Assessing the Efficacy of Cidofovir against Herpesvirus-Induced Genital Lesions in Goats Using Different Therapeutic Regimens

Abstract

Caprine herpesvirus 1 (CpHV-1) infection in goats induces genital vesicular-ulcerative lesions that strictly resemble those produced by human herpesvirus 2 in humans. In previous studies, the potent inhibition of CpHV-1 by cidofovir was demonstrated. Cidofovir antiherpetic activity was evaluated in goats infected experimentally by the vaginal route with CpHV-1 and then treated locally at different times after infection. The administration of 1% cidofovir cream onto vaginal mucosa was able to prevent the onset of genital lesions and to decrease significantly the titers of the virus shed by the infected animals, notably in the groups treated shortly after infection (24 and 48 h). The efficacy of cidofovir against caprine herpesvirus infection was higher when the treatment was started shortly after infection than when lesions were already present and advanced. Herpesvirus genital infection of goats is a useful animal model to study the activity of antiviral drugs against human herpesvirus infections.

Caprine herpesvirus 1 (CpHV-1) is responsible for recidivous genital disease in adult goats, characterized by confluent vesicles evolving to ulcers and crusts on the vulvar rima and vaginal mucosa (9, 17). Several biological similarities exist between CpHV-1 and the human genital herpesvirus type 2, such as the preferential tropism for the genital tract, the vesicular-ulcerative nature of the topical lesions, and the tendency to become latent in the sacral ganglia (10, 18, 21). This makes the genital CpHV-1 infection of goats a reliable animal model for comparative studies, chiefly for the development of appropriate therapies and vaccines. As for the therapeutic approach, the attention of researchers has been focused in recent years on the study of antiviral drugs, such as acyclovir, ganciclovir, and, more recently, cidofovir (CDV) (2, 4). In particular, CDV appears to have some unique features which could be exploited successfully for antiviral therapy in humans. CDV is an acyclic nucleoside phosphonate with a potent broad-spectrum activity against DNA viruses (3). CDV has been used topically for animals and a limited number of human patients (22). In previous experiments with goat models, the topical vaginal administration of CDV proved effective in preventing CpHV-1-induced genital lesions in infected goats (14, 15). CDV was administered to goats 4 h after infection and then every 12 h for five consecutive days (15). In the treated animals, CDV was able to protect against disease progression and to inhibit the onset of vaginal lesions due to CpHV-1 replication. The virus was shed for a shorter period and at lower titers in the treated animals than in the control goats. We subsequently made attempts to optimize the therapeutic protocol that was set up as mucosal applications every 6 h for the first day and then every 12 h during the following 4 days (14).

However, the therapy in field conditions is usually seldom started shortly after infection, since it will only be required when clinical signs develop. Evaluation of the efficacy of CDV in animals with active herpetic lesions would mirror more properly the actual context of therapy in humans. Accordingly, a protocol for CDV treatment was designed and evaluated in animals at different stages of infection.

MATERIALS AND METHODS

Animals.

Twenty-four 6-year-old Maltese crossbred goats seronegative for CpHV-1, from a CpHV-1-free flock, were used in this experiment. The goats were randomly divided into six groups (A, B, C, D, E, and F), each one consisting of four animals. Group F was infected with CpHV-1 and kept as a control. The goats of the other five groups were infected with CpHV-1 and treated with CDV using different protocols.

Virus.

The CpHV-1 strain BA.1 (1) was cultivated on Madin-Darby bovine kidney cells (MDBK) grown in Dulbecco minimal essential medium. The titer of virus stock was 10^6.75 50% tissue culture infectious doses (TCID₅₀)/50 μl.

CDV.

CDV was kindly provided by W. Lee, Gilead Sciences, Foster City, CA. CDV cream formulated at 1% in Beeler base (15 g cetyl alcohol, 1 g white wax, 10 g propylene glycol, 2 g sodium lauryl sulfate, and 72 g water) was used in this study (13). Each treatment dose consisted of 3 ml of a 1% CDV cream.

Experimental design.

The experiment was approved by the Italian Ministry of Health and carried out by following the national guide for the care and use of experimental animals. The goats were sedated with 0.05 mg/kg xylazine (Rompun; Bayer, S.p.A., Milan, Italy), and after 20 min, they were infected intravaginally with 4 ml of CpHV-1 strain BA.1 (titer, 10^6.75 TCID₅₀/50 μl) as previously reported (16). As reported in Table 1, the group A animals were administered intravaginally one dose of CDV 24 h postinfection (p.i.), then every 6 h for 1 day and subsequently every 12 h for 3 days. For the group B animals, after the intravaginal application of one dose of CDV at 48 h p.i., CDV was administered every 6 h for 1 day and every 12 h for 3 days. The group C animals were administered one dose of CDV at 72 h p.i. and then every 6 h for 1 day and every 12 h for 3 days. The animals of group D were given the initial application of one dose of CDV at 96 h p.i. and then every 6 h for 1 day and every 12 h for 3 days. The group E animals were treated with one dose of CDV at 120 h p.i. and then every 6 h for 1 day and every 12 h for 3 days. The animals of group F were kept as a control (infected but not treated with CDV) and housed separately from the other animals. Safety tests of CDV on the vaginal mucosa of goats were previously and successfully performed (data not shown).

TABLE 1.

Timing of CDV treatment of CpHV-1-infected goats and results of clinical scores and viral shedding^a

Group	First CDV treatment (h.p.i.)	Median AUC (clinical score) ± SEM	Median AUC (viral titer) ± SEM	Clinical examination sign (day of onset/remission)
				Hyperemia	Edema	Lesions	Pain	Temp
A	24	10.00 ± 1.15	6.15 ± 0.72	3/7	NO	NO	NO	2/5
B	48	12.67 ± 0.88	18.17 ± 1.08	2/4	NO	NO	NO	2/8
C	72	21.33 ± 1.45	22.75 ± 0.72	2/6	3/6	3/5	3/5	2/8
D	96	21.00 ± 2.57	24.67 ± 1.43	2/8	3/5	3/8	3/8	3/5
E	120	57.00 ± 2.08	38.92 ± 0.22	2/10	3/10	3/10	3/10	3/8
F	NT	59.00 ± 2.08	32.33 ± 1.10	2/10	2/12	2/12	2/12	2/11

^aSEM, standard error of the median; NT, not treated; NO, not observed.

All the animals were kept under observation for 21 days. The goats were examined daily for clinical evidence of CpHV-1 infection. Their temperatures were measured, and general and local clinical signs were evaluated. Each clinical sign (hyperemia, edema, lesions, pain, and temperature) was scored as follows: 0, absent; 1, mild; 2, moderate; and 3, severe. Temperatures above normal (38.2 to 38.6°C) were scored as follows: 1, >0.5 to 1°C; 2, >1.1 to 1.5°C; and 3, >1.5°C. The total daily clinical score for each animal was calculated by summing the scores of the five clinical signs and used to evaluate the severity of the infection.

Vaginal swabs were collected starting the day before the infection and then for 21 days after, in order to titrate the virus shed by the animals on MDBK cells. Blood samples were taken the day before the infection and then at 0, 7, 14, and 21 days p.i. (d.p.i.) to evaluate the dynamics of the antibody response to CpHV-1 by a seroneutralization assay, as previously reported (1).

PCR.

Viral DNA was extracted from swabs using the commercial QIAamp tissue kit (Qiagen GmbH, Hilden, Germany), according to the instructions of the company. The PCR was carried out following the protocol described by Tempesta et al. (19). A pair of primers corresponding to the sequences from oligonucleotides 632 to 653 and 1027 to 1046 of the gene coding for the glycoprotein C of the BA.1 strain of CpHV-1 was chosen (Table 2) (20). The PCR was carried out in a total volume of 25 μl containing 5 μl of DNA sample, 2.5 μl of 10× PCR buffer, 1.5 mM MgCl₂, 1.25 mM of each oligonucleotide triphosphate, 200 μM of each primer, 1.5 U of Takara LA Taq (Takara Bio, Inc.), and 2.5 μl of glycerol and sterile water up to 25 μl. The thermal profile consisted of 94°C at 1 min and 40 cycles at 94°C for 1 min (denaturation), 70°C for 1 min (annealing), and 72°C for 1 min (polymerization), followed by a final extension at 72°C for 10 min. Ten microliters of the PCR products was analyzed by electrophoresis in 1.5% agarose gel and visualized by UV light after ethidium bromide staining.

TABLE 2.

Primers used in the CpHV-1 PCR assay

Primer	Sequence (5′ to 3′)	Sense	Positiona	Amplicon size (bp)
CapIII	AGGGCGCCGGTGGATGCTCTG	+	632-653
CapIV	GGCGGGCGGTGCGTCGTGA	−	1027-1046	414

^aOligonucleotide position refers to the sequence of CpHV-1 reference strain BA.1 (GenBank accession no. AY821804).

Virus isolation and titration.

Vaginal swabs were dipped in 1.5 ml of Dulbecco minimal essential medium and centrifuged at 5,000 × g for 5 min. The supernatant was treated with a 10% mixture of antibiotics (5,000 IU/ml penicillin, 2,500 μg/ml streptomycin, and 10 μg/ml amphotericin B) for 30 min at room temperature, diluted in serial 10-fold steps, and inoculated in quadruplicate onto MDBK cells in 96-well microtiter plates. The plates were read after 3 days of incubation, and the viral titers were calculated.

Data analysis.

The data obtained by evaluation of the clinical scores and the titers of the virus shed by each group (four goats per single group) were analyzed by GraphPad Prism software version 3.00 (GraphPad Software, San Diego, CA) by calculating the area under the curve (AUC). The groups of animals were statistically compared by using the one-way analysis of variance test.

RESULTS

Clinical examination.

The goats of group A had increases in temperature from the second to the fifth d.p.i. and a slight vaginal hyperemia from the third to the seventh d.p.i. Edema and pain at swabbing and CpHV-1-associated vaginal lesions were not observed (Fig. 1a and Table 1).

FIG. 1.

Results of clinical scores (a and b) and viral titers (c and d) in CpHV-1-infected goats treated and not treated (control) with CDV. (a) Clinical scores of groups A and B (CDV treated) and group F (not treated with CDV); (b) clinical scores of groups C and D (CDV treated) and group F (not treated with CDV); (c) viral titers in vaginal swabs of groups A and B (CDV treated) and group F (not treated with CDV); (d) viral titers in vaginal swabs of groups C and D (CDV treated) and group F (not treated with CDV). Viral excretion and clinical scores are expressed as medians ± standard error of the medians of the AUCs calculated for the experimental groups. Statistical analysis (one-way analysis of variance) showed highly significant differences between treated and control groups (P < 0.0001). Group E curves are not reported because there was no significant difference. The circles represent the start of CDV treatment.

The goats of group B had increases in temperature from the second to the eighth d.p.i. and mild vaginal hyperemia from the second to the fourth d.p.i. Lesions, edema, and pain at swabbing were absent (Fig. 1a and Table 1).

The goats of group C showed increases in temperature from the second to the eighth d.p.i. The animals presented slight vaginal hyperemia from the second to the sixth d.p.i., mild edema from the third to the sixth d.p.i., and mild pain at swabbing and small lesions over the vulvar rima from the third to the fifth d.p.i. (Fig. 1b and Table 1).

The goats of group D displayed increases in temperature from the third to the fifth d.p.i. The animals presented mild vaginal hyperemia from the second to the eighth d.p.i. and slight edema from the third to the fifth d.p.i. In addition, small and medium lesions over the vulvar rima associated with mild pain at swabbing were observed from the third to the eighth d.p.i. (Fig. 1b and Table 1).

The goats of group E presented increases in temperature from the third to the eighth d.p.i. The animals displayed hyperemia of the vaginal mucosa from the 2nd to the 10th d.p.i. that appeared severer from the fourth to the eighth d.p.i. Edema and lesions over the vulvar rima were more marked from the 3rd to the 10th d.p.i., and mild pain at swabbing was observed (Table 1).

The control group F goats developed, as expected, high temperatures for 8 to 10 days and displayed, at the vaginal level, severe hyperemia from 2 to 10 d.p.i., which was more marked from 3 to 7 d.p.i. Severe edema and extensive ulcerative lesions, with local pain at swabbing, were observed up to the 12th d.p.i. (Fig. 1a and b; Table 1).

The median clinical score AUC values for CDV-treated goats were 10.00 ± 1.15 for group A, 12.67 ± 0.88 for group B, 21.33 ± 1.45 for group C, 21.00 ± 2.57 for group D, and 57.00 ± 2.08 for group E, whereas for the control goats (group F), they were 59.00 ± 2.08, with high significance (P < 0.0001) (Table 1). The group E median clinical score AUC values are not reported in Fig. 1 because the curve of the group has almost overlapped that of the control group and there is not any significant difference.

Virus isolation.

The CDV-treated goats of group A shed virus from the first to the fourth d.p.i., with the peak of viral excretion (10^3.25 TCID₅₀/50 μl) at the second d.p.i. The goats of group B shed virus from the first to the fifth d.p.i., with the peak of viral excretion (10^6.75 TCID₅₀/50 μl) at 2 d.p.i. (Fig. 1c). The group C goats shed virus from the first to the seventh d.p.i., with the peak of viral excretion (10^6.00 TCID₅₀/50 μl) at the third d.p.i. The goats of group D shed virus from the first to the seventh d.p.i., with the peak of viral excretion (10^6.00 TCID₅₀/50 μl) at 2 d.p.i. (Fig. 1d). The goats of group E shed virus from the first to the ninth d.p.i., with the peak of viral excretion (10^6.00 TCID₅₀/50 μl) at 2 to 4 d.p.i. (data not shown).

The control goats (group F) shed virus from the 1st to the 10th d.p.i., with the peak of viral excretion (10^6.00 TCID₅₀/50 μl) at 4 to 5 d.p.i. (Fig. 1c and d).

As reported in Table 1, in the treated animals, the median AUC values (TCID₅₀/50 μl/day) of the virus titers were 6.15 ± 0.72 in group A, 18.17 ± 1.08 in group B, 22.75 ± 0.72 in group C, 24.67 ± 1.43 in group D, and 38.92 ± 0.22 in group E, whereas in the control untreated goats (group F), the median AUC value was 32.33 ± 1.10 TCID₅₀/50 μl/day, with high significance (P = 0.0001).

The group E median titer AUC values are not reported in Fig. 1 because the curve of the group has almost overlapped that of the control group and there is not any significant difference. Viral DNA was detected by PCR up to the 10th d.p.i. in the treated goats of group E and to the 11th in one of the controls (unpublished data).

Dynamic of CpHV-1-specific antibody response.

All the goats were seronegative before the infection. At the seventh d.p.i., the seroneutralization assay antibody titers in the CDV-treated goats were 1:2, while those in the control goats were 1:4. At the 14th d.p.i., the antibody titers in the treated goats ranged from 1:8 to 1:64, and they were 1:16 in the control goats. At the 21st d.p.i., the antibody titers in the treated goats were 1:8 to 1:32, while they were 1:16 in the control goats.

DISCUSSION

Several studies have reported that CDV is effective in vitro and in vivo against a broad spectrum of animal viruses, such as equine herpesvirus 1 (5, 6, 7), bovine herpesvirus 1 (8), feline herpesvirus 1 (11), and Orf virus in lambs (12). We previously evaluated in the goat model the effects of the mucosal administration of CDV against CpHV-1 infection. The administration of CDV started 4 h after the infection, using various protocols that differed in the treatment schedule (14, 15). In both the experiments, CDV proved to be highly effective against CpHV-1, since it was able to inhibit the onset of CpHV-1-induced lesions and also to decrease significantly virus shedding in the treated animals.

In the present study, CDV was administered to animals by using the same treatment protocols as in the previous experiments, but the therapy was started at different times after the infection, i.e., 24, 48, 72, 96, and 120 h after the vaginal administration of CpHV-1. The results of these experiments allowed us to gather information on the efficacy of CDV in animals with active herpetic lesions. As for clinical protection, treatment with CDV appeared to be more effective when the therapy was started shortly after infection. The animals of groups A to D displayed AUC values significantly higher than group F, whereas the AUC values of group E, treated 120 h after the infection, and the AUC values of group F (not treated) were superimposable. The goats of group E displayed the same lesions as the goats of the control group, indicating that CDV has no effect on clinically evident and advanced herpetic lesions. For the group E animals, the topical administration of CDV was made on an injured vaginal mucosa, with hyperemia, edema, and ulcerative lesions. These data support the proposition that the sooner CDV is administered after herpetic infection, the higher the efficacy and protection that will be reached against the onset and progressive evolution of the clinical signs.

In regard to viral excretion, CDV treatment was able to decrease significantly viral shedding in the treated animals of groups A to D, whereas it had no effect on viral excretion in the goats of group E.

The decrease in virus shedding was chiefly evident with the goats of group A. In these animals, the excretion of CpHV-1 ended markedly earlier than in the animals of the control group (3 to 4 days versus 8 to 10 days).

When the dynamics of viral shedding (Fig. 1c and d) of the treated groups are compared to those of the control animals, from the time of the initial CDV administration, the antiviral activity of CDV appeared clearer. The virus titer in the genital secretions dropped immediately after the initial treatment with CDV, reaching zero well before the virus was shed by the control animals. Also, the significance of the difference between the curves progressively decreased throughout the various groups (A to E), and there was no difference between group E and group F in the pattern of virus shedding.

In conclusion, the experiment confirmed that CDV has a potent antiviral activity against CpHV-1, since it was able to protect the animals from CpHV-1-associated clinical signs and to decrease drastically in vivo virus replication and shedding. The efficacy of CDV appeared to decrease when it was applied 48 to 72 h after the infection, and this could represent a limit for the use of the molecule under natural conditions, since therapy is usually started after the onset of the symptoms. CpHV-1 infection in goats represents an excellent animal model to set up and evaluate new approaches for the treatment of human herpesvirus 2 genital infection in humans. Several advantages are offered by this model. CpHV-1 vaginal infection in goats is reproducible, with evident herpetic lesions developing in the infected animals. The topical administration of drugs in goats is not difficult, and the evaluation of the clinical signs can be accomplished easily and clearly, with decreased possibilities of misinterpretations. Accordingly, it will be interesting to assess other antiherpetic drugs in the goat model in order to develop tools suitable for the treatment of active mucosal herpetic lesions.