Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2008 Sep 12;74(21):6782–6791. doi: 10.1128/AEM.01285-08

Diverse Phage-Encoded Toxins in a Protective Insect Endosymbiont ▿ †

Patrick H Degnan 1,*, Nancy A Moran 1
PMCID: PMC2576707  PMID: 18791000

Abstract

The lysogenic bacteriophage APSE infects “Candidatus Hamiltonella defensa,” a facultative endosymbiont of aphids and other sap-feeding insects. This endosymbiont has established a beneficial association with aphids, increasing survivorship following attack by parasitoid wasps. Although APSE and “Ca. Hamiltonella defensa” are effectively maternally transmitted between aphid generations, they can also be horizontally transferred among insect hosts, which results in genetically distinct “Ca. Hamiltonella defensa” strains infecting the same aphid species and sporadic distributions of both APSE and “Ca. Hamiltonella defensa” among hosts. Aphids infected only with “Ca. Hamiltonella defensa” have significantly less protection than those infected with both “Ca. Hamiltonella defensa” and APSE. This protection has been proposed to be connected to eukaryote-targeted toxins previously discovered in the genomes of two characterized APSE strains. In this study, we have sequenced partial genomes from seven additional APSE strains to address the evolution and extent of toxin variation in this phage. The APSE lysis region has been a hot spot for nonhomologous recombination of novel virulence cassettes. We identified four new toxins from three protein families, Shiga-like toxin, cytolethal distending toxin, and YD-repeat toxins. These recombination events have also resulted in reassortment of the downstream lysozyme and holin genes. Analysis of the conserved APSE genes flanking the variable toxin cassettes reveals a close phylogenetic association with phage sequences from two other facultative endosymbionts of insects. Thus, phage may act as a conduit for ongoing gene exchange among heritable endosymbionts.


Bacteriophage genomes are in a state of constant flux, reflecting a propensity to undergo rampant recombination (47, 49, 72). As such, phage are an important vector for horizontal gene transfer (HGT) within and between bacterial species (15, 19, 63). In addition, integrated temperate phage (prophage) frequently constitute the single greatest source of genomic variation among closely related bacterial strains (9, 16, 17). This flexible pool of phage-encoded loci has wide-ranging effects that can alter a bacterial host's antigenicity, toxicity, or even metabolic capacity (4, 43, 87).

While infection by multiple phage types is common in free-living bacteria, phage are completely absent from bacteria with host-restricted lifestyles, such as obligate intracellular mutualists of insects (2, 24, 60, 86, 90). However, among facultative (secondary) endosymbionts of insects, several phage have been found (21, 44, 54, 83, 85, 91). APSE, a lambda-like phage, infects “Candidatus Hamiltonella defensa,” a facultative endosymbiont known from a wide range of sap-feeding insects (aphids, mealybugs, psyllids, and whiteflies) (20, 22, 59, 74, 77). Pea aphids, Acyrthosiphon pisum (Hemiptera: Aphididae), infected with “Ca. Hamiltonella defensa” and APSE are significantly more successful at surviving attempted parasitism by the solitary endoparasitoid wasps Aphidius ervi and Aphidius eadyi (Hymenoptera: Braconidae) (11, 31, 64, 65).

Genome sequences from the two previously described APSE strains are highly similar except for a nonorthologous, 3.7- to 5.8-kb region that encodes homologs of two distinct eukaryotic toxins, Shiga-like toxin (Stx) and cytolethal distending toxin (CdtB) (57, 85). Although the exact mechanisms underlying aphid protection are unknown, we have hypothesized that these APSE-encoded proteins, independently or in conjunction with bacterial chromosomal loci, are responsible for prematurely arresting the development of the wasp larvae (57). Moreover, variation in the level of protection conferred on the aphid is known to be associated with genes encoding Stx and Cdt homologs (57, 65). Also, the failure of a particular “Ca. Hamiltonella defensa” strain to protect aphids against the parasitoid A. ervi (65) has been linked to the absence of APSE (25).

Although both symbiont and phage are vertically (maternally) inherited with high fidelity, incongruence among the phylogenetic trees of phage, bacteria, and hosts and the patchy distribution among host insect species indicate that both “Ca. Hamiltonella defensa” and APSE are sometimes horizontally transmitted, lost, or both (25, 74, 77).

Here we have sequenced and analyzed the APSE toxin cassette region from seven additional insect host sources. We identified four new phage-encoded toxins that were flanked by highly conserved regions of the APSE genome. This hot spot for nonhomologous recombination is responsible for shuffling ecologically important genes among “Ca. Hamiltonella defensa” strains.

MATERIALS AND METHODS

Amplification of variable regions of phage genome.

We previously identified a panel of 23 insects infected with “Ca. Hamiltonella defensa,” of which 8 were confirmed to be infected with APSE (Table 1) (25). We added a sixth marker (P24) to the five 1-kb markers previously sequenced from the APSE genome (25). Then, using both existing and newly designed outward-facing primers located in each of these “anchors,” we attempted to amplify the intervening regions of the APSE genome, which ranged from 4.5 to 13 kb in length (Table 2). We also attempted to amplify the integration site boundaries from integrated and nonintegrated APSE. Primers flanking the bacterial (attB) and phage (attP) attachment sites were designed using preliminary data from the “Ca. Hamiltonella defensa” strain 5AT genome (P. H. Degnan and N. A. Moran, unpublished).

TABLE 1.

APSE strains and their virulence cassettes

Phage strain(s) “Ca. Hamiltonella defensa” strain(s) Insect host Collection locationc P3-P24 length (bp) Cassette length (bp) % G+C
Referenceb
APSEa Cassette Toxin
APSE-1 Acyrthosiphon pisum 39.5 The Netherlands 13,093 3,654 46.0 39.5 35.6 85
APSE-2a, APSE-2b 5AT Acyrthosiphon pisum (A. pisum 82b = donor) Madison, WI (Cayuga Co., NY) 15,104, 15,095 5,764 45.8 38.5 35.5 25
APSE-3 A1A, A2F, A2H Acyrthosiphon pisum Logan, UT 16,509 7,131 46.2 45.5 49.9 25
APSE-4 5ATac Acyrthosiphon pisum (Aphis craccivora = donor) Madison, WI (Tucson, AZ) 13,034 3,634 46.2 38.4 32.5 25
APSE-5 Uroleucon rudbeckiae Whiteriver, AZ 13,045 3,641 46.2 38.4 32.5 25
APSE-6 N4 Chaitophorus sp. Crestone, CO 11,754 2,363 46.6 45.6 39.7 25
APSE-7 Bemisia tabaci (biovar B) Tucson, AZ 12,477 2,148 45.9 41.2 39.5 25
a

Includes conserved APSE core genes P3, P4, P5, P14, P16, P17, P18, P19, P23, and P24.

b

Original identification of APSE infections.

c

Parentheses denote collection location for donor strains. Co., county.

TABLE 2.

Oligonucleotide primers used to amplify APSE genome fragments and toxins

Gene regiona Primer name Size (kb) Sequence (5′ to 3′) Referenceb
P3-P24 APSE1329F 13.1 CTCGACATGGACGGTTGTACGTTAG *
APSE14422R AGTGACATCACCCGAAGCGGTAG *
P24-P35 APSE13.6F 7.4 ATACAGGCGACAGTGTGAGC *
APSE21049R AGGCATTACGACTGTAGACTACGCTG *
P35-P41 APSE19.6F 6.4 GTCGTCTCTTCCGCTGC 25
APSE20.6F 5.4 GGGACATCGGTAGACCAGAA 25
APSE26.0R ATCATTCCGGTTACGCAAAG 25
P41-P45 APSE25.0F ATCCTGTATTGCCCGTTTTG 25
APSE31.9R 6.9 GGCTCTGATATTTTAGCCATGC 25
APSE31.1R 6.1 TGGGATGTGTATGGACGTTG 25
P45-P51 APSE30.6F 4.3 AGTGCAGAAGGGTAACAAAGAC 25
APSE34.9R GATAAAACATCGCCGTTTGC 25
P51-P3 APSE34.0F 4.4 AGGTGCGATTACCCTGTTTG 25
APSE1.9R GTTTTAGCTTCATCCTCAAAG 25
HD-P38 BA2566127F 2.0 GACTCAATCTTCAATCTGGCG *
APSE23311F GGACAAGTATCCGCAAGTATG *
P38-HD APSE24631R 1.6 GCAGTTACACAACACCGTG *
ctg154-394R CGATGGAGTGACAATGGG *
a

HD, Ca. Hamiltonella defensa.

b

*, new with this study.

Two sets of PCR conditions were used to amplify the various fragments. For amplicons longer than 7 kb, we used the FailSafe PCR system (Epicentre). Amplifications were set up in 10-μl reaction mixtures with 0.5 U of FailSafe enzyme mix, 3 pmol (each) primer, 1× FailSafe PreMix E buffer, and ∼12 ng genomic DNA. A touchdown PCR was used, starting with an initial denaturation for 2 min at 94°C and then three cycles of 94°C for 50 s, 61°C for 50 s, and 72°C for 9 or 13 min, followed by seven cycles in which the annealing temperature was dropped by 1°C a cycle from 60 to 54°C, followed by 14 cycles with an annealing temperature of 54°C and a final extension of 72°C for 10 min.

For the remaining amplicons, we used 0.008 U of Taq (Eppendorf) in 10-μl reaction mixtures with 4 pmol (each) primer, 250 pmol (each) deoxynucleoside triphosphate, a final MgCl2 concentration of 2.5 mM, 1× PCR buffer, and ∼12 ng genomic DNA. These reaction mixtures were then cycled with an initial denaturation of 2 min at 94°C, followed by 35 cycles of 94°C for 30 s, 52°C for 50 s, 72°C for 3 to 6 min, and a final extension of 72°C for 10 min.

Successful amplifications of the target regions were scaled up to 30- or 50-μl reaction mixtures and either sequenced directly or cloned. Cloning was carried out using the TOPO XL large construct kit according to the manufacturer's instructions (Invitrogen). Clones were screened, and positive clones were grown in 5-ml overnight cultures of LB plus kanamycin (50 μg/ml) at 37°C. Frozen permanents were stored at −80°C, and plasmid DNA was purified using the Plasmid Mini kit (Eppendorf).

Amplified phage genome fragments were sequenced by primer walking on an ABI3730xl sequencer using the BigDye Terminator v3 mix (Applied Biosystems). Sequence traces were then assembled and edited using the PHRED, PHRAP, and CONSED software applications (29, 30, 36). All low-quality regions (>20) were resequenced or changed to N′s. We used CONSED to identify all open reading frames (ORFs) encoding >30 amino acids and then manually annotated the ORFs using multiple lines of evidence (similarity BLAST and PFAM and structural Phyre) (5, 10, 51). The partial APSE-2 genome reported previously (57) was completed, and annotated sequences of the new P3-P24 and the P41-P45 APSE phage fragments were submitted to GenBank. The sequenced attachment sites (attB and attP) and integrated boundaries (attL and attR) were also deposited in GenBank.

Evolutionary rates of phage loci.

Phylogenetic trees were determined for each conserved APSE locus using the MrBayes software program, version 3.1.1 (73), as described in reference 25. Briefly, the nucleotide sequences for each gene were aligned using the inferred protein sequence in the ClustalW software program (82). Substitution model parameters were chosen based on the results of a heuristic likelihood ratio test in the MrModeltest software program (61) and two independent runs of four simultaneous incrementally heated Markov chain Monte Carlo chains. After 25 million generations, average posterior probabilities of the 50% majority rule consensus tree topology were estimated using a burn-in of 500,000 generations from each of the two runs. Estimates of the rates of nonsynonymous changes per nonsyonymous site and synonymous changes per synonymous site were determined for each locus using the consensus tree topology in the software program PAML v3.15 (92).

Toxin and lysis gene phylogenies.

Orthologous toxin and lysis genes were recovered from GenBank, and protein sequences were aligned using the Mafft and ClustalW programs (50, 82). A conservative attempt was made to exclude gaps and ambiguous portions of the alignment. The programs PhyML and MrBayes were used to analyze the protein alignments, and bootstraps and posterior probabilities are reported below (37, 73). Likelihood searches in PhyML were started from a neighbor joining tree (BIONJ algorithm), using the JTT model with four substitution rate categories and with the proportion of invariable sites and gamma distribution estimated from the data and then optimized. Finally, bootstrap values were calculated from 100 nonparametric bootstrap replicates. Bayesian searches were performed, starting from a random tree, with the proportion of invariable sites and gamma distribution estimated from the data (rates = invgamma) and amino acid substitution rate matrix averaged over 10 models (aamodelpr = mixed). Two independent runs of four simultaneous incrementally heated Markov chain Monte Carlo chains were run for 2 million generations, sampling every 1,000 generations, and posterior probabilities estimated after a burn-in of 1 million generations. Back-translated nucleotide alignments of several loci were analyzed using a partitioned codon model in MrBayes (79) and were concordant with the phylogenies generated from the amino acid alignments (data not shown).

Nucleotide sequence accession numbers.

Annotated sequences of the new P3-P24 and the P41-P45 APSE phage fragments were submitted to GenBank under accession numbers EU794049 to EU794057. The sequenced attachment sites (attB and attP) and integrated boundaries (attL and attR) were also deposited in GenBank, with accession numbers EU794058 to EU794073.

RESULTS

The amplification and sequencing of APSE chromosome fragments from seven infected insects revealed five new APSE strains. Although the six gene anchors were amplified from all of the APSE strains, all six intervening regions were amplified only from APSE-3, -4, and -5. Three or four interanchor fragments failed to amplify for APSE-6 or -7, respectively (Fig. 1). Several successful amplifications of particular intervening amplicons required alternate primer pairs, which suggests that divergence at the priming sites may have been the cause of failed amplifications. Alternatively, the phage or prophage genomes became rearranged through recombination or truncated/inactivated by gene pseudogenization. Further evidence for these phenomena is found in the inability to amplify both the left and the right APSE/“Ca. Hamiltonella defensa” integrated junctures for APSE-4, -6, and -7 (attL and attR) (Fig. 1).

FIG. 1.

FIG. 1.

APSE genome amplification by PCR. (A) Schematic diagram of the circularly permutated APSE chromosome, where gray bars indicate the six anchor sequences used to amplify genomic fragments. The APSE integration site in the “Ca. Hamiltonella defensa” chromosome was determined from the draft “Ca. Hamiltonella defensa” strain 5AT genome (Degnan and Moran, unpublished). The attachment site in APSE (attP) is adjacent to the integrase gene P38 and corresponds to an identical 62-bp sequence in “Ca. Hamiltonella defensa” (attB), which overlaps with an arginine tRNA. (B) All six of the genomic fragments were amplified for the novel strains APSE-3, -4, and -5 (solid black lines) and for the previously sequenced strains APSE-1 and -2. Failure to amplify several interanchor fragments from APSE-6 and -7 (dashed lines) suggests recombination or degradation of the phage. One or both of the APSE/“Ca. Hamiltonella defensa” junctures have been confirmed by PCR for APSE-1, -2, -3, -4, -5, and -6 (vertical black bars).

The amplicons spanning genes P3 to P24 and P41 to P45 were the only two that showed significant length variation (P. H. Degnan, unpublished). To determine the cause of their variable lengths, the products were amplified and sequenced by primer walking (Fig. 2). The variation in lengths of the P41-P45 fragments corresponds to the presence or absence of a conserved hypothetical phage gene (G) and/or a 913-bp insertion within the DNA polymerase (P45). Alignment of P45 with orthologous DNA polymerases in the SPO2 family (14, 75) suggests that the insertion of 913 bp is unique to APSE and occurs downstream of the known active sites in the 3′→5′ exonuclease and the DNA polymerase domains (8, 12).

FIG. 2.

FIG. 2.

Variable-length regions of the APSE chromosomes. (A) Map of the entire APSE-1 chromosome. Boxes above the line represent ORFs transcribed in the rightward direction; below the line, leftward. The six anchor genes are indicated, and the dashed boxes show the two regions found to be variable in length by PCR. (B and C) Detailed view of the sequenced virulence cassette (B) or DNA replication regions (C). Orthologous ORFs are shown in the same color, and putatively toxic ORFs are shown with hatch marks. Putative pseudogenes (ψ) are shown as boxes bordered with dashed lines.

Within the APSE “lysis” operon, between genes P3 and P24, we found a region highly variable in both length and gene content. This variable region contained putative toxin genes in all of the APSE strains. We identified divergent copies of genes encoding cytolethal distending toxin (cdtB), Shiga-like toxin (stxAB), and a class of putative YD-repeat-containing toxins. Additionally, variation in several strain-specific ORFs and variable combinations of holin and lysozyme genes were detected. This genic variation is in stark contrast to the high level of conservation of structural and regulatory genes; these averaged less than 0.5% divergence in pairwise comparisons (see Table S1 in the supplemental material).

Cytolethal distending toxin.

The two copies of cdtB, carried by APSE-6 and -7 (Chaitophorus sp. and Bemisia tabaci), were extremely diverged from the cdtB gene encoded by APSE-2 (A. pisum strain 5AT). Despite the small amount of overall protein sequence identity (25 to 40% over the aligned region), the 12 active residues are completely conserved among all three copies (28, 53). All of the alleles are A+T biased (36 to 40% G+C) and are below the averages for APSE and “Ca. Hamiltonella defensa” genes (45% and 42% G+C, respectively) (25) (Table 1).

Unlike copies of cdtB commonly found among bacterial pathogens, these alleles are not flanked by cdtAC, genes which are involved in the transport of the toxic subunit (cdtB) (68, 78). We have previously proposed that CdtB is delivered to its eukaryotic target by some other mechanism, either the “Ca. Hamiltonella defensa” type two secretion system, as in Salmonella (38), the type three secretion system, or lysis of intracellular “Ca. Hamiltonella defensa” cells (57). Analysis of the N termini of the three APSE alleles shows a weak similarity to a canonical Sec-dependent secretion signal (71), suggesting that the export of these toxins may be dependent on the type two secretion system (see Fig. S1 in the supplemental material).

These phage-encoded cdtB alleles form a monophyletic group distinct from those found in a wide range of bacterial pathogens (Fig. 3). Although the tree is poorly resolved at internal nodes, it is of note that there are two clusters of toxin genes common among Helicobacter and Campylobacter species. The entire cdtABC operon in species of Helicobacter and Campylobacter with completed genomes lacks obvious signs of HGT (e.g., aberrant G+C percentage and being flanked by mobile DNA). This suggests that vertical transmission and loss or restricted HGT among closely related species have led to the present distribution. However, in Escherichia coli, divergent copies of cdtABC have been sequenced and are carried not only on the chromosome but on a plasmid, an active phage, and a prophage (7, 48, 67). Other bacteria, such as Salmonella enterica and Burkholderia phymatum, are similar to APSE in that they encode only the cdtB locus, which is likely to have been acquired by HGT, as evidenced by both a significantly lower G+C percentage and the presence of transposable sequence elements (data not shown).

FIG. 3.

FIG. 3.

Amino acid phylogenies of APSE-encoded toxins. Consensus maximum likelihood phylogenies of APSE-encoded cytolethal distending toxin (CdtB) (A) or YD-repeat proteins (B). Proteins previously demonstrated to be toxic are indicated with daggers (†). Bootstrap values from PhyML, followed by posterior probabilities estimated in MrBayes, are listed at appropriate nodes. Nodes with less than 50% support by both methods have been collapsed. Genus abbreviations are as follows: H., Haemophilus (for H. ducreyi) or Helicobacter (all others); C., Campylobacter; F., “Flexispira”; S., Shigella (for S. boydii) or Salmonella (for S. enterica); P., Photorhabdus (for P. luminescens) or Pseudomonas (all others); A., Aggregatibacter. sv., serovar; str., strain.

The large amounts of evolutionary divergence among cdtB alleles in APSE may result from the combination of elevated mutation rates in phage genomes and strong directional selection to avoid host immune mechanisms yet strong purifying selection at the active sites to retain toxicity. For example, expression of CdtB by mammalian pathogens has been demonstrated to elicit a strong antibody response (1, 89), and in at least one case, CdtB is immunosuppressive and increases the potential for long-term colonization of the host (69).

Shiga-like toxin.

Shiga toxin is a major virulence determinant in toxigenic E. coli and Shigella dysenteriae, resulting in hemorrhagic colitis and hemolytic uremic syndrome (62). The holotoxin has an A1B5 protein structure with five beta subunits forming a pentameric ring that binds to cell surfaces and permits entry of the cytotoxic alpha subunit (27, 66). Van der Wilk et al. (85) noted a weak homology between P7 of the phage APSE-1 and the beta subunit of stx (stxB). Although the phylogenetic signal is very weak, protein domain and structural predictions are consistent with P7 being homologous to StxB proteins. Sequences of P7 from APSE-4 and -5 show very little divergence from that from APSE-1 (tree rate of nonsynonymous changes per nonsyonymous site: 0.063), although the P7 allele in APSE-4 has an inactivating mutation (+1 bp).

It is possible that the APSE stxB gene alone can disrupt cells, but we propose that the downstream ORF P9 is a functional analog of the cytotoxic alpha subunit (stxA). The product of P9 is slightly longer than those of the stxA genes (360 to 366 amino acids [aa] versus 315 to 319 aa), does not share either of the conserved amino acid domains found in Stx and other ricin toxins (see Fig. S2 in the supplemental material) (6, 33, 42, 46), and lacks significant homology to any proteins in the NR or Pfam_ls database. However, the P9 alleles are predicted to encode eight alpha helices in their product's C terminus, and the P7 and P9 genes have an operon-like arrangement. The three P9 alleles encode nearly identical stretches of 36 and 42 amino acids at their corresponding N and C termini, respectively, flanking a region that is much more variable. Despite low sequence identity between the three alleles across this region (∼36%), there are six conserved amino acid motifs that may be associated with P9's binding or catalysis (see Fig. S2 in the supplemental material).

YD-repeat protein.

The three A. pisum strains from Utah infected with APSE were found to have identical P3-P24 intergenic regions. This phage strain, APSE-3, encodes a 1,683-amino-acid YD-repeat protein (OrfZ). Genes encoding members of this protein family were originally described for E. coli as recombination hot spots (rhs) (32). Orthologs encode the repeated peptide motif xxGxxxRYxYDxxGRL[I/T]xxxx, and their products are suggested to function as membrane-bound adhesins (32, 41). Despite the growing number of identified YD-repeat proteins encoded in sequenced genomes, this protein family remains poorly understood (PFAM accession no. PF05593). Recent work has now shown that YD-repeat-containing proteins in E. coli are upregulated and are protective against the biocide polyhexamethylene biguanide (3), and in Myxococcus, a YD-repeat protein is involved with swarming motility (93). An unpublished YD-repeat protein from Xenorhabdus bovienii is toxic to nematodes (GenBank accession no. CAC19493). Mechanisms for these activities are as yet uncertain.

Given the homology of our allele to the X. bovienii YD-repeat toxin gene (Fig. 3) and its presence in a phage associated with enhanced protection of insect hosts (25), the APSE-encoded ORF protein might also be a toxin. If recombination at these loci is prevalent outside of E. coli, then the phylogeny in Fig. 3 should be treated with caution. However, the tree resolves several groups reasonably well, including the fungal and pseudomonad YD-repeat proteins.

Recombining genes linked to putative toxins. (i) Bacterial cell lysis proteins.

We found variation in the number and type of holin and lysozyme genes that occur directly downstream of those encoding the eukaryotic toxins (Fig. 2). The APSE strains contained ORFs corresponding to two phylogenetically and structurally distinct groups of holins. The P11-like holins are homologous to the Lambda-like group I holins and have three transmembrane domains (88). The “E”-like holins have only two transmembrane domains and are members of the phage 21 group II holin superfamily (88). Despite the variation in length and structure, the two holins have similar roles in the timed disruption of the bacterial inner membrane that allows lysozyme access to the cell wall (88).

Two distinct lysozymes were also identified in APSE (P13 and F) (Fig. 4), and although they are highly dissimilar in sequence, both alleles encode members of the glycoside hydrolase family 24 (40), and their products have the two residues essential in phage T4 for glycosidase activity (T4 Glu-11 and Thr-26) (52). While lysozymes are primarily involved in lysis of the bacterial cell, the lysozyme of phage P22 is also packaged into the virion and is later released after the particle has adsorbed to the host cell, facilitating entry of the phage chromosome (56). This same phenomenon may be present in APSE, since the structural genes involved in the construction of the phage virion and injection of the phage DNA into the bacterial host are orthologous to those in P22 (21, 85).

FIG. 4.

FIG. 4.

APSE lysozyme protein phylogeny. The consensus maximum-likelihood phylogeny for the APSE lysozymes P13 and “F” is shown. These lysozymes form two distinct clades, each of which is most closely related to homologs found in Sodalis glossinidius, the facultative endosymbiont of tsetse flies (Glossinia morsitans). The brackets denote that P13-like lysozymes are all linked to an adjacent group I holin while F-like lysozymes are linked to a group II holin. Numbers in parentheses correspond to the gene number from the genome sequenced, and the asterisks indicate the two APSE strains that carry both a group I and a group II holin gene. The support values at the nodes list the bootstrap values from PhyML followed by posterior probabilities estimated in MrBayes. Genera are as follows: Y., Yersinia; G., Glossinia; V., Vibrio; S., Sodalis.

Among the sequenced APSE fragments, the bacterial cell lysis genes E and F and P11 to P13 frequently cooccur; however, APSE-2 and -7 represent reciprocal recombinants that carry both types of holins and one or the other lysozyme allele. The recombination event that introduced P11 and P13 into APSE-7 appears to have occurred secondarily, since the holin E is encoded upstream of P11 to P13 while the last 23 aa encoded by F occur downstream. In situ observations indicated that APSE-1 is effective at lysing “Ca. Hamiltonella defensa” cells (85), and in vitro experiments demonstrated that the product encoded by P11 from APSE-2 can lyse E. coli at high rates (I.-N. Wang, personal communication). The significance (if any) of phage bearing two holins or the presence of alternative lysozyme alleles remains unclear.

(ii) Unique ORFs.

Six ORFs apart from the putative toxins and the lysis proteins were annotated in the seven APSE genomes. Many have no known orthologs and have only weak structural predictions. An exception to this is ORF D from APSE-2, which has significant similarity to a recently identified gene in Photobacterium damselae subsp. piscicida, the Aip56 gene, which is involved in antiphagocytic activity (26). Possibly, the other unknown APSE ORFs are toxins or additional toxicity factors that facilitate transport or binding of the predicted toxins.

DISCUSSION

Bacteriophage are a central mechanism for HGT in bacteria (15, 19, 63), and our findings on APSE indicate that bacteriophage can be a conduit for gene exchange among symbiotic bacteria residing in diverse insect hosts. A difference in toxin gene content between the first two sequenced APSE strains has been hypothesized to contribute to variation among “Ca. Hamiltonella defensa” strains' abilities to protect aphid hosts against attack by parasitoid wasps (25). Here we have characterized five new APSE strains, encoding three families of toxins: CdtB, Stx-like, and YD-repeat toxins. The presence of these genes within a conserved region of the APSE chromosome can be explained only by nonorthologous recombination events within this localized region. In addition to reassorting these putative toxins, the footprint of recombination has led to heterogeneous sets of other potential virulence factors and phage lysis genes.

Previous experiments using genetically identical strains of aphids experimentally infected with “Ca. Hamiltonella defensa” strains demonstrated that aphids infected with “Ca. Hamiltonella defensa” and APSE had significantly greater success in arresting parasitoids than did aphids lacking “Ca. Hamiltonella defensa” or lacking APSE (57, 65). The level of protection varied among the genetically distinct APSE strains (65). This variation in phenotype between APSE strains is likely due to differences between the encoded toxins in target specificity, level or mode of activity, level of transcription, and/or mechanism of delivery. For example, Shiga toxins are known for having specific coreceptors, limiting the types of cells they can bind and therefore intoxicate (62). These diverse toxins may target different parasitoids or pathogens, particularly since many parasitoids have narrow host ranges (55, 70) and APSE is found in diverse insect hosts (25).

Although the genome organization of APSE is similar to that of other temperate phage, no putative operators for any of the regulatory proteins or phage-encoded toxins have been identified (85). Our previous study showed that cdtB of APSE-2 is constitutively expressed, even in unparasitized aphids, at levels significantly higher than those for other phage-encoded loci (57). Thus, toxin genes apparently are expressed not only in cells undergoing lysis but in lysogens as well. The mechanisms used to deliver the toxins to the parasitoid wasp larvae are still uncertain.

We identified the APSE site of integration, overlapping an arginine tRNA, confirming that APSE is a temperate bacteriophage (lysogenic). Additionally, sequences spanning attB, attL, and attR were recovered from single insects, demonstrating that “Ca. Hamiltonella defensa” populations are heterogeneous for APSE infections. Thus, upon cell lysis, naive bacterial hosts are available for infection by APSE, and APSE could be lost due to population bottlenecks during vertical or horizontal transmission.

Effect of recombination on APSE strain diversity.

APSE has a dynamic genome, reflecting horizontal transmission as well as intragenic and nonhomologous recombination. Repeated recombination events have resulted in a diversity of APSE strains, as represented by the seven described here. In each case, the G+C percentage of the virulence cassette deviates from mean G+C percentages for both APSE and “Ca. Hamiltonella defensa” (Table 1), suggesting an exogenous source for these toxin genes. However, given the significant divergence of these toxins from known orthologs (Fig. 3), identifying the source is difficult.

A single aphid or whitefly can harbor multiple symbionts as well as other commensal bacteria (20, 23, 31, 77). For example, coinfections of distinct facultative endosymbionts are possible through sexual transmission (58). APSE infections of various “Ca. Hamiltonella defensa” strains or rare/accidental infections of other aphid-borne bacteria may result in gene transfer. Natural selection may favor recombinant phages that encode novel toxins, providing greater resistance to parasitoids or pathogens and subsequently increasing in frequency among infected insects.

Alternatively, integrated phage can be inactivated by recombination or mutations that result in changes preventing phage excision, assembly, or bacterial cell lysis. Our inability to amplify the entire chromosomes of APSE-6 and -7 by PCR suggests that these phages have succumbed to this fate (Fig. 1). Inactivation of prophages can benefit the bacterial host by allowing retention of lysogenic converting genes (e.g., toxins) without the inevitable fate of lysis and by providing immunity to superinfection by the same phage (16). Relaxed selection, due to an absence of or change in the parasitoid or pathogen against which the phage toxins were providing a defense, could also lead to the inactivation of the APSE prophages.

Comparisons of APSE with phage of other insect endosymbionts.

Recombination of bacteriophages commonly results in a mosaic genomic architecture in which different gene blocks are highly similar to those of distinct phages (47, 49). APSE shares a core block of genes with the nonintegrative bacteriophage φSG1 (also termed pSOG3), which infects the facultative endosymbiont of tsetse flies, Sodalis glossinidius (21). In the Sodalis genome, 262 of 2,432 intact ORFs are phage related (83), and numerous degraded prophage elements are homologous to APSE genes (Fig. 4). In spite of these similarities, these phages and facultative endosymbionts have very different insect host ranges (Diptera versus Hemiptera).

APSE has been linked to a third facultative endosymbiont of insects with the discovery of at least one APSE-like gene (DNA polymerase; P45) in an Arsenophonus species, a symbiont of a psyllid insect host (39). Arsenophonus species are facultative endosymbionts of a variety of insects, including dipterans, hemipterans, and hymenopterans (44, 74, 81, 84), and thus are likely to overlap in host range with both Sodalis and Hamiltonella. In addition, the infection frequency of Arsenophonus in psyllids is positively correlated with the prevalence of the parasitoid wasp Psyllaphaegus bliteus (Hymenoptera: Encyrtidae) (39). In sum, these data suggest that APSE-like phage play an integral role in the reassortment of genes among a wide variety of facultative endosymbionts and other insect-associated bacteria. This HGT may in turn contribute to ecologically relevant phenotypes of insect hosts (e.g., parasitoid immunity).

Parallels to APSE are found in the bacteriophage WO, which infects Wolbachia, a widespread reproductive parasite of insects. WO is a lysogen and can occur in two or more copies per Wolbachia genome (76, 91); WO is variably present among Wolbachia strains (13, 18, 35) and undergoes intragenic recombination (13). Furthermore, a comparison of several WO genomes reveals a conserved core of structural genes and a variable fraction that encode ankyrin repeat genes. Variable presence, number of repeats, and sex-specific expression of these ankyrin genes correlate with the effects of Wolbachia on host reproductive biology (34, 45, 54, 80, 91).

Conclusions.

Previous work suggested that the ability of “Ca. Hamiltonella defensa” to defend aphids from parasitoid invaders is linked to the presence of the bacteriophage APSE. We have now demonstrated considerable variation in the toxins encoded by APSE, and this variation is expected to influence the levels of protection against specific parasitoids or pathogens. Our findings indicate that the same phage-mediated processes known to generate genomic variation and pathogenicity in mammalian pathogens, such as E. coli and Salmonella enterica, also are important in genomes of insect symbionts that are beneficial to their hosts. Furthermore, insect symbionts are using toxin-encoding genes homologous to those of pathogens. Our data also indicate that two APSE strains have undergone substantial degradation yet have retained the virulence cassette containing intact toxin-encoding genes. Finally, the close relationships of phage genes from three distinct bacterial symbionts of insects strongly suggest that phage act as a conduit for ongoing gene exchange among facultative endosymbionts infecting a diverse set of insect hosts.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank H. Dunbar, K. Hammond, and B. Nankivell for laboratory and administrative assistance. Also, M. van Passel and J. Stavrinides provided useful discussion and comments on the research. We also thank M. Verbeek for samples of A. pisum infected with APSE-1.

This research was supported by NSF grant 0313737 to N.A.M. P.H.D. is supported by an NSF IGERT Fellowship in Evolutionary and Functional Genomics at the University of Arizona. Additional funding was awarded to P.H.D. from the Center for Insect Science at the University of Arizona and an NSF doctoral dissertation improvement grant, no. 0709992.

Footnotes

▿

Published ahead of print on 12 September 2008.

†

Supplemental material for this article may be found at http://aem.asm.org/.

REFERENCES

  • 1.AbuOun, M., G. Manning, S. A. Cawthraw, A. Ridley, I. H. Ahmed, T. M. Wassenaar, and D. G. Newell. 2005. Cytolethal distending toxin (CDT)-negative Campylobacter jejuni strains and anti-CDT neutralizing antibodies are induced during human infection but not during colonization in chickens. Infect. Immun. 73:3053-3062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Akman, L., A. Yamashita, H. Watanabe, K. Oshima, T. Shiba, M. Hattori, and S. Aksoy. 2002. Genome sequence of the endocellular obligate symbiont of tsetse flies, Wigglesworthia glossinidia. Nat. Genet. 32:402-407. [DOI] [PubMed] [Google Scholar]
  • 3.Allen, M. J., G. F. White, and A. P. Morby. 2006. The response of Escherichia coli to exposure to the biocide polyhexamethylene biguanide. Microbiology 152:989-1000. [DOI] [PubMed] [Google Scholar]
  • 4.Allison, G. E., D. Angeles, N. Tran-Dinh, and N. K. Verma. 2002. Complete genomic sequence of SfV, a serotype-converting temperate bacteriophage of Shigella flexneri. J. Bacteriol. 184:1974-1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Altschul, S. F., W. Gish, W. Miller, W. E. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
  • 6.Asakura, H., S. Makino, H. Kobori, M. Watarai, T. Shirahata, T. Ikeda, and K. Takeshi. 2001. Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals. Epidemiol. Infect. 127:27-36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Asakura, M., A. Hinenoya, M. S. Alam, K. Shima, S. H. Zahid, L. Shi, N. Sugimoto, A. N. Ghosh, T. Ramamurthy, S. M. Faruque, G. B. Nair, and S. Yamasaki. 2007. An inducible lambdoid prophage encoding cytolethal distending toxin (Cdt-1) and a type III effector protein in enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 104:14483-14488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Astatke, M., N. D. Grindley, and C. M. Joyce. 1998. How E. coli DNA polymerase I (Klenow fragment) distinguishes between deoxy- and dideoxynucleotides. J. Mol. Biol. 278:147-165. [DOI] [PubMed] [Google Scholar]
  • 9.Aziz, R. K., R. A. Edwards, W. W. Taylor, D. E. Low, A. McGeer, and M. Kotb. 2005. Mosaic prophages with horizontally acquired genes account for the emergence and diversification of the globally disseminated M1T1 clone of Streptococcus pyogenes. J. Bacteriol. 187:3311-3318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bateman, A., L. Coin, R. Durbin, R. D. Finn, V. Hollich, S. Griffiths-Jones, A. Khanna, M. Marshall, S. Moxon, E. L. Sonnhammer, D. J. Studholme, C. Yeats, and S. R. Eddy. 2004. The Pfam protein families database. Nucleic Acids Res. 32:D138-D141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bensadia, F., S. Boudreault, J.-F. Guay, D. Michaud, and C. Cloutier. 2005. Aphid clonal resistance to a parasitoid fails under heat stress. J. Insect Phys. 52:146-157. [DOI] [PubMed] [Google Scholar]
  • 12.Bernad, A., L. Blanco, J. M. Lázaro, G. Martín, and M. Salas. 1989. A conserved 3′→5′ exonuclease active site in prokaryotic and eukaryotic DNA polymerases. Cell 59:219-228. [DOI] [PubMed] [Google Scholar]
  • 13.Bordenstein, S. R., and J. J. Wernegreen. 2004. Bacteriophage flux in endosymbionts (Wolbachia): infection frequency, lateral transfer, and recombination rates. Mol. Biol. Evol. 21:1981-1991. [DOI] [PubMed] [Google Scholar]
  • 14.Braithwaite, D. K., and J. Ito. 1993. Compilation, alignment, and phylogenetic relationships of DNA polymerases. Nucleic Acids Res. 21:787-802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Canchaya, C., G. Fournous, S. Chibani-Chennoufi, M. L. Dillmann, and H. Brüssow. 2003. Phage as agents of lateral gene transfer. Curr. Opin. Microbiol. 6:417-424. [DOI] [PubMed] [Google Scholar]
  • 16.Canchaya, C., C. Proux, G. Fournous, A. Bruttin, and H. Brüssow. 2003. Prophage genomics. Microbiol. Mol. Biol. Rev. 67:238-276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Casjens, S. 2003. Prophages and bacterial genomics: what have we learned so far? Mol. Microbiol. 49:277-300. [DOI] [PubMed] [Google Scholar]
  • 18.Chauvatcharin, N., A. Ahantarig, V. Baimai, and P. Kittayaong. 2006. Bacteriophage WO-B and Wolbachia in natural mosquito hosts: infection incidence, transmission mode and relative density. Mol. Ecol. 15:2451-2461. [DOI] [PubMed] [Google Scholar]
  • 19.Cheetham, B. F., and M. E. Katz. 1995. A role for bacteriophages in the evolution and transfer of bacterial virulence determinants. Mol. Microbiol. 18:201-208. [DOI] [PubMed] [Google Scholar]
  • 20.Clark, M. A., L. Baumann, M. A. Munson, P. Baumann, B. C. Campbell, J. E. Duffus, L. S. Osborne, and N. A. Moran. 1992. The eubacterial endosymbionts of whiteflies (Homoptera: Aleyrodoidea) constitute a lineage distinct from the endosymbionts of aphids and mealybugs. Curr. Microbiol. 25:119-123. [Google Scholar]
  • 21.Clark, A. J., M. Pontes, T. Jones, and C. Dale. 2007. A possible heterodimeric prophage-like element in the genome of the insect endosymbiont Sodalis glossinidius. J. Bacteriol. 189:2949-2951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Darby, A. C., and A. E. Douglas. 2003. Elucidation of the transmission patterns of an insect-borne bacterium. Appl. Environ. Microbiol. 69:4403-4407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Davidson, E. W., R. C. Rosell, and D. L. Hendrix. 2000. Culturable bacteria associated with the whitefly, Bemisia argentifolii (Homoptera: Aleyrodidae). Fla. Entomol. 83:159-171. [Google Scholar]
  • 24.Degnan, P. H., A. B. Lazarus, and J. J. Wernegreen. 2005. Genome sequence of Blochmannia pennsylvanicus indicates parallel evolutionary trends among bacterial mutualists of insects. Genome Res. 15:1023-1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Degnan, P. H., and N. A. Moran. 2008. Evolutionary genetics of a defensive facultative symbiont of insects: exchange of toxin-encoding bacteriophage. Mol. Ecol. 17:916-929. [DOI] [PubMed] [Google Scholar]
  • 26.do Vale, A., M. T. Silva, N. M. dos Santos, D. S. Nascimento, P. Reis-Rodrigues, C. Costa-Ramos, A. E. Ellis, and J. E. Azevedo. 2005. AIP56, a novel plasmid-encoded virulence factor of Photobacterium damselae subsp. piscicida with apoptogenic activity against sea bass macrophages and neutrophils. Mol. Microbiol. 58:1025-1038. [DOI] [PubMed] [Google Scholar]
  • 27.Donohue-Rolfe, A., D. W. Acheson, and G. T. Keusch. 1991. Shiga toxin: purification, structure, and function. Rev. Infect. Dis. 13:S293-S297. [DOI] [PubMed] [Google Scholar]
  • 28.Elwell, C. A., and L. A. Dreyfus. 2000. DNase I homologous residues in CdtB are critical for cytolethal distending toxin-mediated cell cycle arrest. Mol. Microbiol. 37:952-963. [DOI] [PubMed] [Google Scholar]
  • 29.Ewing, B., and P. Green. 1998. Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res. 8:186-194. [PubMed] [Google Scholar]
  • 30.Ewing, B., L. Hillier, M. C. Wendel, and P. Green. 1998. Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res. 8:175-185. [DOI] [PubMed] [Google Scholar]
  • 31.Ferrari, J., A. C. Darby, T. J. Daniell, H. C. J. Godfray, and A. E. Douglas. 2004. Linking the bacterial community in pea aphids with host-plant use and natural enemy resistance. Ecol. Entomol. 29:60-65. [Google Scholar]
  • 32.Feulner, G., J. A. Gray, J. A. Kirschman, A. F. Lehner, A. B. Sadosky, D. A. Vlazny, J. Zhang, S. Zhao, and C. W. Hill. 1990. Structure of the rhsA locus from Escherichia coli K-12 and comparison of rhsA with other members of the rhs multigene family. J. Bacteriol. 172:446-456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fraser, M. E., M. Fujinaga, M. M. Cherney, A. R. Melton-Celsa, E. M. Twiddy, A. D. O'Brien, and M. N. James. 2004. Structure of Shiga toxin type 2 (Stx2) from Escherichia coli O157:H7. J. Biol. Chem. 279:27511-27517. [DOI] [PubMed] [Google Scholar]
  • 34.Fujii, Y., T. Kubo, H. Ishikawa, and T. Sasaki. 2004. Isolation and characterization of the bacteriophage WO from Wolbachia, an arthropod endosymbiont. Biochem. Biophys. Res. Commun. 317:1183-1188. [DOI] [PubMed] [Google Scholar]
  • 35.Gavotte, L., H. Henri, R. Stouthamer, D. Charif, S. Charlat, M. Boulétreau, and F. Vavre. 2007. A survey of bacteriophage WO in the endosymbiotic bacteria Wolbachia. Mol. Biol. Evol. 24:427-435. [DOI] [PubMed] [Google Scholar]
  • 36.Gordon, D., C. Abajian, and P. Green. 1998. Consed: a graphical tool for sequence finishing. Genome Res. 8:195-202. [DOI] [PubMed] [Google Scholar]
  • 37.Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696-704. [DOI] [PubMed] [Google Scholar]
  • 38.Haghjoo, E., and J. E. Galán. 2004. Salmonella typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterial-internalization pathway. Proc. Natl. Acad. Sci. USA 101:4614-4619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hansen, A. K., G. Jeong, T. D. Paine, and R. Stouthamer. 2007. Frequency of secondary symbiont infection in an invasive psyllid relates to parasitism pressure on a geographic scale in California. Appl. Environ. Microbiol. 73:7531-7535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Henrissat, B., and G. J. Davies. 1997. Structural and sequence-based classification of glycoside hydrolases. Curr. Opin. Struct. Biol. 7:637-644. [DOI] [PubMed] [Google Scholar]
  • 41.Hill, C. W., C. H. Sandt, and D. A. Vlazny. 1994. Rhs elements of Escherichia coli: a family of genetic composites each encoding a large mosaic protein. Mol. Microbiol. 12:865-871. [DOI] [PubMed] [Google Scholar]
  • 42.Hovde, C. J., S. B. Calderwood, J. J. Mekalanos, and R. J. Collier. 1988. Evidence that glutamic acid 167 is an active-site residue of Shiga-like toxin I. Proc. Natl. Acad. Sci. USA 85:2568-2572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Huan, P. T., B. L. Whittle, D. A. Bastin, A. A. Lindberg, and N. K. Verma. 1997. Shigella flexneri type-specific antigen V: cloning, sequencing and characterization of the glucosyl transferase gene of temperate bacteriophage SfV. Gene 195:207-216. [DOI] [PubMed] [Google Scholar]
  • 44.Hypsa, V., and C. Dale. 1997. In vitro culture and phylogenetic analysis of “Candidatus Arsenophonus triatominarum,” an intracellular bacterium from the triatomine bug, Triatoma infestans. Int. J. Syst. Bacteriol. 47:1140-1144. [DOI] [PubMed] [Google Scholar]
  • 45.Iturbe-Ormaetxe, I., G. R. Burke, M. Riegler, and S. L. O'Neill. 2005. Distribution, expression, and motif variability of ankyrin domain genes in Wolbachia pipientis. J. Bacteriol. 187:5136-5145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jackson, M. P., R. L. Deresiewicz, and S. B. Calderwood. 1990. Mutational analysis of the Shiga toxin and Shiga-like toxin II enzymatic subunits. J. Bacteriol. 172:3346-3350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Johansen, B. K., Y. Wasteson, P. E. Granum, and S. Brynestad. 2001. Mosaic structure of Shiga-toxin-2-encoding phages isolated from Escherichia coli O157:H7 indicates frequent gene exchange between lambdoid phage genomes. Microbiology 147:1929-1936. [DOI] [PubMed] [Google Scholar]
  • 48.Johnson, T. J., S. Kariyawasam, Y. Wannemuehler, P. Mangiamele, S. J. Johnson, C. Doetkott, J. A. Skyberg, A. M. Lynne, J. R. Johnson, and L. K. Nolan. 2007. The genome sequence of avian pathogenic Escherichia coli strain O1:K1:H7 shares strong similarities with human extraintestinal pathogenic E. coli genomes. J. Bacteriol. 189:3228-3236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Juhala, R. J., M. E. Ford, R. L. Duda, A. Youlton, G. F. Hatfull, and R. W. Hendrix. 2000. Genomic sequences of bacteriophages HK97 and HK022: pervasive genetic mosaicism in the lambdoid bacteriophages. J. Mol. Biol. 299:27-51. [DOI] [PubMed] [Google Scholar]
  • 50.Katoh, K., K. Kuma, H. Toh, and T. Miyata. 2005. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 33:511-518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kelley, L. A., R. M. MacCallum, and M. J. Sternberg. 2000. Enhanced genome annotation using structural profiles in the program 3D-PSSM. J. Mol. Biol. 299:499-520. [DOI] [PubMed] [Google Scholar]
  • 52.Kuroki, R., L. H. Weaver, and B. W. Matthews. 1999. Structural basis of the conversion of T4 lysozyme into a transglycosidase by reengineering the active site. Proc. Natl. Acad. Sci. USA 96:8949-8954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lara-Tejero, M., and J. E. Galán. 2000. A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 290:354-357. [DOI] [PubMed] [Google Scholar]
  • 54.Masui, S., S. Kamoda, T. Sasaki, and H. Ishikawa. 2000. Distribution and evolution of bacteriophage WO in Wolbachia, the endosymbiont causing sexual alterations in arthropods. J. Mol. Evol. 51:491-497. [DOI] [PubMed] [Google Scholar]
  • 55.Memmott, J., N. D. Martinez, and J. E. Cohen. 2000. Predators, parasitoids and pathogens: species richness, trophic generality and body sizes in a natural food web. J. Anim. Ecol. 69:1-15. [Google Scholar]
  • 56.Moak, M., and I. J. Molineux. 2004. Peptidoglycan hydrolytic activities associated with bacteriophage virions. Mol. Microbiol. 51:1169-1183. [DOI] [PubMed] [Google Scholar]
  • 57.Moran, N. A., P. H. Degnan, S. R. Santos, H. E. Dunbar, and H. Ochman. 2005. The players in a mutualistic symbiosis: insects, bacteria, viruses, and virulence genes. Proc. Natl. Acad. Sci. USA 102:16919-16926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Moran, N. A., and H. E. Dunbar. 2006. Sexual acquisition of beneficial symbionts in aphids. Proc. Natl. Acad. Sci. USA 103:12803-12806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Moran, N. A., J. A. Russell, R. Koga, and T. Fukatsu. 2005. Evolutionary relationships of three new species of Enterobacteriaceae living as symbionts of aphids and other insects. Appl. Environ. Microbiol. 71:3302-3310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Nakabachi, A., A. Yamashita, H. Toh, H. Ishikawa, H. E. Dunbar, N. A. Moran, and M. Hattori. 2006. The 160-kilobase genome of the bacterial endosymbiont Carsonella. Science 314:267. [DOI] [PubMed] [Google Scholar]
  • 61.Nylander, J. A. A. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden.
  • 62.O'Loughlin, E. V., and R. M. Robins-Browne. 2001. Effect of Shiga toxin and Shiga-like toxins on eukaryotic cells. Microbes Infect. 3:493-507. [DOI] [PubMed] [Google Scholar]
  • 63.Ochman, H., J. G. Lawrence, and E. A. Groisman. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405:299-304. [DOI] [PubMed] [Google Scholar]
  • 64.Oliver, K. M., J. A. Russell, N. A. Moran, and M. S. Hunter. 2003. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl. Acad. Sci. USA 100:1803-1807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Oliver, K. M., N. A. Moran, and M. S. Hunter. 2005. Variation in resistance to parasitism in aphids is due to symbionts not host genotype. Proc. Natl. Acad. Sci. USA 102:12795-12800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Olsnes, S., R. Reisbig, and K. Eiklid. 1981. Subunit structure of Shigella cytotoxin. J. Biol. Chem. 256:8732-8738. [PubMed] [Google Scholar]
  • 67.Pérès, S. Y., O. Marchès, F. Daigle, J. P. Nougayrède, F. Hérault, C. Tasca, J. De Rycke, and E. Oswald. 1997. A new cytolethal distending toxin (CDT) from Escherichia coli producing CNF2 blocks HeLa cell division in G2/M phase. Mol. Microbiol. 24:1095-1107. [DOI] [PubMed] [Google Scholar]
  • 68.Pickett, C. L., D. L. Cottle, E. C. Pesci, and G. Bikah. 1994. Cloning, sequencing, and expression of the Escherichia coli cytolethal distending toxin genes. Infect. Immun. 62:1046-1051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Pratt, J. S., K. L. Sachen, H. D. Wood, K. A. Eaton, and V. B. Young. 2006. Modulation of host immune responses by the cytolethal distending toxin of Helicobacter hepaticus. Infect. Immun. 74:4496-4504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Price, P. W. 1980. Evolutionary biology of parasitoids. Princeton University Press, Princeton, NJ.
  • 71.Pugsley, A. P. 1993. The complete general secretory pathway in gram-negative bacteria. Microbiol. Rev. 57:50-108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Recktenwald, J., and H. Schmidt. 2002. The nucleotide sequence of Shiga toxin (Stx) 2e-encoding phage φP27 is not related to other Stx phage genomes, but the modular genetic structure is conserved. Infect. Immun. 70:1896-1908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574. [DOI] [PubMed] [Google Scholar]
  • 74.Russell, J. A., A. Latorre, B. Sabater-Muñoz, A. Moya, and N. A. Moran. 2003. Side-stepping secondary symbionts: widespread horizontal transfer across and beyond the Aphidoidea. Mol. Ecol. 12:1061-1075. [DOI] [PubMed] [Google Scholar]
  • 75.Rutberg, L., B. Rådén, and J. I. Flock. 1981. Cloning and expression of bacteriophage SP02 DNA polymerase gene L in Bacillus subtilis, using the Staphylococcus aureus plasmid pC194. J. Virol. 39:407-412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Salzberg, S. L., J. C. Dunning Hotopp, A. L. Delcher, M. Pop, D. R. Smith, M. B. Eisen, and W. C. Nelson. 2005. Serendipitous discovery of Wolbachia genomes in multiple Drosophila species. Genome Biol. 6:R23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Sandström, J. P., J. A. Russell, J. P. White, and N. A. Moran. 2001. Independent origins and horizontal transfer of bacterial symbionts of aphids. Mol. Ecol. 10:217-228. [DOI] [PubMed] [Google Scholar]
  • 78.Scott, D. A., and J. B. Kaper. 1994. Cloning and sequencing of the genes encoding Escherichia coli cytolethal distending toxin. Infect. Immun. 62:244-251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Shapiro, B., A. Rambout, and A. J. Drumond. 2006. Choosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences. Mol. Biol. Evol. 23:7-9. [DOI] [PubMed] [Google Scholar]
  • 80.Sinkins, S. P., T. Walker, A. R. Lynd, A. R. Steven, B. L. Makepeace, H. C. J. Godfray, and J. Parkhill. 2005. Wolbachia variability and host effects on crossing type in Culex mosquitoes. Nature 436:257-260. [DOI] [PubMed] [Google Scholar]
  • 81.Thao, M. L., and P. Baumann. 2004. Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts. Appl. Environ. Microbiol. 70:2401-3406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Toh, H., B. L. Weiss, S. A. H. Perkin, A. Yamashita, K. Oshima, M. Hattori, and S. Aksoy. 2006. Massive genome erosion and functional adaptations provide insights into the symbiotic lifestyle of Sodalis glossinidius in the tsetse host. Genome Res. 16:149-156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Trowbridge, R. E., K. Dittmar, and M. F. Whiting. 2006. Identification and phylogenetic analysis of Arsenophonus- and Photorhabdus-type bacteria from adult Hippoboscidae and Streblidae (Hippoboscoidea). J. Invert. Pathol. 91:64-68. [DOI] [PubMed] [Google Scholar]
  • 85.van der Wilk, F., A. M. Dullemans, M. Verbeek, and J. F. van den Heuvel. 1999. Isolation and characterization of APSE-1, a bacteriophage infecting the secondary endosymbiont of Acyrthosiphon pisum. Virology 262:104-113. [DOI] [PubMed] [Google Scholar]
  • 86.van Ham, R. C., J. Kamerbeek, C. Palacios, C. Rausell, F. Abascal, U. Bastolla, J. M. Fernández, L. Jiménez, M. Postigo, F. J. Silva, J. Tamames, E. Viguera, A. Latorre, A. Valencia, F. Morán, and A. Moya. 2003. Reductive genome evolution in Buchnera aphidicola. Proc. Natl. Acad. Sci. USA 100:581-586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Wagner, P. L., and M. K. Waldor. 2002. Bacteriophage control of bacterial virulence. Infect. Immun. 70:3985-3993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Wang, I.-N., D. L. Smith, and R. Young. 2000. Holins: the protein clocks of bacteriophage infections. Annu. Rev. Microbiol. 54:799-825. [DOI] [PubMed] [Google Scholar]
  • 89.Wising, C., L. A. Svensson, H. J. Ahmed, V. Sundaeus, K. Ahlman, I. M. Jonsson, L. Mölne, and T. Lagergård. 2002. Toxicity and immunogenicity of purified Haemophilus ducreyi cytolethal distending toxin in a rabbit model. Microb. Pathog. 33:49-62. [DOI] [PubMed] [Google Scholar]
  • 90.Wu, D., S. C. Daugherty, S. E. Van Aken, G. H. Pai, K. L. Watkins, H. Khouri, L. J. Tallon, J. M. Zaborsky, H. E. Dunbar, P. L. Tran, N. A. Moran, and J. A. Eisen. 2006. Metabolic complementarity and genomics of the dual bacterial symbiosis of sharpshooters. PLoS Biol. 4:e188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Wu, M., L. V. Sun, J. Vamathevan, M. Riegler, R. Deboy, J. C. Brownlie, E. A. McGraw, W. Martin, C. Esser, N. Ahmadinejad, C. Wiegand, R. Madupu, M. J. Beanan, L. M. Brinkac, S. C. Daugherty, A. S. Durkin, J. F. Kolonay, W. C. Nelson, Y. Mohamoud, P. Lee, K. Berry, M. B. Young, T. Utterback, J. Weidman, W. C. Nierman, I. T. Paulsen, K. E. Nelson, H. Tettelin, S. L. O'Neill, and J. A. Eisen. 2004. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2:e69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Yang, Z. 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13:555-556. [DOI] [PubMed] [Google Scholar]
  • 93.Youderian, P., and P. L. Hartzell. 2007. Triple mutants uncover three new genes required for social motility in Myxococcus xanthus. Genetics 177:557-566. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]
supp_74_21_6782__1.pdf (210.9KB, pdf)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES