, we cloned the promoterless siaC gene encoding a sialidase from C. canimorsus 5 (18) into pMM47.A, resulting in a full-length siaC downstream from the −33 and −7 boxes and in frame with a C-terminal His tag (pMM52). Sialidase could be detected in crude extracts of a sialidase-deficient Tn4351 mutant of C. canimorsus 5 (siaC) harboring pMM52 or of a site-directed mutant of siaC (siaC::ermF) complemented with pMM52, indicating the functionality of the expression vector pMM47.A (see Fig. 4B).

Electrotransformation as a method to transfer DNA.

The shuttle vectors described above allowed us to test if electrotransformation could be applied as an alternative way of introducing DNA into C. canimorsus. Competent bacteria were prepared by washing them in ice-cold water and 10% glycerol and giving them a final cold shock by freezing them in liquid N₂. In this way, plasmid DNA (pMM47.A) isolated from an E. coli host strain could be transformed into C. canimorsus 5 with an efficiency of 2.1 × 10³ (±2.3 × 10³) clones per μg of DNA; 4.4 × 10⁻⁷ (±4.0 × 10⁻⁷) transformants per viable C. canimorsus 5 bacterium could be obtained in this way. A 2-min heat treatment at 56°C before electroporation was tested in order to prevent the degradation of DNA by intracellular restriction systems, but this treatment proved to reduce the transformation efficiency. The same decrease was observed when using MgCl₂ or NaCl during the washing steps (data not shown). Hence, sufficient transformation efficiency could be reached using electrotransformation of DNA isolated from E. coli.

E. coli-C. canimorsus shuttle vectors can be introduced to C. cynodegmi, C. ochracea, and C. gingivalis by RP4-mediated conjugation machinery of E. coli.

E. coli S17-1 carrying plasmid pMM45.A (Cf^r), pMM104.A (Tc^r), or pMM105.A (Em^r) (Fig. 2) was mated with C. cynodegmi, C. ochracea, or C. gingivalis (Table 3). All three shuttle vectors (ermF, tetQ, and cfxA) were functional in C. cynodegmi. In contrast, only tetQ and ermF were functional in C. ochracea, and tetQ and cfxA were functional in C. gingivalis. Although conjugation frequencies varied from 10⁻⁴ to 10⁻⁸ transconjugants per recipient cell, depending on the species (Table 3), tools developed for C. canimorsus can thus be used for other species in the genus.

Tn4351 transposition in C. canimorsus.

As shown before, Tn4351, derived from B. fragilis, could be introduced into C. canimorsus 5 using E. coli BW19851 to mobilize the delivery vector pEP4351 by conjugation. Em^r colonies of C. canimorsus 5 appeared at a frequency of 10⁻⁶ to 10⁻⁸ per recipient. Genomic DNA was thereafter analyzed by Southern blotting after HindIII restriction for transposon integration (Fig. 3). For the C. canimorsus 5 mutants W2E9, X7B9, and Y2F12, two bands hybridized with DIG-labeled IS4351, while for mutant X2E4, three bands hybridized (Fig. 3A). In mutant X2E4, the cat gene from the delivery vector could also be detected by PCR amplification, indicating that a cointegration event took place (Fig. 3B). We conclude that clones W2E9, X7B9, and Y2F12 contained one copy of Tn4351 flanked by the IS4351 sequences, while X2E4 contained one copy of Tn4351 but cointegrated with the vector, resulting in three copies of IS4351, as schematically represented in Fig. 3C.

FIG. 3. — Integration of Tn4351 into the chromosome of *C. canimorsus* 5. (A) Southern blot hybridization. Genomic DNA from the wild type (*C. canimorsus* 5 [*Cc5*]) and four insertion mutants (W2E9, X7B9, Y2F12, and X2E4), as well as DNA from pMM13 and pEP4351, was digested with HindIII and hybridized with DIG-labeled IS4351. Plasmids pMM13, containing one copy of IS4351, and pEP4351, containing Tn4351 (two copies of IS4351), served as positive controls. (B) PCR amplification of the 633-bp *cat* gene from the vector pEP4351 to identify vector cointegration events. (C) (Top) Schematic representation of Tn4351 integrated into the chromosome (open bars) with the IS4351 insertion sequences flanking *ermF* and *tetX*. (Bottom) Schematic representation of a cointegrate with the *cat* gene and the mobilization (*mob*) site of the vector.

Site-directed gene replacement using an antibiotic resistance cassette.

Taking advantage of the DNA transfer procedures and selection markers that we had established, we next tried to perform site-directed gene replacement. For the proof of principle, we selected the siaC gene as a target. A replacement cassette consisting of ermF flanked by ∼500-bp regions homologous to siaC was constructed, as schematically shown in Fig. 4A. The resulting plasmid, pMM106, lacking the replicon for C. canimorsus, was introduced by E. coli S17-1 into C. canimorsus 5. Transconjugants selected on Em were assumed to have integrated pMM106 into the chromosome by a single recombination event at the homologous regions of siaC. Em^r colonies were obtained at a transfer frequency of 3.4 × 10⁻⁴ Em^r colonies per C. canimorsus 5 recipient. The colonies were then immediately replicated on Cf and Em, and Cf-sensitive and Em^r colonies assumed to have undergone an excising event of the vector backbone were picked. The disruption of the sialidase (siaC::ermF) was confirmed by PCR, sequencing, and immunoblotting against SiaC (Fig. 4B), as well as by testing for the loss of sialidase activity using 2′-(4-methylumbelliferyl)-α-d-N-acetylneuraminic acid as a substrate (Fig. 4C). Activity and sialidase expression could be restored by introducing in trans the full-length gene cloned into the expression shuttle vector pMM47.A (Fig. 4B and C).

DISCUSSION

The availability of genetic methods is crucial for the study of molecular mechanisms associated with the pathogenesis of bacterial infections. In this study, techniques that allow the genetic manipulation of C. canimorsus were developed, opening the possibility of genetic analysis of bacteria of the genus Capnocytophaga. We showed that C. canimorsus can serve as a recipient for RP4-mediated conjugation, but we found that the classical broad-host-range replicon pBBR1 is not functional in C. canimorsus. The replicon from a natural plasmid of the closely related F. psychrophilum also did not lead to plasmid replication in C. canimorsus. Therefore, we isolated and sequenced an endogenous plasmid from C. canimorsus 7 and identified a replication region that could be used to engineer shuttle vectors. These vectors could also be used in other species of the genus Capnocytophaga. The selection markers ermF, cfxA, and tetQ, originating from Bacteroides spp., could be used successfully in C. canimorsus, suggesting that the promoter region and the sigma factor resemble those found in Bacteroides spp. rather than those from E. coli (3). This is in line with the assumption that the classical selection markers used in E. coli could not be used in C. canimorsus, presumably due to the lack of promoter recognition. We thus engineered an expression vector for C. canimorsus using the promoter region of IS4351 with the Bacteroides consensus for −33 and −7 boxes located upstream from the ermF gene in Tn4351 (24).

For a transposon mutagenesis approach, we tested Tn4351, a transposon widely used in Bacteroides spp. (29), Flavobacterium spp. (19), and P. gingivalis (8-10). Southern blot analysis showed that Tn4351 integrated into the C. canimorsus genome, either alone or as a cointegrate with its vector. This vector coinsertion has been reported to occur in a strain-dependent manner in bacteria of the phylum Bacteroidetes. It has also been reported that Tn4351 does not integrate in a random manner (11). For these reasons, a mariner-based transposon for Flavobacterium spp. (HimarEm) was constructed by Braun et al. using ermF as a selectable marker (5). Although Himar insertions are reported to occur at positions containing the target nucleotide sequence “TA” and are usually described as being otherwise random (36), Himar insertions were not completely random in F. johnsoniae (5). In spite of these limitations, the mariner transposon could be another approach for transposon mutagenesis of C. canimorsus.

A method for directed gene disruption by allelic exchange with a resistance marker cassette was also developed, demonstrating that homologous recombination occurs in C. canimorsus. Inserting a resistance marker cassette into the chromosome might influence the expression of downstream genes located in an operon and thus limit this method in some instances.

Taken together, a collection of techniques allowing genetic manipulations in C. canimorsus has been established. This will not only provide the basis for new approaches to understanding the mechanisms underlying pathogenesis of C. canimorsus infections, but will also make genetic manipulation available for other species in the genus Capnocytophaga.

Acknowledgments

We thank Mark J. McBride for generously providing plasmids and for invaluable advice, Georges Wauters and Michel Delmee for providing Capnocytophaga strains, and Hwain Shin for critical reading of the manuscript. We are also grateful to Nadia B. Shoemaker and Abigail A. Salyers for helpful suggestions.

This work was supported by the Swiss National Science Foundation (grant 32-65393.01).

Footnotes

^▿

Published ahead of print on 22 August 2008.

REFERENCES

1.Agarwal, S., D. W. Hunnicutt, and M. J. McBride. 1997. Cloning and characterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc. Natl. Acad. Sci. USA 94:12139-12144. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Alvarez, B., P. Secades, M. J. McBride, and J. A. Guijarro. 2004. Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 70:581-587. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Bayley, D. P., E. R. Rocha, and C. J. Smith. 2000. Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure. FEMS Microbiol. Lett. 193:149-154. [DOI] [PubMed] [Google Scholar]
4.Bobo, R. A., and E. J. Newton. 1976. A previously undescribed gram-negative bacillus causing septicemia and meningitis. Am. J. Clin. Pathol. 65:564-569. [DOI] [PubMed] [Google Scholar]
5.Braun, T. F., M. K. Khubbar, D. A. Saffarini, and M. J. McBride. 2005. Flavobacterium johnsoniae gliding motility genes identified by mariner mutagenesis. J. Bacteriol. 187:6943-6952. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Brenner, D. J., D. G. Hollis, G. R. Fanning, and R. E. Weaver. 1989. Capnocytophaga canimorsus sp. nov. (formerly CDC group DF-2), a cause of septicemia following dog bite, and C. cynodegmi sp. nov., a cause of localized wound infection following dog bite. J. Clin. Microbiol. 27:231-235. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Cooper, A. J., A. P. Kalinowski, N. B. Shoemaker, and A. A. Salyers. 1997. Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is RecA independent. J. Bacteriol. 179:6221-6227. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Dyer, D. W., G. Bilalis, J. H. Michel, and R. Malek. 1992. Conjugal transfer of plasmid and transposon DNA from Escherichia coli into Porphyromonas gingivalis. Biochem. Biophys. Res. Commun. 186:1012-1019. [DOI] [PubMed] [Google Scholar]
9.Genco, C. A., R. E. Schifferle, T. Njoroge, R. Y. Forng, and C. W. Cutler. 1995. Resistance of a Tn4351-generated polysaccharide mutant of Porphyromonas gingivalis to polymorphonuclear leukocyte killing. Infect. Immun. 63:393-401. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Hoover, C. I., E. Abarbarchuk, C. Y. Ng, and J. R. Felton. 1992. Transposition of Tn4351 in Porphyromonas gingivalis. Plasmid 27:246-250. [DOI] [PubMed] [Google Scholar]
11.Hunnicutt, D. W., and M. J. McBride. 2000. Cloning and characterization of the Flavobacterium johnsoniae gliding-motility genes gldB and gldC. J. Bacteriol. 182:911-918. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Jenal, U., and L. Shapiro. 1996. Cell cycle-controlled proteolysis of a flagellar motor protein that is asymmetrically distributed in the Caulobacter predivisional cell. EMBO J. 15:2393-2406. [PMC free article] [PubMed] [Google Scholar]
13.Kado, C. I., and S. T. Liu. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365-1373. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Kempf, M. J., and M. J. McBride. 2000. Transposon insertions in the Flavobacterium johnsoniae ftsX gene disrupt gliding motility and cell division. J. Bacteriol. 182:1671-1679. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176. [DOI] [PubMed] [Google Scholar]
16.Li, L. Y., N. B. Shoemaker, and A. A. Salyers. 1995. Location and characteristics of the transfer region of a Bacteroides conjugative transposon and regulation of transfer genes. J. Bacteriol. 177:4992-4999. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Lion, C., F. Escande, and J. C. Burdin. 1996. Capnocytophaga canimorsus infections in human: review of the literature and cases report. Eur. J. Epidemiol. 12:521-533. [DOI] [PubMed] [Google Scholar]
18.Mally, M., H. Shin, C. Paroz, R. Landmann, and G. R. Cornelis. Capnocytophaga canimorsus: a human pathogen feeding at the surface of epithelial cells and phagocytes. PLoS Pathog., in press. [DOI] [PMC free article] [PubMed]
19.McBride, M. J., and S. A. Baker. 1996. Development of techniques to genetically manipulate members of the genera Cytophaga, Flavobacterium, Flexibacter, and Sporocytophaga. Appl. Environ. Microbiol. 62:3017-3022. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.McBride, M. J., and M. J. Kempf. 1996. Development of techniques for the genetic manipulation of the gliding bacterium Cytophaga johnsonae. J. Bacteriol. 178:583-590. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Metcalf, W. W., W. Jiang, L. L. Daniels, S. K. Kim, A. Haldimann, and B. L. Wanner. 1996. Conditionally replicative and conjugative plasmids carrying lacZ alpha for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35:1-13. [DOI] [PubMed] [Google Scholar]
22.Meyer, S., H. Shin, and G. R. Cornelis. Capnocytophaga canimorsus resists phagocytosis by macrophages and blocks the ability of macrophages to kill other bacteria. Immunobiology, in press. [DOI] [PubMed]
23.Pridmore, R. D. 1987. New and versatile cloning vectors with kanamycin-resistance marker. Gene 56:309-312. [DOI] [PubMed] [Google Scholar]
24.Rasmussen, J. L., D. A. Odelson, and F. L. Macrina. 1986. Complete nucleotide sequence and transcription of ermF, a macrolide-lincosamide-streptogramin B resistance determinant from Bacteroides fragilis. J. Bacteriol. 168:523-533. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Reeves, A. R., J. N. D'Elia, J. Frias, and A. A. Salyers. 1996. A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch. J. Bacteriol. 178:823-830. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Salyers, A. A., G. Bonheyo, and N. B. Shoemaker. 2000. Starting a new genetic system: lessons from bacteroides. Methods 20:35-46. [DOI] [PubMed] [Google Scholar]
27.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
28.Shin, H., M. Mally, M. Kuhn, C. Paroz, and G. R. Cornelis. 2007. Escape from immune surveillance by Capnocytophaga canimorsus. J. Infect. Dis. 195:375-386. [DOI] [PubMed] [Google Scholar]
29.Shoemaker, N. B., C. Getty, J. F. Gardner, and A. A. Salyers. 1986. Tn4351 transposes in Bacteroides spp. and mediates the integration of plasmid R751 into the Bacteroides chromosome. J. Bacteriol. 165:929-936. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Shoemaker, N. B., E. P. Guthrie, A. A. Salyers, and J. F. Gardner. 1985. Evidence that the clindamycin-erythromycin resistance gene of Bacteroides plasmid pBF4 is on a transposable element. J. Bacteriol. 162:626-632. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1:784-791. [Google Scholar]
32.Smith, C. J., and A. C. Parker. 1993. Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J. Bacteriol. 175:2682-2691. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Tierney, D. M., L. P. Strauss, and J. L. Sanchez. 2006. Capnocytophaga canimorsus mycotic abdominal aortic aneurysm: why the mailman is afraid of dogs. J. Clin. Microbiol. 44:649-651. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Vandamme, P., M. Vancanneyt, A. van Belkum, P. Segers, W. G. Quint, K. Kersters, B. J. Paster, and F. E. Dewhirst. 1996. Polyphasic analysis of strains of the genus Capnocytophaga and Centers for Disease Control group DF-3. Int. J. Syst. Bacteriol. 46:782-791. [DOI] [PubMed] [Google Scholar]
35.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. [DOI] [PubMed] [Google Scholar]
36.Youderian, P., N. Burke, D. J. White, and P. L. Hartzell. 2003. Identification of genes required for adventurous gliding motility in Myxococcus xanthus with the transposable element mariner. Mol. Microbiol. 49:555-570. [DOI] [PubMed] [Google Scholar]

[r1] 1.Agarwal, S., D. W. Hunnicutt, and M. J. McBride. 1997. Cloning and characterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc. Natl. Acad. Sci. USA 94:12139-12144. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r2] 2.Alvarez, B., P. Secades, M. J. McBride, and J. A. Guijarro. 2004. Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 70:581-587. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r3] 3.Bayley, D. P., E. R. Rocha, and C. J. Smith. 2000. Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure. FEMS Microbiol. Lett. 193:149-154. [DOI] [PubMed] [Google Scholar]

[r4] 4.Bobo, R. A., and E. J. Newton. 1976. A previously undescribed gram-negative bacillus causing septicemia and meningitis. Am. J. Clin. Pathol. 65:564-569. [DOI] [PubMed] [Google Scholar]

[r5] 5.Braun, T. F., M. K. Khubbar, D. A. Saffarini, and M. J. McBride. 2005. Flavobacterium johnsoniae gliding motility genes identified by mariner mutagenesis. J. Bacteriol. 187:6943-6952. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r6] 6.Brenner, D. J., D. G. Hollis, G. R. Fanning, and R. E. Weaver. 1989. Capnocytophaga canimorsus sp. nov. (formerly CDC group DF-2), a cause of septicemia following dog bite, and C. cynodegmi sp. nov., a cause of localized wound infection following dog bite. J. Clin. Microbiol. 27:231-235. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r7] 7.Cooper, A. J., A. P. Kalinowski, N. B. Shoemaker, and A. A. Salyers. 1997. Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is RecA independent. J. Bacteriol. 179:6221-6227. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r8] 8.Dyer, D. W., G. Bilalis, J. H. Michel, and R. Malek. 1992. Conjugal transfer of plasmid and transposon DNA from Escherichia coli into Porphyromonas gingivalis. Biochem. Biophys. Res. Commun. 186:1012-1019. [DOI] [PubMed] [Google Scholar]

[r9] 9.Genco, C. A., R. E. Schifferle, T. Njoroge, R. Y. Forng, and C. W. Cutler. 1995. Resistance of a Tn4351-generated polysaccharide mutant of Porphyromonas gingivalis to polymorphonuclear leukocyte killing. Infect. Immun. 63:393-401. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r10] 10.Hoover, C. I., E. Abarbarchuk, C. Y. Ng, and J. R. Felton. 1992. Transposition of Tn4351 in Porphyromonas gingivalis. Plasmid 27:246-250. [DOI] [PubMed] [Google Scholar]

[r11] 11.Hunnicutt, D. W., and M. J. McBride. 2000. Cloning and characterization of the Flavobacterium johnsoniae gliding-motility genes gldB and gldC. J. Bacteriol. 182:911-918. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r12] 12.Jenal, U., and L. Shapiro. 1996. Cell cycle-controlled proteolysis of a flagellar motor protein that is asymmetrically distributed in the Caulobacter predivisional cell. EMBO J. 15:2393-2406. [PMC free article] [PubMed] [Google Scholar]

[r13] 13.Kado, C. I., and S. T. Liu. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365-1373. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r14] 14.Kempf, M. J., and M. J. McBride. 2000. Transposon insertions in the Flavobacterium johnsoniae ftsX gene disrupt gliding motility and cell division. J. Bacteriol. 182:1671-1679. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r15] 15.Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176. [DOI] [PubMed] [Google Scholar]

[r16] 16.Li, L. Y., N. B. Shoemaker, and A. A. Salyers. 1995. Location and characteristics of the transfer region of a Bacteroides conjugative transposon and regulation of transfer genes. J. Bacteriol. 177:4992-4999. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r17] 17.Lion, C., F. Escande, and J. C. Burdin. 1996. Capnocytophaga canimorsus infections in human: review of the literature and cases report. Eur. J. Epidemiol. 12:521-533. [DOI] [PubMed] [Google Scholar]

[r18] 18.Mally, M., H. Shin, C. Paroz, R. Landmann, and G. R. Cornelis. Capnocytophaga canimorsus: a human pathogen feeding at the surface of epithelial cells and phagocytes. PLoS Pathog., in press. [DOI] [PMC free article] [PubMed]

[r19] 19.McBride, M. J., and S. A. Baker. 1996. Development of techniques to genetically manipulate members of the genera Cytophaga, Flavobacterium, Flexibacter, and Sporocytophaga. Appl. Environ. Microbiol. 62:3017-3022. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r20] 20.McBride, M. J., and M. J. Kempf. 1996. Development of techniques for the genetic manipulation of the gliding bacterium Cytophaga johnsonae. J. Bacteriol. 178:583-590. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r21] 21.Metcalf, W. W., W. Jiang, L. L. Daniels, S. K. Kim, A. Haldimann, and B. L. Wanner. 1996. Conditionally replicative and conjugative plasmids carrying lacZ alpha for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35:1-13. [DOI] [PubMed] [Google Scholar]

[r22] 22.Meyer, S., H. Shin, and G. R. Cornelis. Capnocytophaga canimorsus resists phagocytosis by macrophages and blocks the ability of macrophages to kill other bacteria. Immunobiology, in press. [DOI] [PubMed]

[r23] 23.Pridmore, R. D. 1987. New and versatile cloning vectors with kanamycin-resistance marker. Gene 56:309-312. [DOI] [PubMed] [Google Scholar]

[r24] 24.Rasmussen, J. L., D. A. Odelson, and F. L. Macrina. 1986. Complete nucleotide sequence and transcription of ermF, a macrolide-lincosamide-streptogramin B resistance determinant from Bacteroides fragilis. J. Bacteriol. 168:523-533. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r25] 25.Reeves, A. R., J. N. D'Elia, J. Frias, and A. A. Salyers. 1996. A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch. J. Bacteriol. 178:823-830. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r26] 26.Salyers, A. A., G. Bonheyo, and N. B. Shoemaker. 2000. Starting a new genetic system: lessons from bacteroides. Methods 20:35-46. [DOI] [PubMed] [Google Scholar]

[r27] 27.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

[r28] 28.Shin, H., M. Mally, M. Kuhn, C. Paroz, and G. R. Cornelis. 2007. Escape from immune surveillance by Capnocytophaga canimorsus. J. Infect. Dis. 195:375-386. [DOI] [PubMed] [Google Scholar]

[r29] 29.Shoemaker, N. B., C. Getty, J. F. Gardner, and A. A. Salyers. 1986. Tn4351 transposes in Bacteroides spp. and mediates the integration of plasmid R751 into the Bacteroides chromosome. J. Bacteriol. 165:929-936. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r30] 30.Shoemaker, N. B., E. P. Guthrie, A. A. Salyers, and J. F. Gardner. 1985. Evidence that the clindamycin-erythromycin resistance gene of Bacteroides plasmid pBF4 is on a transposable element. J. Bacteriol. 162:626-632. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r31] 31.Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1:784-791. [Google Scholar]

[r32] 32.Smith, C. J., and A. C. Parker. 1993. Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J. Bacteriol. 175:2682-2691. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r33] 33.Tierney, D. M., L. P. Strauss, and J. L. Sanchez. 2006. Capnocytophaga canimorsus mycotic abdominal aortic aneurysm: why the mailman is afraid of dogs. J. Clin. Microbiol. 44:649-651. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r34] 34.Vandamme, P., M. Vancanneyt, A. van Belkum, P. Segers, W. G. Quint, K. Kersters, B. J. Paster, and F. E. Dewhirst. 1996. Polyphasic analysis of strains of the genus Capnocytophaga and Centers for Disease Control group DF-3. Int. J. Syst. Bacteriol. 46:782-791. [DOI] [PubMed] [Google Scholar]

[r35] 35.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. [DOI] [PubMed] [Google Scholar]

[r36] 36.Youderian, P., N. Burke, D. J. White, and P. L. Hartzell. 2003. Identification of genes required for adventurous gliding motility in Myxococcus xanthus with the transposable element mariner. Mol. Microbiol. 49:555-570. [DOI] [PubMed] [Google Scholar]

PERMALINK

Genetic Tools for Studying Capnocytophaga canimorsus^▿

Manuela Mally

Guy R Cornelis

Abstract

MATERIALS AND METHODS