Skip to main content
NCBI home page
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2008 Sep 2;28(21):6620–6631. doi: 10.1128/MCB.00448-08

TRF4 Is Involved in Polyadenylation of snRNAs in Drosophila melanogaster▿

Ryoichi Nakamura 1, Ryo Takeuchi 1, Kei-ichi Takata 1,2, Kaori Shimanouchi 1, Yoko Abe 1, Yoshihiro Kanai 1, Tatsushi Ruike 1, Ayumi Ihara 1, Kengo Sakaguchi 1,*
PMCID: PMC2573236  PMID: 18765642

Abstract

The Saccharomyces cerevisiae poly(A) polymerases Trf4 and Trf5 are involved in an RNA quality control mechanism, where polyadenylated RNAs are degraded by the nuclear exosome. Although Trf4/5 homologue genes are distributed throughout multicellular organisms, their biological roles remain to be elucidated. We isolated here the two homologues of Trf4/5 in Drosophila melanogaster, named DmTRF4-1 and DmTRF4-2, and investigated their biological function. DmTRF4-1 displayed poly(A) polymerase activity in vitro, whereas DmTRF4-2 did not. Gene knockdown of DmTRF4-1 by RNA interference is lethal in flies, as is the case for the trf4 trf5 double mutants. In contrast, disruption of DmTRF4-2 results in viable flies. Cellular localization analysis suggested that DmTRF4-1 localizes in the nucleolus. Abnormal polyadenylation of snRNAs was observed in transgenic flies overexpressing DmTRF4-1 and was slightly increased by the suppression of DmRrp6, the 3′-5′ exonuclease of the nuclear exosome. These results suggest that DmTRF4-1 and DmRrp6 are involved in the polyadenylation-mediated degradation of snRNAs in vivo.

The addition of poly(A) tails to mRNA 3′ ends is important in many aspects of mRNA metabolism. The conventional role of a poly(A) tail in eukaryotes, which are added by a canonical nuclear poly(A) polymerase (PAP), is threefold: (i) stabilization of RNA, (ii) facilitation of export from the nucleus, and (iii) stimulation of the subsequent translation (7, 33, 55). However, recent studies have changed the traditional view of polyadenylation in eukaryotic RNA metabolism. In particular, a number of noncanonical PAPs were discovered in yeast, worms, and vertebrates. These noncanonical PAPs, which contain a catalytic NTP transferase and PAP-associated domains similar to canonical PAPs, are localized either in the nuclei or cytoplasm and are thought to catalyze polyadenylation of specific RNAs (1, 23, 34, 39, 45).

Schizosaccharomyces pombe Cid1 and Cid13 are cytoplasmic noncanonical PAPs. Cid1 is required for the S-M checkpoint control, including migration from mitosis to meiosis (47), while Cid13 participates in DNA replication and genome maintenance by specifically regulating suc22 mRNA, which encodes a subunit of ribonucleotide reductase (39). In addition, very recent studies have shown that Cid1 has poly(U) polymerase activity in addition to PAP activity (24, 36). Caenorhabditis elegans GLD-2, initially identified as a gene involved in the control of germ line development, is a cytoplasmic noncanonical PAP that promotes the transition from mitosis to meiosis. GLD-2 enzyme activity is stimulated by forming a heterodimeric PAP with an RNA-binding protein GLD-3 (45). Subsequently, GLD-2 homologues were identified in vertebrates, including frogs, mice, and humans. Vertebrate GLD-2 proteins are important for meiotic maturation of oocytes and are probably involved in the activation of many mRNAs throughout early development (37). In addition, it has been suggested that mammalian GLD-2 are responsible for localized cytoplasmic polyadenylation of neuronal mRNAs at synapses (52). Hs4, one of the human noncanonical PAPs (Hs1-Hs5), was identified as the mitochondrial PAP (hmtPAP) required for mitochondrial RNA polyadenylation (31, 42).

In S. cerevisiae, Trf4 and its redundant homologue Trf5 were identified as nuclear noncanonical PAPs (9, 14, 16). These proteins were initially reported to possess DNA polymerase activity in vitro and were classified as the fourth essential DNA polymerase, DNA polymerase σ (48, 49). Unlike cytoplasmic noncanonical PAPs, Trf4 functions in a nuclear RNA surveillance pathway as part of the TRAMP complex, which activates RNA for exosome-mediated degradation by the addition of a poly(A) tail (9, 20, 21, 25, 43, 53). Trf4 interacts with an RNA helicase (Mtr4) and one of two functionally redundant putative RNA-binding proteins (Air1 or Air2) to form the Trf4/Air1/Mtr4 polyadenylation (TRAMP) complex. This mechanism resembles the role of polyadenylation in bacterial RNA turnover (6, 8, 22, 27, 32). Recent studies show that Trf4 is involved in the regulation of histone mRNA levels for the maintenance of genome stability (35). Furthermore, Trf4 is responsible for the control of the ribosomal DNA (rDNA) copy number by degradation of cryptic transcripts from telomeric and rDNA spacer regions (15). In S. pombe, Cid14 has been identified as the functional homologue of Trf4 and Trf5. It appears that this enzyme polyadenylates pre-rRNAs to trigger RNA processing by the exosome (51). In addition, Cid14 is also involved in the elimination of a variety of RNA targets to regulate heterochromatic gene silencing, meiotic differentiation, and maintenance of genomic integrity (2, 46). A similar polyadenylation-mediated degradation was observed in the catabolism of pre-mRNAs in human cells, but the PAP involved in the pathway is still obscure (50).

The 3′-5′ exonuclease Rrp6, a constituent of the exosome, plays a key role in nuclear exosome-dependent degradation (30). S. cerevisiae strains lacking Rrp6 accumulate polyadenylated snRNAs, snoRNAs, and rRNAs in a ScTrf4-dependent manner (53). These findings suggest that the noncoding RNAs, such as snRNAs, snoRNAs, and rRNAs, are the main targets of ScTrf4 during polyadenylation-mediated degradation.

The process of mRNA splicing is a major posttranscriptional event that is essential for the maturation of mRNAs in eukaryotes. The reaction is accomplished by spliceosomes, which primarily consist of RNA-protein complexes called small nuclear ribonucleoproteins (snRNPs). The snRNPs contain U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs) and bind to the pre-mRNA in a specific order to align the splice sites for cleavage. First, the U1 and U2 snRNPs bind to the 5′ end of the intron and the branch site close to the 3′ end of the intron, respectively, generating the prespliceosome. Then, the preformed U4/U6-U5 tri-snRNP, in which the U4 and U6 snRNAs are base paired, join the complex and form the mature spliceosome. The mature spliceosome induces a major structural change that results in the dissociation of the U1 and U4 snRNPs, allowing U6 snRNP to interact with sequences close to the 5′ splice site and U5 snRNP interacts with nucleotides at the end of the first exon, just before the 5′ splice junction. This is the active spliceosome, which catalyzes 5′ cleavage and lariat formation. U5 snRNP remains attached to the end of the first exon and also begins to interact with the beginning of the second exon, thus bringing the two exons together. The ligated exons are released from the spliceosome, but the lariat intron remains bound. The spliceosome then disassembles, releasing the lariat, which is linearized and degraded. The snRNPs are subsequently recycled (19, 28).

Although the Trf4 family of proteins is conserved from yeast to humans, their biological role in multicellular organisms is poorly understood. We analyzed here the biological roles of Drosophila Trf4 homologs (DmTRF4). Our data suggest that in addition to ScTrf4/5 one DmTRF4 is also involved in the RNA surveillance system.

MATERIALS AND METHODS

Drosophila stocks.

Fly stocks were cultured at 25°C on standard food. The Canton-S fly was used as the wild-type (WT) strain and w1118 was used as a control in certain experiments. The following GAL4 drivers were used. Act5C-GAL4 drives GAL4 under the control of the constitutive Actin5C promoter. GMR-GAL4 drives GAL4 under the control of the eye-specific glass multimer reporter (11). ey-GAL4 drives GAL4 in the pattern of the eyeless gene (13, 18). MS1096-GAL4 drives GAL4 in the dorsal compartment of the wing imaginal disc (3). Hsp70-GAL4 induces GAL4 by heat shock. The heat shock involved incubating the third-instar larvae at 37°C for 3 h.

P-element insertion mutant for the CG17462 gene, CG17462NP2505, and for the DmRrp6 gene, DmRrp6f07001, were obtained from the Drosophila Genetic Resource Center, Kyoto Institute of Technology (Kyoto, Japan) and the Exelixis Collection at the Harvard Medical School (Boston, MA), respectively.

Establishment of transgenic flies.

The pUAS-DmTRF4-1 was constructed from the entire open reading frame of DmTRF4-1. This was achieved by PCR using the primer pair PM01/PM02 (Table 1) with cDNA (EST clone RE04457) as a template. The amplified product was then subcloned into pUAST transformation vector. The pUAS-Dmtrf4-1 IR was constructed from nucleotides 1540 to 2015 of DmTRF4-1 cDNA cloned into pUAST as an inverted repeat with an interruption of the DmTRF4-1 third intron. The PCR was performed using cDNA and genome-DNA as a template with the primer pairs PM05-PM06 and PM07-PM08, respectively (Table 1). The two amplified products were then subcloned into pUAST vector in a head-to-head orientation. P-element transformation was performed by using a standard method. Several independent lines were established for the pUAS-DmTRF4-1 and pUAS-Dmtrf4-1 IR, respectively. All crosses were performed at 28°C, except crossing Hsp70-GAL4.

TABLE 1.

Oligonucleotide sequences used in this study

Oligonucleotidea Sequence (5′-3′) Target
PM01 CCGGAATTCATGGATCCATTTGTTGGCTGGT DmTRF4-1
PM02 TCTAGACTATCGCTCGTCACGCTGCT DmTRF4-1
PM03 ACGCGTCGACATGATGATGATGATGATGATGAAGCTTTCGCTCGTCACGCTGCTGAT DmTRF4-1
PM04 TGTGTCTAGATCGCTCGTCACGCT DmTRF4-1
PM05 CTCGAGTTCTTCGAACTTTA DmTRF4-1
PM06 GAATTCATCGTTGTAGTCGTCGTTAC DmTRF4-1
PM07 CTCGAGCTGACGCCAGGCAATGATAT DmTRF4-1
PM08 TCTAGAATCGTTGTAGTCGTCGTTAC DmTRF4-1
PM09 CGAAACGGTCGCGTGTTCGC DmTRF4-1
PM10 TTGTGGCGGGTTGTTGCTGG DmTRF4-1
PM11 CCGTTTGAGTTCTTGTGCTGTG Actin5C
PM12 CATGATGGAGTTGTAGGTGGTC Actin5C
PM13 CCGGAATTCATGTGTGACGAAGCGAATCC DmTRF4-2
PM14 CCCAAGCTTATTCATCTTAAGGTTTGCAAGGTCG DmTRF4-2
PM15 TGGACTTGGATGTGGACAAG DmRrp6
PM16 ACGGAGTACATGTCATCATCC DmRrp6
PB01 TCGGGACGGCGCGAACGCCA U1 snRNA
PB02 GTACTGCAATACCGGGCCAA U2 snRNA
PB03 GTAGTGGACGGTATTTCACGTC U4 snRNA
PB04 GACTCATTAGAGTGTTCCTCTC U5 snRNA
PB05 GTGGAACGCTTCACGATTTTG U6 snRNA
PB06 GTCCAGCTTCTTGAAGCCAATG RpS29
Open in a new tab
a

Oligonucleotides PB01 to PB06 were used as probes.

RNA purification, Northern blotting, and reverse transcription-PCR (RT-PCR) analysis.

Total RNAs were extracted by using TRIzol (Invitrogen, Carlsbad, CA) from Drosophila melanogaster bodies at several different stages, from Kc cells, and from the treated third-instar larvae in respective experiments, treated with DNase I (TaKaRa Bio., Inc., Kyoto, Japan) and then purified with phenol-chloroform. Poly(A)+ RNA was purified from total RNA using PolyATract mRNA isolation kit according to the manufacturer's protocols (Promega, Madison, WI). Then, 1 μg of poly(A)+ RNA was hybridized to 300 ng of oligo(dT)18 in 25 mM Tris-HCl (pH 7.9), 1 mM EDTA, and 50 mM NaCl by slow cooling from 68 to 30°C. The mixture was adjusted to 53 mM Tris-HCl (pH 7.9), 25 mM NaCl, 0.5 mM EDTA, 1 mM dithiothreitol, and 30 μg of bovine serum albumin (BSA)/ml and digested for 1 h at 37°C with 60 U of RNase H (TaKaRa Bio., Inc.).

Northern blotting, for the experiments shown in Fig. 1, was carried out as described previously (41). Full-length DmTRF4-1 or -2 was used as the specific probe. Full-length ribosomal protein 49 (Rp49) cDNA was used as a control. For the experiments shown in Fig. 7, RNA [5 μg of total RNA, 1 μg of purified poly(A)+ RNA, and 1 μg of deadenylated RNA] was separated in a 6% polyacrylamide gel (19:1) containing 8 M urea, electrophoretically transferred to nylon membrane (Hybond-N+; Amersham) in 0.5× TBE (1× TBE is 89 mM Tris-borate and 2 mM EDTA) at 3.3 mA/cm2 for 2 h, and then UV cross-linked to the membrane by using Stratalinker (Stratagene, La Jolla, CA). Membranes were hybridized in ULTRAhyb-Oligo (Ambion, Austin, TX) using oligonucleotide DNA probes (Table 1) that were 5′ end labeled using T4 polynucleotide kinase (TaKaRa Bio) and [γ-32P]ATP (GE Healthcare Bioscience, Piscataway, NJ). After two washes in 2× SSC (1× SSC is 0.15 M NaCl, 0.015 M sodium citrate [pH 7.0]) plus 0.5% sodium dodecyl sulfate, the membrane was exposed to BioMax MS-1 (Kodak, Rochester, NY).

FIG. 1.

FIG. 1.

Open in a new tab

DmTRF4-1 and DmTRF4-2 are candidate genes for the homologue of S. cerevisiae Trf4/5. (A) Schematic representation of DmTRF4-1, DmTRF4-2, and ScTrf4. The location of the nucleotidyltransferase domain and the PAP-associated domain are indicated by dark gray and light gray boxes, respectively. Numbers to the right of the boxes indicate the total number of amino acids in the respective proteins. Homology/similarity (as a percentage) in the catalytic domains between DmTRF4-1 or DmTRF4-2 and ScTrf4 are indicated below each box, respectively. (B) Comparison of DmTRF4-1, DmTRF4-2, and ScTrf4. An amino acid alignment of the catalytic domain, consisting of the nucleotidyltransferase domain and the PAP-associated domain, of DmTRF4-1, DmTRF4-2, and ScTrf4. Identical and similar amino acid residues are boxed in black and gray, respectively. The two conserved catalytic aspartate residues are indicated by asterisks. The alignment was carried out using the CLUSTAL W program. (C) Expression of DmTRF4-1 and DmTRF4-2 during the Drosophila development. Northern blotting was successively performed on the same membrane. A portion (30 μg) of total RNA was applied to each lane. Rp49 mRNA served as a loading control.

FIG. 7.

FIG. 7.

Open in a new tab

Overexpression of DmTRF4-1 causes extraordinary snRNA polyadenylation, which is DmRrp6 dependent. Total RNA (5 μg) (total; left panels), purified poly(A)+ RNA (1 μg) [poly(A)+; middle panels], deadenylated RNA (1 μg) [poly(A)−; right panels] were isolated from third-instar larvae of Hsp70-GAL4/+ (control; lanes 1, 7, and 13), Hsp70-GAL4/+; DmRrp6f07001/+ (DmRrp6 KD; lanes 2, 8, and 14), Hsp70-GAL4/UAS-Dmtrf4-1 IR (DmTRF4-1 KD; lanes 3, 9, and 15), Hsp70-GAL4/UAS-Dmtrf4-1 IR; DmRrp6f07001/+ (DmTRF4-1 KD and DmRrp6 KD; lanes 4, 10, and 16), Hsp70-GAL4/+; UAS-DmTRF4-1/+ (DmTRF4-1 OE; lanes 5, 11, and 17), Hsp70-GAL4/+; UAS-DmTRF4-1/DmRrp6f07001 (DmTRF4-1 OE and DmRrp6 KD; lanes 6, 12, and 18) after induction of GAL4 expression by heat shock for 3 h. Specific radiolabeled probes (Table 1) for U1 (A), U2 (B), U4 (C), U5 (D), U6 (E), snRNA and Ribosomal protein S29 (RpS29), as a loading control (F), were hybridized and detected by autoradiography. The migration positions of the regular snRNA and polyadenylated snRNA are indicated on the right of the panels. The ratio of the polyadenylated snRNAs in Hsp70-GAL4/+; UAS-DmTRF4-1/DmRrp6f07001 (DmTRF4-1 OE and DmRrp6 KD) to those in Hsp70-GAL4/+; UAS-DmTRF4-1/+ (DmTRF4-1 OE) are shown in lane 12. Each band intensity was quantified by using a BAS-3000 imaging analyzer and normalized to RpS29 mRNA.

In the RT-PCRs for the experiments shown in Fig. 3, 5, and 6, first-strand cDNA was synthesized from 5 μg of total RNA by using the SuperScript First-Strand synthesis system (Invitrogen) with oligo(dT)12-18 and then amplified using the specific primer pairs PM09-PM10, PM11-PM12, PM13-PM14, and PM15-PM16 (Table 1). PCR products were visualized by staining with ethidium bromide after agarose gel electrophoresis. Quantification was analyzed by using a BAS-3000 imaging analyzer (Fuji Film, Tokyo, Japan).

FIG. 3.

FIG. 3.

Open in a new tab

DmTRF4-1 knockdown and DmTRF4-2 knockout mutants. (A) Physical map of the genomic location of DmTRF4-2 (CG17462). In CG17462NP2505, P-element was inserted in the 5′-untranslated region of the CG17462 gene. Black and gray arrows indicate predicted genes. (B) RT-PCR was performed for total RNAs from WT (lane 1) and DmTRF4-2 mutant (CG17462NP2505; lane 2) third-instar larvae. Expression of Act5C was used as an internal control. The cycle numbers used are indicated. (C) RT-PCR was performed for total RNAs from Act5c-GAL4/+ (control; lane 1) and Act5C-GAL4/UAS-Dmtrf4-1 IR (DmTRF4-1 KD; lane 2) third-instar larvae. Expression of Act5C was used as an internal control. The cycle numbers are indicated. The relative amount of the DmTRF4-1 transcript in Act5c-GAL4/UAS-DmTRF4-1 IR to that in Act5C-GAL4/+, normalized to Act5C mRNA, was also quantified graphically. The data represent the mean of three independent measurements. Error bars indicate ± the standard deviation. (D) Knockdown of the DmTRF4-1 level by ubiquitous expression of the DmTRF4-1 double-stranded RNAs in living flies (Act5C-GAL4/UAS-Dmtrf4-1 IR) caused third-instar-larval or early pupal lethality. Few transgenic flies survived until the late pupal stage, but when this happened the body of the pupa was significantly darkened. Note the darkened imaginal body in the DmTRF4-1 knockdown mutant, as indicated by the arrowhead (DmTRF4-1 KD; panel a). Early pupal lethality was not observed in control flies (Act5C-GAL4/+) (Control; panel b).

FIG. 5.

FIG. 5.

Open in a new tab

Effects of overexpression of the DmTRF4-1 in D. melanogaster. (A) RT-PCR was performed for total RNAs from Hsp70-GAL4/+ (control; lane 1), Hsp70-GAL4/UAS-Dmtrf4-1 IR (DmTRF4-1 KD; lane 2), Hsp70-GAL4/+; UAS-DmTRF4-1/+ (DmTRF4-1 OE; lane 3), and Hsp70-GAL4/UAS-Dmtrf4-1 IR; UAS-DmTRF4-1/+ (DmTRF4-1 KD and OE; lane 4) third-instar larvae incubated for 3 h at 37°C. Expression of Act5C was used as an internal control. The cycle numbers are indicated. The relative amount of the DmTRF4-1 transcript in each sample to that in Hsp70-Gal4/+, normalized to Act5C mRNA, was also quantified graphically. The data represent the mean of three independent measurements. Error bars indicate + the standard deviation. (B) The transgenic fly lines crossed the GMR-GAL4 driver, which induced GAL4 posterior to the MF of the eye disc. No phenotype were observed in control flies (GMR-GAL4/+; +; +) (control; panel a) and knockdown flies DmTRF4-1(GMR-GAL4/+; UAS-Dmtrf4-1 RI/+; +) (DmTRF4-1 KD; panel b). Overexpression of the DmTRF4-1 caused a rough eye phenotype (GMR-GAL4/+; +; UAS-DmTRF4-1/+), as indicated by the arrowhead (DmTRF4-1 OE; panel c). Knockdown of the DmTRF4-1, while overexpressing DmTRF4-1, suppressed a rough eye phenotype induced by overexpression of the DmTRF4-1 (GMR-GAL4/+; UAS-Dmtrf4-1 RI/+; UAS-DmTRF4-1/+) (DmTRF4-1 KD and OE; panel d). (C) Overexpression of DmTRF4-1 in the wing imaginal disc using the MS1096-GAL4 driver caused an underdeveloped wing (MS1096-GAL4/+; +; UAS-DmTRF4-1/+), as indicated by the arrowhead (DmTRF4-1 OE; panel a). No phenotype was observed in control flies (MS1096-GAL4/+) (control; panel b). (D) Overexpression of DmTRF4-1 in the whole eye imaginal disc using the ey-GAL4 driver resulted in a headless phenotype, as indicated by the arrowhead, and caused lethality at the pupal stage (ey-GAL4/+; UAS-DmTRF4-1/+) (DmTRF4-1 OE; panel a). No phenotype was observed in control flies (ey-GAL4/+) (control; panel b). These were the contents of the dissected pupa.

FIG. 6.

FIG. 6.

Open in a new tab

DmRrp6 mutant suppresses a rough eye phenotype induced by the overexpression of DmTRF4-1. (A) Physical map of the genomic location of DmRrp6. In DmRrp6f07001, the P-element was inserted in the second intron of the DmRrp6 gene. Black and gray arrows indicate predicted genes. (B) RT-PCR was performed for total RNAs from WT (lane 1) and DmRrp6 mutant (DmRrp6f07001; lane 2) third-instar larvae. A homozygote of the DmRrp6f07001 is inviable. Expression of Act5C was used as an internal control. The cycle numbers used are indicated. The relative amount of the DmRrp6 transcript in DmRrp6f07001 to that in the WT, normalized to Act5C mRNA, was also quantified graphically. The data represent the mean of three independent measurements. Error bars indicate ± the standard deviation. (C) DmRrp6 mutation suppresses the phenotype induced by overexpression of DmTRF4-1. No phenotype was observed in the WT fly (control; panel a) and DmRrp6 mutant (DmRrp6f07001) (DmRrp6 KD; panel b). Overexpression of DmTRF4-1 posterior to the MF of the eye disc caused a rough eye phenotype (GMR-GAL4/+; +; UAS-DmTRF4-1/+) (DmTRF4-1 OE; panel c). DmRrp6 mutation slightly suppressed the rough eye phenotype induced by overexpression of DmTRF4-1 (GMR-GAL4/+; +; UAS-DmTRF4-1/DmRrp6f07001) (DmTRF4-1 OE and DmRrp6 KD; panel d). Note that the rough eye phenotype is indicated by arrowheads.

Purification of recombinant DmTRF4-1 WT, mutant, and DmTRF4-2 proteins.

The entire open reading frames of DmTRF4-1 and DmTRF4-2 cDNA were amplified by PCR using the DmTRF4-1 cDNA clone (RE04457) and the DmTRF4-2 cDNA clone (LP06848) with the primer pairs PM01-PM03 and PM13-PM14, respectively (Table 1). Note that in each case the 3′-oligonucleotide primer encodes an in-frame His tag. The amplified DNA products were then subcloned into the pGEX 6P-1 expression vector (GE Healthcare Bioscience). The resulting construct was then transformed into Escherichia coli BL21(DE3) (Novagen, Madison, WI). One colony was picked and incubated in 10 ml of Terrific broth medium containing 1% (wt/vol) glucose and 50 μg of ampicillin/ml. The culture was grown overnight at 30°C and transferred into 1 liter of fresh Terrific broth medium containing 1% (wt/vol) glucose and 50 μg of ampicillin/ml. The cells were grown at 30°C until the A600 value reached 0.5 and cooled on ice for 30 min. The culture was then incubated with 100 μM IPTG (isopropyl-β-d-thiogalactopyranoside) at 16°C for 16 h. The cells were harvested by centrifugation at 4°C and washed with cold phosphate-buffered saline. After centrifugation, the cells were frozen in liquid nitrogen. The frozen cells were thawed in an ice bath and resuspended in 7 ml of His tag binding buffer (50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, 10% [vol/vol] glycerol, 0.01% [vol/vol] Nonidet P-40 [pH 8.0])/g containing 1 μg/ml each of pepstatin A and leupeptin, 1 mM phenylmethylsulfonyl fluoride, and 1 mg of lysozyme/ml. The suspension was incubated on ice for 40 min. After an equal volume of His tag binding buffer was added, the cell lysate was centrifuged for 30 min at 15,000 × g at 4°C. After filtration through a 0.45-μm-pore-size polyvinylidene difluoride membrane, the supernatant was loaded onto 1 ml of a Ni-NTA agarose column equilibrated with His tag binding buffer, washed with 50 ml of His tag wash buffer (50 mM NaH2PO4, 300 mM NaCl, 30 mM imidazole, 10% [vol/vol] glycerol, 0.01% [vol/vol] Nonidet P-40 [pH 8.0]), and eluted with 10 ml of His tag elution buffer (50 mM NaH2PO4, 100 mM NaCl, 200 mM imidazole, 10% [vol/vol] glycerol, 0.01% [vol/vol] Nonidet P-40 [pH 7.7]). After being mixed with 30 ml of TEMG buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 5 mM 2-mercaptoethanol, and 10% glycerol) containing 0.4 M NaCl, the eluted material was loaded onto a 0.3 ml glutathione-Sepharose 4B column equilibrated with TEMG buffer containing 0.4 M NaCl. The column was washed with 50 ml of TEMG buffer containing 2 M NaCl and then with 10 ml of TEMG buffer containing 0.2 M NaCl. Protein was eluted from the column with TEMG buffer (adjusted to pH 8.0) containing 10 mM glutathione (reduced form). The fractions containing protein were collected, frozen in liquid nitrogen, and then stored at −80°C until use.

The DmTRF4-1 mutant (GST-DmTRF4-1 DD328,330AA) was overexpressed and purified as for the WT protein.

PAP assay.

PAP assays were performed in 20-μl reaction mixtures containing 250 to 500 ng of the purified protein, 2.5 fmol of 5′-end-labeled oligo(A)15, 0.5 mM ATP, 0.5 mM MnCl2, 25 mM Tris-HCl (pH 7.9), 20 mM KCl, 10% glycerol, 0.01 mM EDTA, 0.1 mg of BSA/ml, 1 mM dithiothreitol, 0.02% Nonidet P-40, and 5 U of RNA Guard (Promega). As indicated in the figure legends, in some experiments we modified the components of the above reaction in the following ways: 5 mM MgCl2 replaced MnCl2 (see Fig. 2C, lanes 2 and 6); both 0.5 mM MnCl2 and 5 mM MgCl2 were added at the same time (see Fig. 2C, lanes 4 and 8); and the reaction mixture contained 0.5 mM concentrations of either GTP, UTP, or CTP instead of ATP (see Fig. 2D). Assay mixtures were assembled on ice and incubated at 30°C for the times indicated and stopped by the addition of loading buffer (20 μl) containing 95% formamide, 0.025% bromophenol blue, 0.025% xylene cyanol FF, and 0.5 mM EDTA. The reaction products were resolved on 20% polyacrylamide gels containing 8 M urea. After drying, the gel was exposed to BioMax MS-1 film (Kodak).

FIG. 2.

FIG. 2.

Open in a new tab

DmTRF4-1, but not DmTRF4-2, exhibits PAP activity. (A) Purified GST fusion protein containing WT DmTRF4-1 (GST-DmTRF4-1 WT; lane 1) and mutant DmTRF4-1 (GST-DmTRF4-1 DD328,330AA; lane 2), in which aspartate residues at positions 328 and 330 have been changed to alanine, and WT DmTRF4-2 (GST-DmTRF4-2 WT; lane 3) were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 7.5 or 12.5% polyacrylamide gel and stained with Coomassie brilliant blue (1.0 μg of each). The positions of the purified proteins are indicated by an asterisk. (B) DmTRF4-1 has PAP activity, but DmTRF4-2 has no activity in vitro. GST-DmTRF4-1 WT (lane 2 to 3) (250 ng), GST-DmTRF4-1 DD328,330AA (lane 4) (500 ng), and GST-DmTRF4-2 WT (lane 5 to 6) (350 ng) were incubated with 5′-end-labeled oligo(A)15 in the presence of 0.5 mM Mn2+ at 30°C. A control reaction with no enzyme is shown in lane 1. (C) Mg2+ versus Mn2+ dependence. GST-DmTRF4-1 WT (250 ng) was incubated with 5′-end-labeled oligo(A)15 in the presence of either Mg2+ (5 mM; lane 2), Mn2+ (0.5 mM; lane 3), or both Mg2+ and Mn2+ ions (5 and 0.5 mM, respectively; lane 4) at 30°C for 30 min. GST-DmTRF4-2 WT (350 ng) was incubated with 5′-end-labeled oligo(A)15 in the presence of either Mg2+ (5 mM; lane 6), Mn2+ (0.5 mM; lane 7), or both Mg2+ and Mn2+ ions (5 and 0.5 mM, respectively; lane 8) at 30°C for 30 min. A control reaction with no cations is shown in lanes 1 and 5. (D) Nucleotide substrate dependence. GST-DmTRF4-1 WT (250 ng) was incubated with 5′-end-labeled oligo(A)15 in the presence of either ATP (lane 1), GTP (lane 2), CTP (lane 3), or UTP (lane 4) at 30°C for 30 min. All PAP polymerase reaction products were resolved on a 20% polyacrylamide-8 M urea gels and visualized by using autoradiography.

Cell culture, plasmid construction, and transfection.

S2 cells were cultured in Schneider's Drosophila medium (Invitrogen) containing 10% heat-inactivated fetal bovine serum at 25°C. The expression vector for V5-tagged DmTRF4-1 WT and mutant was constructed by subcloning the DmTRF4-1 coding region, using the primer pair PM01-PM04, into pAc5.1/V5-His A (Invitrogen). All transfections and establishment of the stable cell lines were performed in accordance with the manufacturer's protocols (Invitrogen).

Immunofluorescence analysis.

S2 cells were placed on poly-(l-lysine)-coated coverslips and fixed with 4% paraformaldehyde in NaCl/Pi for 10 min at room temperature. After several washes with NaCl/Pi, the cells were treated with methanol for permeabilization. The samples were incubated with primary antibodies, mouse monoclonal anti-V5 antibody (Invitrogen) and rabbit polyclonal antifibrillarin antibody (Abcam, Cambridge, MA) (used as a nucleolar marker), at 4°C overnight and then treated for 1 h with the secondary antibodies Alexa546 anti-mouse immunoglobulin G and Alexa488 anti-rabbit immunoglobulin G (Molecular Probes, Eugene, OR). Samples were also counterstained with DAPI (4′,6′-diamidino-2-phenylindole). The preparations were observed under a fluorescence microscope, and the data were collected using a charge-coupled device camera (Nikon, Chiyoda, Japan).

Oligonucleotides.

The oligonucleotide sequences used in the present study as primers and probes are shown Table 1.

RESULTS

The Drosophila genome contains two homologues of S. cerevisiae Trf4.

A search of the Drosophila genome database (Flybase [http://flybase.bio.indiana.edu/]) identified two genes homologous to ScTrf4, which are named CG11265 and CG17462 (DmTRF4-1 and DmTRF4-2, respectively). The predicted protein product of DmTRF4-1 is composed of 1,001 amino acids and contains a unique sequence with no homology to any known protein in both the N-terminal and the C-terminal regions (Fig. 1A). In contrast, DmTRF4-2 encodes a predicted protein of 407 amino acids (Fig. 1A). The Trf4/5 family is a divergent member of the DNA polymerase β-nucleotidyltransferase superfamily (25, 43, 53), which includes CCA-adding enzymes, DNA polymerases, and eukaryotic nuclear canonical PAPs. The catalytic domain, consisting of the nucleotidyltransferase domain and PAP-associated domain, is well conserved among the Trf4/5 family members. We compared the sequences of these domains from ScTrf4, DmTRF4-1, and DmTRF4-2. DmTRF4-1 and DmTRF4-2 display 36% identity (55% similarity) and 31% identity (50% similarity) with ScTRF4, respectively (Fig. 1A and B). The catalytic domains of DmTRF4-1 and DmTRF4-2 display 48% identity (65% similarity). We performed Northern blot analysis to analyze the expression patterns of these genes over the range of developmental stages. Both DmTRF4 mRNAs were highly transcribed in unfertilized eggs and in the early embryonic stages from 0 to 4 h (Fig. 1C).

DmTRF4-1, but not DmTRF4-2, exhibits PAP activity in vitro.

To test whether DmTRF4-1 and DmTRF4-2 possess PAP activity, we induced expression of a glutathione S-transferase (GST) fusion protein containing DmTRF4-1 and DmTRF4-2 with a 3′ terminal His tag (GST-DmTRF4-1 and GST-TRF4-2) in Escherichia coli. Soluble GST-DmTRF4-1 and -2 were purified on Ni-NTA agarose and glutathione-Sepharose columns (Fig. 2A, lanes 1 and 3). Purified GST-DmTRF4-1 displayed PAP activity (Fig. 2B, lanes 2 to 3). To confirm the absence of E. coli PAP enzymes, we constructed a DmTRF4-1 inactive mutant (GST-DmTRF4-1 DD328,330AA) in which the aspartate residues 328 and 330 were replaced with alanine (Fig. 1B). These residues correspond to the conserved amino acids essential for catalysis in many polymerase β families (29). The GST-DmTRF4-1 DD328,330AA was expressed and purified by the same procedures as for the WT protein (Fig. 2A, lane 2). The GST-DmTRF4-1 DD328,330AA showed no PAP activity (Fig. 2B, lane 4), indicating that GST-DmTRF4-1 protein was responsible for the enzyme activity and not a coprecipitating contaminant. GST-DmTRF4-1 requires Mn2+ for its PAP activity rather than Mg2+ (Fig. 2C, lanes 1 to 4). Furthermore, GST-DmTRF4-1 showed a high degree of selectivity for ATP incorporation into poly(A) RNA, whereas GTP, CTP, and UTP were incorporated very poorly (Fig. 2D). GST-DmTRF4-2 displayed no PAP activity in the presence of either Mn2+ or Mg2+ (see Fig. 2B, lanes 5 to 6; Fig. 2C, lanes 5 to 8).

Although it was initially reported that ScTrf4 is inactive in the absence of accessory proteins (25, 43, 53), a recent study showed that Trf4 and Trf5 exhibit significant PAP activity in isolation (14). Similarly, GST-DmTRF4-1 does not require any accessory proteins for PAP activity in vitro.

DmTRF4-1, but not DmTRF4-2, is essential for development in D. melanogaster.

We searched for disruption mutants in the Gal4 Enhancer Trap Insertion Database (GETDB [http://flymap.lab.nig.ac.jp/∼dclust/getdb.html]). The DmTRF4-1 knockout mutant was not stocked, but a strain with a disrupted DmTRF4-2 was found. In this mutant, CG17462NP2505, the P element was inserted in the 5′-untranslated region of the DmTRF4-2 (CG17462) gene (Fig. 3A). We performed semiquantitative PT-PCR and confirmed that CG17462NP2505 was a null mutant of DmTRF4-2 (Fig. 3B). The CG17462NP2505 homozygous mutants were viable and fertile despite lacking DmTRF4-2, indicating that DmTRF4-2 is not essential for viability. To address the in vivo function of DmTRF4-1, we established transgenic fly lines carrying UAS-Dmtrf4-1 IR, which causes an RNA interference-induced knockdown of the DmTRF4-1 transcript when crossing a GAL4 driver (Fig. 3C and 5A). The ubiquitous knockdown of DmTRF4-1 driven by Act5C-GAL4 caused third-instar-larval or early pupal lethality (Fig. 3D), which is reminiscent of trf4 trf5 double mutants (5). These results indicate that DmTRF4-1 is essential for development in D. melanogaster and that DmTRF4-2 is unable to complement DmTRF4-1.

Our experiments using the recombinant proteins and the transgenic flies suggested that DmTRF4-1, like ScTrf4/5, might play a crucial role in RNA quality control. In contrast, DmTRF4-2 appears to be inessential, although we cannot rule out the possibility that the protein is also involved in the same pathway. Therefore, we focused on the characterization of DmTRF4-1 in the present study.

DmTRF4-1 is a nucleolar protein.

To investigate the subcellular localization of DmTRF4-1, we attempted to generate Schneider 2 (S2) cells expressing V5-tagged DmTRF4-1 WT under the control of an Actin5C promoter. Unfortunately, we were unable to obtain the desired cell line. This was probably caused by the high-level expression of V5-tagged DmTRF4-1 WT being toxic to S2 cells. We then attempted to visualize the subcellular localization of V5-tagged DmTRF4-1 DD328, 330AA mutant by using immunofluorescence microscopy. We found that DmTRF4-1 DD328,330AA overlapped with the nucleolar marker, fibrillarin (Fig. 4), suggesting that the DmTRF4-1 is a nucleolar protein. It is widely thought that Trf4 family members are nuclear protein (44). However, our findings are consistent with the recent observation that S. pombe Cid14 is a nuclear protein enriched in the nucleolus (51).

FIG. 4.

FIG. 4.

Open in a new tab

Subcellular localization of DmTRF4-1 in living S2 cells. The S2 cells overexpressing V5-tagged DmTRF4-1 DD328,330AA was immunostained with anti-V5 antibody (red) (A and A′) and antifibrillarin (green) (B and B′), as a nucleolar marker, and stained with DAPI (blue) (C and C′). The merge is shown in (D and D′). The lower panels are a high-magnification view.

An abnormal morphogenesis induced by the overexpression of DmTRF4-1 is partially rescued by suppression of DmRrp6.

To address the function of DmTRF4-1 in vivo, we established transgenic fly lines carrying UAS-DmTRF4-1, where overexpression of DmTRF4-1 is induced by crossing a GAL4 driver. Ubiquitous overexpression of DmTRF4-1 using the Act5C-GAL4 driver caused embryonic lethality. In addition, flies overexpressing DmTRF4-1 in which knockdown of DmTRF4-1 was induced using the Act5C-GAL4 driver were also inviable (data not shown). The knockdown of DmTRF4-1 using the Hsp70-GAL4 driver, which transiently induced the transcript of the GAL4 gene by heat shock, decreased the amount of the DmTRF4-1 transcripts (Fig. 5A, lane 2), whereas the overexpression of DmTRF4-1 using the Hsp70-GAL4 driver increased the amount of the DmTRF4-1 transcripts (Fig. 5A, lane 3). The simultaneous overexpression and knockdown of DmTRF4-1 using the Hsp70-GAL4 driver almost restored the amount of the DmTRF4-1 transcripts close to its normal level (Fig. 5A, lane 4). Moreover, knockdown of DmTRF4-1 posterior to the morphogenetic furrow (MF) of the eye disc using the GMR-GAL4 driver suppressed rough eye phenotypes induced by overexpression of DmTRF4-1 (Fig. 5Bc and d), although a phenotype was not detectable by knockdown of DmTRF4-1 using this driver. These data suggest that the UAS-DmTRF4-1 and UAS-Dmtrf4-1 IR lines specifically regulate the amount of DmTRF4-1 transcript. When the UAS-DmTRF4-1 strain was mated with the MS1096-GAL4 strain and the ey-GAL4 strain, expressing GAL4 in the wing discs and in eye-antennal discs, respectively, the progeny flies carrying both the GAL4 driver and UAS-DmTRF4-1 displayed a shrunken wing phenotype and a headless phenotype (Fig. 5C and D), whereas a phenotype was not detectable by knockdown of DmTRF4-1 using these drivers. These data suggest that overexpression of DmTRF4-1 induced an abnormal morphogenesis.

Previous studies demonstrated that the RNAs polyadenylated by ScTrf4 are exposed to exosome-mediated degradation (9, 20, 21, 25, 43, 53). Rrp6, a 3′-5′ exonuclease, plays a key role in this degradation machinery (30). The homozygote of the DmRrp6f07001, where the P-element is inserted into the second intron of the DmRrp6 gene (Fig. 6A), is inviable. The heterozygote of the DmRrp6f07001 expressed approximately half the amount of DmRrp6 transcript compared to the WT (Fig. 6B). We crossed the flies overexpressing DmTRF4-1 with the DmRrp6 mutant. A rough eye phenotype caused by overexpression of DmTRF4-1 was partially rescued in the DmRrp6 heterozygous background, whereas DmRrp6 heterozygous mutants displayed no rough eye phenotype (Fig. 6C).

Overexpression of DmTRF4-1 caused accumulation of polyadenylated snRNAs.

It is possible that an aberrant polyadenylation of RNA substrates by DmTRF4-1 interferes with the morphogenetic process. To address this possibility, we examined the polyadenylation of RNAs from third-instar larvae of W (control), heterozygous DmRrp6f07001 (DmRrp6 KD), UAS-Dmtrf4-1 IR (DmTRF4-1 KD), UAS-Dmtrf4-1 IR and heterozygous DmRrp6f07001 (DmTRF4-1 KD and DmRrp6 KD), UAS-DmTRF4-1 (DmTRF4-1 OE), UAS-DmTRF4-1, and heterozygous DmRrp6f07001 (DmTRF4-1 OE and DmRrp6 KD) lines crossed with the Hsp70-GAL4 driver. Polyadenylated RNAs were purified from total RNAs using oligo(dT)-immobilized beads [poly(A)+ RNA fraction]. We found that the band mobility of snRNAs was shifted up to approximately 500 nucleotides in the poly(A)+ RNA fraction from the transgenic flies overexpressing DmTRF4-1 (DmTRF4-1 OE) and DmTRF4-1 in the heterozygous DmRrp6f07001 background (DmTRF4-1 OE and DmRrp6 KD) (Fig. 7A to E, middle panels, lanes 11 and 12). In addition, an increase in the elongated snRNAs (1.6- to 2.5-fold) was observed in the DmTRF4-1 OE and DmRrp6 KD compared to that in the DmTRF4-1 OE. We next treated the poly(A)+ RNA fractions with oligo(dT) and RNaseH [poly(A)− RNA fraction]. The RNase H enzyme hydrolyzes the 3′-terminal phosphodiester bonds of RNA hybridized to DNA. This resulted in a dramatic decrease in the length of snRNAs (Fig. 7A to E, right panels, lanes 17 and 18). These data indicate that the overexpressed DmTRF4-1 catalyzes the extraordinary polyadenylation of snRNAs and that the abnormally polyadenylated snRNAs by overexpression of DmTRF4-1 are digested in a DmRrp6-dependent manner. In contrast, no aberrant polyadenylation of snRNAs was detectable in the poly(A)+ RNA fraction from the other flies (Fig. 7A to E, middle panels, lanes 7 to 10), whereas snRNAs were abundant in the total RNA fractions. This is probably because the polyadenylated snRNAs were subject to immediate degradation under normal conditions. Several reports indicate that noncoding RNAs and tRNAs are targets for polyadenylation by Saccharomyces cerevisiae Trf4 (9, 21, 25, 43, 53). Thus, we also tested the polyadenylation of several kinds of snoRNAs and tRNAs. However, no signal could be detected in the present study (data not shown).

DISCUSSION

In this study, we identified two kinds of Trf4 homologue genes from D. melanogaster, DmTRF4-1 and DmTRF4-2, which are expressed with the same pattern during development. Only DmTRF4-1 displays substantial PAP activity in vitro, and transgenic flies in which the expression of DmTRF4-1 is either upregulated or downregulated were inviable. These results suggest that DmTRF4-1 is an essential PAP, as well as ScTrf4 and ScTrf5, and that the DmTRF4-1 expression level is strictly regulated in vivo. In contrast, DmTRF4-2 did not polyadenylate RNA substrates. Previous studies indicated that ScTrf4 alone has no polyadenylation activity and suggested that ScTrf4 is the catalytic subunit of the TRAMP complex in which the Air1 and Air2 proteins confer poly(A) addition activity to the Trf4 subunit by providing the RNA-binding domain (25, 43, 53). It is likely that various accessory proteins may allow Trf4 to target different substrates in different situations. Therefore, it is possible that DmTRF4-2 proteins may show PAP activity through interaction with accessory proteins. However, because disruption of DmTRF4-2 does not generate an abnormal phenotype, the biological role of DmTRF4-2 is presumably complemented by other proteins.

Our experiments suggest that DmTRF4-1 is localized in the nucleoli and reveal that overexpression of DmTRF4-1 induces an extraordinary polyadenylation of snRNAs. Recently, Cid14 was identified as a nucleolar protein (51). Furthermore, it was reported that polyadenylated RNAs accumulate in the nucleoli of yeast cells lacking either Rrp6 or Mtr4 (4), suggesting that polyadenylation-dependent exosome-mediated degradation mainly occurs in nucleoli. In addition, it has been found that the vertebrate snRNAs are transiently transferred to the nucleoli (12, 26), where snRNAs undergo common internal modification, including pseudouridylation and 2′-O-methylation (54). These observations suggest that DmTRF4-1 catalyzes polyadenylation of snRNAs in the nucleoli, where snRNAs are exposed to posttranscriptional modification.

We found that overexpression of DmTRF4-1 in the eye disc causes the rough eye phenotype, which is partially rescued by the suppression of Rrp6. This phenotype might result from abnormal degradation of the polyadenylated snRNAs caused by constitutive overexpression of DmTRF4-1, leading to disruption of normal RNA splicing. Suppression of DmRrp6 might moderate the rough eye phenotype by inhibiting the degradation of the polyadenylated snRNAs, although it is unclear whether the polyadenylated snRNAs retain a normal function. We detected polyadenylated snRNAs only in the DmTRF4-1-overexpressing background, probably because the rate of polyadenylation by overexpressed DmTRF4-1 exceeds that of DmRrp6-mediated degradation. Unfortunately, we could not examine the polyadenylation of snRNAs using the DmRrp6 null mutant because DmRrp6 is an essential gene in Drosophila. However, enhanced accumulation of polyadenylated snRNAs in the DmTRF4-1 overexpressing and heterozygous DmRrp6f07001 background suggests that the snRNAs polyadenylated by DmTRF4-1 are digested in the DmRrp6-dependent pathway. In contrast, we could not detect polyadenylation of snoRNAs and tRNAs even under conditions where the transcription of DmTRF4-1 was stimulated. In yeast, the elongated RNAs were detectable only in the rrp6-null mutant. Polyadenylation was tested by transient overexpression of DmTRF4-1 using the Hsp-GAL4 driver. We cannot rule out the possibility that these noncoding RNAs and tRNAs are targets of polyadenylation catalyzed by DmTRF4-1 under normal conditions. Therefore, ubiquitous overexpression of DmTRF4-1 might cause an abnormal polyadenylation of RNAs other than snRNAs that could not be detected by the transient overexpression. Such polyadenylation might lead to the rough eye phenotype.

Trf4 and GLD-2 proteins are often considered as a single family. However, we propose these proteins should be classified into two distinct families; the nuclear/nucleolar noncanonical PAP family and the cytoplasmic noncanonical PAP family. In fact, it seems more likely that each member is conserved, respectively, in eukaryotes, except S. cerevisiae, in which the candidate gene of cytoplasmic noncanonical PAP, as a homologue of GLD-2, does not exist (40). Indeed, a homology search of the Drosophila genome sequence database shows CG5732 and CG15737 are similar to GLD-2 (data not shown). Thus, we speculate that CG5732 and/or CG15737 may play a role as a cytoplasmic noncanonical PAP. We suggest that various PAPs, including the Trf4 family, GLD-2 family, mitochondrial PAP and nuclear canonical PAP, play important roles in diverse biological processes, in different cellular locations.

Here, we focused on the function of DmTRF4-1 in RNA surveillance. However, a previous study using two-hybrid screening showed that DmTRF4-1 (CG11265) might interact with several components of the Hedgehog signaling (Hh) pathway, including suppressor of fused protein and kinesin-like protein Costal2 (10). The Hh signaling pathway is important for development, which regulate the transcription of specific target genes, resulting in the control of growth and differentiation (17, 38). Therefore, it is possible that DmTRF4-1 might participate not only in an RNA quality control but also in the Hh pathway, although we have never tested whether this protein interacts with the Hh factors.

In summary, we identified the Drosophila homologues of ScTrf4/5, named DmTRF4-1 and DmTRF4-2. Only DmTRF4-1 possesses PAP activity, and both the DmTRF4-1 knockdown and the overexpressing mutants were inviable, suggesting that transcription of this gene must be strictly regulated for development. DmTRF4-1 is localized in nucleoli, and the overexpression of DmTRF4-1 induced an extraordinary polyadenylation of snRNAs. Moreover, enhanced accumulation of the polyadenylated snRNAs was observed by suppression of DmRrp6. From these data, we suggest that DmTRF4-1 plays an important role in the regulation of RNA quality in vivo.

Acknowledgments

We thank the Bloomington Stock Center, the Drosophila Genetic Resource Center at the Kyoto Institute of Technology, and The Exelixis Collection at the Harvard Medical School for the fly stocks. We thank Kenji Matsuno (Tokyo University of Science) for technical assistance and Ai Saotome (National Institute of Sensory Organs) for valuable comments.

Footnotes

▿

Published ahead of print on 2 September 2008.

REFERENCES

  • 1.Barnard, D. C., K. Ryan, J. L. Manley, and J. D. Richter. 2004. Symplekin and xGLD-2 are required for CPEB-mediated cytoplasmic polyadenylation. Cell 119641-651. [DOI] [PubMed] [Google Scholar]
  • 2.Buhler, M., W. Haas, S. P. Gygi, and D. Moazed. 2007. RNAi-dependent and -independent RNA turnover mechanisms contribute to heterochromatic gene silencing. Cell 129707-721. [DOI] [PubMed] [Google Scholar]
  • 3.Capdevila, J., and I. Guerrero. 1994. Targeted expression of the signaling molecule decapentaplegic induces pattern duplications and growth alterations in Drosophila wings. EMBO J. 134459-4468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Carneiro, T., C. Carvalho, J. Braga, J. Rino, L. Milligan, D. Tollervey, and M. Carmo-Fonseca. 2007. Depletion of the yeast nuclear exosome subunit Rrp6 results in accumulation of polyadenylated RNAs in a discrete domain within the nucleolus. Mol. Cell. Biol. 274157-4165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Castano, I. B., S. Heath-Pagliuso, B. U. Sadoff, D. J. Fitzhugh, and M. F. Christman. 1996. A novel family of TRF (DNA topoisomerase I-related function) genes required for proper nuclear segregation. Nucleic Acids Res. 242404-2410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cheng, Z. F., and M. P. Deutscher. 2005. An important role for RNase R in mRNA decay. Mol. Cell 17313-318. [DOI] [PubMed] [Google Scholar]
  • 7.Coller, J. M., N. K. Gray, and M. P. Wickens. 1998. mRNA stabilization by poly(A) binding protein is independent of poly(A) and requires translation. Genes Dev. 123226-3235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dreyfus, M., and P. Regnier. 2002. The poly(A) tail of mRNAs: bodyguard in eukaryotes, scavenger in bacteria. Cell 111611-613. [DOI] [PubMed] [Google Scholar]
  • 9.Egecioglu, D. E., A. K. Henras, and G. F. Chanfreau. 2006. Contributions of Trf4p- and Trf5p-dependent polyadenylation to the processing and degradative functions of the yeast nuclear exosome. RNA 1226-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fouix, S., S. Martin-Lanneree, M. Sanial, L. Morla, C. Lamour-Isnard, and A. Plessis. 2003. Over-expression of a novel nuclear interactor of Suppressor of fused, the Drosophila myelodysplasia/myeloid leukaemia factor, induces abnormal morphogenesis associated with increased apoptosis and DNA synthesis. Genes Cells 8897-911. [DOI] [PubMed] [Google Scholar]
  • 11.Freeman, M. 1996. Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophila eye. Cell 87651-660. [DOI] [PubMed] [Google Scholar]
  • 12.Gerbi, S. A., and T. S. Lange. 2002. All small nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP localize to nucleoli; Identification of the nucleolar localization element of U6 snRNA. Mol. Biol. Cell 133123-3137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Halder, G., P. Callaerts, S. Flister, U. Walldorf, U. Kloter, and W. J. Gehring. 1998. Eyeless initiates the expression of both sine oculis and eyes absent during Drosophila compound eye development. Development 1252181-2191. [DOI] [PubMed] [Google Scholar]
  • 14.Haracska, L., R. E. Johnson, L. Prakash, and S. Prakash. 2005. Trf4 and Trf5 proteins of Saccharomyces cerevisiae exhibit poly(A) RNA polymerase activity but no DNA polymerase activity. Mol. Cell. Biol. 2510183-10189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Houseley, J., K. Kotovic, A. El Hage, and D. Tollervey. 2007. Trf4 targets ncRNAs from telomeric and rDNA spacer regions and functions in rDNA copy number control. EMBO J. 264996-5006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Houseley, J., and D. Tollervey. 2006. Yeast Trf5p is a nuclear poly(A) polymerase. EMBO Rep. 7205-211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ingham, P. W., and A. P. McMahon. 2001. Hedgehog signaling in animal development: paradigms and principles. Genes Dev. 153059-3087. [DOI] [PubMed] [Google Scholar]
  • 18.Jiao, R., M. Daube, H. Duan, Y. Zou, E. Frei, and M. Noll. 2001. Headless flies generated by developmental pathway interference. Development 1283307-3319. [DOI] [PubMed] [Google Scholar]
  • 19.Jurica, M. S., and M. J. Moore. 2003. Pre-mRNA splicing: awash in a sea of proteins. Mol. Cell 125-14. [DOI] [PubMed] [Google Scholar]
  • 20.Kadaba, S., A. Krueger, T. Trice, A. M. Krecic, A. G. Hinnebusch, and J. Anderson. 2004. Nuclear surveillance and degradation of hypomodified initiator tRNAMet in Saccharomyces cerevisiae. Genes Dev. 181227-1240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kadaba, S., X. Wang, and J. T. Anderson. 2006. Nuclear RNA surveillance in Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated tRNA and an aberrant form of 5S rRNA. RNA 12508-521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kushner, S. R. 2002. mRNA decay in Escherichia coli comes of age. J. Bacteriol. 1844658-4665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kwak, J. E., L. Wang, S. Ballantyne, J. Kimble, and M. Wickens. 2004. Mammalian GLD-2 homologs are poly(A) polymerases. Proc. Natl. Acad. Sci. USA 1014407-4412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kwak, J. E., and M. Wickens. 2007. A family of poly(U) polymerases. RNA 13860-867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.LaCava, J., J. Houseley, C. Saveanu, E. Petfalski, E. Thompson, A. Jacquier, and D. Tollervey. 2005. RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121713-724. [DOI] [PubMed] [Google Scholar]
  • 26.Lange, T. S., and S. A. Gerbi. 2000. Transient nucleolar localization Of U6 small nuclear RNA in Xenopus laevis oocytes. Mol. Biol. Cell 112419-2428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Li, Z., S. Reimers, S. Pandit, and M. P. Deutscher. 2002. RNA quality control: degradation of defective transfer RNA. EMBO J. 211132-1138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Madhani, H. D., and C. Guthrie. 1994. Dynamic RNA-RNA interactions in the spliceosome. Annu. Rev. Genet. 281-26. [DOI] [PubMed] [Google Scholar]
  • 29.Martin, G., and W. Keller. 1996. Mutational analysis of mammalian poly(A) polymerase identifies a region for primer binding and catalytic domain, homologous to the family X polymerases, and to other nucleotidyltransferases. EMBO J. 152593-2603. [PMC free article] [PubMed] [Google Scholar]
  • 30.Mitchell, P., E. Petfalski, A. Shevchenko, M. Mann, and D. Tollervey. 1997. The exosome: a conserved eukaryotic RNA processing complex containing multiple 3′→5′ exoribonucleases. Cell 91457-466. [DOI] [PubMed] [Google Scholar]
  • 31.Nagaike, T., T. Suzuki, T. Katoh, and T. Ueda. 2005. Human mitochondrial mRNAs are stabilized with polyadenylation regulated by mitochondria-specific poly(A) polymerase and polynucleotide phosphorylase. J. Biol. Chem. 28019721-19727. [DOI] [PubMed] [Google Scholar]
  • 32.O'Hara, E. B., J. A. Chekanova, C. A. Ingle, Z. R. Kushner, E. Peters, and S. R. Kushner. 1995. Polyadenylylation helps regulate mRNA decay in Escherichia coli. Proc. Natl. Acad. Sci. USA 921807-1811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Proudfoot, N. J., A. Furger, and M. J. Dye. 2002. Integrating mRNA processing with transcription. Cell 108501-512. [DOI] [PubMed] [Google Scholar]
  • 34.Read, R. L., R. G. Martinho, S. W. Wang, A. M. Carr, and C. J. Norbury. 2002. Cytoplasmic poly(A) polymerases mediate cellular responses to S phase arrest. Proc. Natl. Acad. Sci. USA 9912079-12084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Reis, C. C., and J. L. Campbell. 2007. Contribution of Trf4/5 and the nuclear exosome to genome stability through regulation of histone mRNA levels in Saccharomyces cerevisiae. Genetics 175993-1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rissland, O. S., A. Mikulasova, and C. J. Norbury. 2007. Efficient RNA polyuridylation by noncanonical poly(A) polymerases. Mol. Cell. Biol. 273612-3624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rouhana, L., L. Wang, N. Buter, J. E. Kwak, C. A. Schiltz, T. Gonzalez, A. E. Kelley, C. F. Landry, and M. Wickens. 2005. Vertebrate GLD2 poly(A) polymerases in the germline and the brain. RNA 111117-1130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ruiz i Altaba, A. 1999. The works of GLI and the power of hedgehog. Nat. Cell Biol. 1E147-E148. [DOI] [PubMed] [Google Scholar]
  • 39.Saitoh, S., A. Chabes, W. H. McDonald, L. Thelander, J. R. Yates, and P. Russell. 2002. Cid13 is a cytoplasmic poly(A) polymerase that regulates ribonucleotide reductase mRNA. Cell 109563-573. [DOI] [PubMed] [Google Scholar]
  • 40.Stevenson, A. L., and C. J. Norbury. 2006. The Cid1 family of non-canonical poly(A) polymerases. Yeast 23991-1000. [DOI] [PubMed] [Google Scholar]
  • 41.Takata, K., H. Yoshida, M. Yamaguchi, and K. Sakaguchi. 2004. Drosophila damaged DNA-binding protein 1 is an essential factor for development. Genetics 168855-865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tomecki, R., A. Dmochowska, K. Gewartowski, A. Dziembowski, and P. P. Stepien. 2004. Identification of a novel human nuclear-encoded mitochondrial poly(A) polymerase. Nucleic Acids Res. 326001-6014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Vanacova, S., J. Wolf, G. Martin, D. Blank, S. Dettwiler, A. Friedlein, H. Langen, G. Keith, and W. Keller. 2005. A new yeast poly(A) polymerase complex involved in RNA quality control. PLoS Biol. 3e189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Walowsky, C., D. J. Fitzhugh, I. B. Castano, J. Y. Ju, N. A. Levin, and M. F. Christman. 1999. The topoisomerase-related function gene TRF4 affects cellular sensitivity to the antitumor agent camptothecin. J. Biol. Chem. 2747302-7308. [DOI] [PubMed] [Google Scholar]
  • 45.Wang, L., C. R. Eckmann, L. C. Kadyk, M. Wickens, and J. Kimble. 2002. A regulatory cytoplasmic poly(A) polymerase in Caenorhabditis elegans. Nature 419312-316. [DOI] [PubMed] [Google Scholar]
  • 46.Wang, S. W., A. L. Stevenson, S. E. Kearsey, S. Watt, and J. Bahler. 2008. Global role for polyadenylation-assisted nuclear RNA degradation in posttranscriptional gene silencing. Mol. Cell. Biol. 28656-665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wang, S. W., T. Toda, R. MacCallum, A. L. Harris, and C. Norbury. 2000. Cid1, a fission yeast protein required for S-M checkpoint control when DNA polymerase delta or epsilon is inactivated. Mol. Cell. Biol. 203234-3244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Wang, Z., I. B. Castano, C. Adams, C. Vu, D. Fitzhugh, and M. F. Christman. 2002. Structure/function analysis of the Saccharomyces cerevisiae Trf4/Pol sigma DNA polymerase. Genetics 160381-391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wang, Z., I. B. Castano, A. De Las Penas, C. Adams, and M. F. Christman. 2000. Pol kappa: a DNA polymerase required for sister chromatid cohesion. Science 289774-779. [DOI] [PubMed] [Google Scholar]
  • 50.West, S., N. Gromak, C. J. Norbury, and N. J. Proudfoot. 2006. Adenylation and exosome-mediated degradation of cotranscriptionally cleaved pre-messenger RNA in human cells. Mol. Cell 21437-443. [DOI] [PubMed] [Google Scholar]
  • 51.Win, T. Z., S. Draper, R. L. Read, J. Pearce, C. J. Norbury, and S. W. Wang. 2006. Requirement of fission yeast Cid14 in polyadenylation of rRNAs. Mol. Cell. Biol. 261710-1721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wu, L., D. Wells, J. Tay, D. Mendis, M. A. Abbott, A. Barnitt, E. Quinlan, A. Heynen, J. R. Fallon, and J. D. Richter. 1998. CPEB-mediated cytoplasmic polyadenylation and the regulation of experience-dependent translation of alpha-CaMKII mRNA at synapses. Neuron 211129-1139. [DOI] [PubMed] [Google Scholar]
  • 53.Wyers, F., M. Rougemaille, G. Badis, J. C. Rousselle, M. E. Dufour, J. Boulay, B. Regnault, F. Devaux, A. Namane, B. Seraphin, D. Libri, and A. Jacquier. 2005. Cryptic pol II transcripts are degraded by a nuclear quality control pathway involving a new poly(A) polymerase. Cell 121725-737. [DOI] [PubMed] [Google Scholar]
  • 54.Yu, Y. T., M. D. Shu, A. Narayanan, R. M. Terns, M. P. Terns, and J. A. Steitz. 2001. Internal modification of U2 small nuclear (sn)RNA occurs in nucleoli of Xenopus oocytes. J. Cell Biol. 1521279-1288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Zhao, J., L. Hyman, and C. Moore. 1999. Formation of mRNA 3′ ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol. Mol. Biol. Rev. 63405-445. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES