Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2008 Sep 12;74(21):6814–6817. doi: 10.1128/AEM.01106-08

Distribution of Different Species of the Bacteroides fragilis Group in Individuals with Japanese Cedar Pollinosis▿

Toshitaka Odamaki 1,*, Jin-Zhong Xiao 1, Mitsuo Sakamoto 2, Shizuki Kondo 1, Tomoko Yaeshima 1, Keiji Iwatsuki 1, Hideo Togashi 3, Tadao Enomoto 4, Yoshimi Benno 2
PMCID: PMC2576713  PMID: 18791010

Abstract

We investigated associations of species of the Bacteroides fragilis group with Japanese cedar pollinosis (JCPsis). Cell numbers of Bacteroides fragilis and Bacteroides intestinalis were significantly higher in JCPsis subjects than in non-JCPsis subjects before the pollen season. They correlated positively with both symptom scores and JCPsis-specific immunoglobulin E levels.


Japanese cedar pollinosis (JCPsis), an immunoglobulin E (IgE)-mediated type I allergy caused by exposure to Japanese cedar (Cryptomeria japonica) pollen (JCP), represents a public health issue affecting over 16% of the Japanese population (4). In clinical studies evaluating the effects of a probiotic strain, Bifidobacterium longum BB536, on JCPsis, we found that administration of B. longum BB536 significantly alleviated some subjective symptoms and affected blood markers in individuals with JCPsis (20-22). Furthermore, we observed fluctuations in the Bacteroides fragilis group among individuals with JCPsis in the pollen season, with administration of B. longum BB536 suppressing these fluctuations (12, 13). The genus Bacteroides is known as one of the predominant intestinal bacteria in humans. The Bacteroides fragilis group has been suggested to be associated with allergic disease in several clinical studies (5, 8, 16). However, the taxonomy of the genus Bacteroides has undergone significant changes in the past few years (15), owing to the redefinition of the genus Bacteroides and the application of molecular biological techniques leading to the identification of several novel species (1-3, 6, 9). Little has been determined regarding the distributions of these bacteria in human fecal microbiota.

In the present study, we designed 14 specific primer pairs to detect species in the Bacteroides fragilis group that have been isolated from and identified in human feces and investigated distributions of each species for individuals with JCPsis and those without JCPsis by real-time PCR, to evaluate possible associations with JCPsis.

Clinical study.

Samples came from a clinical study reported by Xiao et al. (21) evaluating the effects of B. longum BB536 on clinical symptoms of JCPsis and blood parameters. Briefly, a total of 44 adults with JCPsis were randomized to ingest either B. longum BB536 powder (BB536 group; 13 men and 9 women; mean age, 36.0 ±7.3 years) or placebo powder (placebo group; 13 men and 9 women; mean age, 36.5 ±8.1 years), in a randomized, double-blinded design during the pollen season (20 January to 21 April). Fourteen healthy adults who were JCP specific, IgE negative, and without prior history of spring allergic rhinitis (healthy group, 11 men and 3 women; mean age, 33.4 ± 7.6 years) were administered placebo powder during the same intervention period in an identical manner to JCPsis subjects. Participants were instructed to collect specimens in a plastic tube, cool the bag immediately to <10°C, and deliver the sample within 12 h. Collected specimens were stored at −80°C until analysis.

Design and specificity of primer pairs.

DNA extraction from fecal samples was performed as described previously (13). Fourteen 16S rRNA gene-targeted species-specific primers (Table 1) were designed and checked for specificity according to previous reports (10, 14). The amplification program consisted of 94°C for 10 s, followed by 35 cycles of 94°C for 5 s and 60°C for 30 s. Melting curves were obtained by heating from 60°C to 95°C in increments of 0.2°C/s, with continuous fluorescence collection. DNA extracts from the type strains listed in Table 1 were used as standards for the determination of the cell number of each species. The specificity of each primer pair was then tested using DNA extracts from all strains listed in Table 1, with the addition of Parabacteroides distasonis JCM 5825T, Parabacteroides merdae JCM 9497T, Prevotella intermedia JCM 12248T, and Porphyromonas gingivalis JCM 8525, 12257T. Each specific primer yielded positive PCR results for the corresponding target bacterium and negative PCR results for nontarget microorganisms.

TABLE 1.

PCR primers for detection of each species in the Bacteroides fragilis group

Target species Primer Sequence (5′ to 3′) Product size (bp) Strain(s) for validation
Bacteroides caccae BaCAC-F GGGCATCAGTTTGTTTGCTT 180 JCM 9498T
BaCAC-R GAACGCATCCCCATCTCATA
Bacteroides coprocola BaCOP-F TATGGTGAGATTGCATGATGG 575 JCM 12979T, 12980
BaCOP-R ATGAACGTCAGTTACAGTTTAGCAA
Bacteroides coprophilus BaCPP-F GGGTTGTAAACTTCTTTTGTGC 241 JCM 13816, 13818T
BaCPP-R GCCTCAACCGTACTCAAGGT
Bacteroides dorei BaDOR-F GGAAACGGTTCAGCTAGCAATA 147 JCM 13471T, 13472
BaDOR-R AGTCTTGTCAGAGTCCTCAGCATC
Bacteroides eggerthii BaEGG-F ATAGTTTTTCCGCATGGTTTC 214 JCM 12986T
BaEGG-R GGCTGGTTCAGACTCTCGTC
Bacteroides finegoldii BaFIN-F CCGGATGGCATAGGATTGTC 173 JCM 13345T, 13346
BaFIN-R CGTAGGAGTTTGGACCGTGT
Bacteroides fragilis BaFRA-F TGATTCCGCATGGTTTCATT 243 JCM 11017, 11019T
BaFRA-R CGACCCATAGAGCCTTCATC
Bacteroides intestinalis BaINT-F AGCATGACCTAGCAATAGGTTG 169 JCM 13265T, 13266
BaINT-R ACGCATCCCCATCGATTAT
Bacteroides ovatus BaOVA-F CCGGATAGCATACGAACATC 173 JCM 5824T
BaOVA-R CGTAGGAGTTTGGACCGTGT
Bacteroides plebeius BaPLE-F ATCATTAAAGATTTATCGGTGTACG 404 JCM 12973T, 12974
BaPLE-R ACTTTCACAGCTGACTTAACGAC
Bacteroides stercoris BaSTE-F AAAGCTTGCTTTGATGGATG 406 JCM 9496T
BaSTE-R ACATACAAAAAGCCACACGTC
Bacteroides thetaiotaomicron BaTHE-F ATCAGACCGCATGGTCTTAT 244 JCM 5827T
BaTHE-R CAACCCATAGGGCAGTCATC
Bacteroides uniformis BaUNI-F TACCCGATGGCATAGTTCTT 164 JCM 5828T, 13286
BaUNI-R GGACCGTGTCTCAGTTCCAA
Bacteroides vulgatus BaVUL-F GCAGATGAATTACGGTGAAAGC 154 JCM 5826T
BaVUL-R GTCAGAGTCCTCAGCGGAAC

Distribution of each species of the Bacteroides fragilis group in fecal samples.

Analyses were conducted on fecal samples collected from individuals that completed the study before (20 January, before the sample intake) and after (21 April) the pollen season. We observed some different distributions of the Bacteroides fragilis group for the JCPsis group compared with the healthy group before the pollen season (Table 2). In particular, cell numbers of Bacteroides fragilis and Bacteroides intestinalis were significantly higher in the JCPsis group than in the non-JCPsis group (Table 2).

TABLE 2.

Cell numbers of each species of the Bacteroides fragilis group in fecal samples before pollen season

Species Mean cell no./g ± SD (% prevalence)a
Pollinosis (n = 44) Healthy (n = 14) Total (n = 58)
Bacteroides caccae 8.95 ± 0.85 (40.9) 8.61 ± 0.79 (71.4) 8.83 ± 0.83 (48.3)
Bacteroides coprocola 8.64 ± 0.55 (20.5) 9.03 ± 0.31 (28.6) 8.76 ± 0.51 (22.4)
Bacteroides coprophilus 7.93 ± 0.64 (11.4) NDb (0) 7.93 ± 0.64 (8.6)
Bacteroides dorei 8.83 ± 0.77 (84.1) 8.49 ± 0.57 (92.9) 8.74 ± 0.73 (86.2)
Bacteroides eggerthii 8.17 ± 0.89 (38.6) 7.94 ± 0.63 (21.4) 8.14 ± 0.85 (34.5)
Bacteroides finegoldii 7.62 ± 0.51 (25.0) 8.05 ± 0.30 (14.3) 7.68 ± 0.50 (22.4)
Bacteroides fragilis 8.50 ± 0.86 (75.0)* 8.19 ± 0.37 (35.7) 8.46 ± 0.81 (65.5)
Bacteroides intestinalis 8.65 ± 0.81 (36.4)* 8.54 ± 0.00 (7.1) 8.64 ± 0.79 (29.3)
Bacteroides ovatus 8.28 ± 0.48 (61.4) 8.25 ± 0.50 (50.0) 8.27 ± 0.48 (58.6)
Bacteroides plebeius 8.17 ± 0.78 (29.6) 7.87 ± 0.81 (28.6) 8.10 ± 0.77 (29.3)
Bacteroides stercoris 8.89 ± 0.51 (15.9) ND (0) 8.89 ± 0.51 (12.1)
Bacteroides thetaiotaomicron 9.12 ± 0.74 (45.5) 8.64 ± 0.24 (57.1) 8.99 ± 0.67 (48.3)
Bacteroides uniformis 9.04 ± 0.93 (79.6) 8.94 ± 0.68 (100) 9.01 ± 0.86 (84.5)
Bacteroides vulgatus 9.50 ± 1.09 (68.2) 9.40 ± 0.56 (71.4) 9.48 ± 0.98 (69.0)
Total (14 species) 9.88 ± 0.94 (100) 9.68 ± 0.56 (100) 9.83 ± 0.87 (100)
a

Cell numbers (mean ± standard deviation) were determined as log10 cells per gram (wet weight) of feces among individuals over detection limits, with prevalence given as a percentage in parentheses. Detection limits for each bacterial species by real-time PCR were 106/g (wet weight) of feces. Statistical analyses were performed using SPSS version 14.0 statistical software (SPSS, Japan). Intergroup differences were analyzed using the Mann-Whitney U test on cell numbers after logarithmic transformation, by substituting data with log 106 values for individuals under the detection limits. *, P < 0.05 for significant intergroup difference compared with the healthy group.

b

ND, not detected (<log 106 cells/g).

Compared to the pre-pollen season, totals of nine, six, and two species of the Bacteroides fragilis group were increased significantly after the pollen season in the placebo, BB536 and healthy groups, respectively (Table 3). Among these, when taking notice of those species that increased among the JCPsis subjects, it was found that Bacteroides caccae, Bacteroides vulgatus, Bacteroides fragilis, and Bacteroides intestinalis were significantly increased only in the placebo group.

TABLE 3.

Cell numbers for species of the Bacteroides fragilis group in fecal samples before and after pollen season

Species Time relative to pollen season Mean cell no./g ± SD (% prevalence)a
Placebo (n = 13) BB536 (n = 20) Healthy (n = 14)
Bacteroides caccae Before 8.84 ± 0.06 (30.8) 8.73 ± 0.81 (35.0) 8.61 ± 0.79 (71.4)
After 8.73 ± 0.90 (61.5)* 8.47 ± 0.99 (45.0) 8.54 ± 0.46 (64.3)
Bacteroides coprocola Before 8.69 ± 0.46 (23.1) 8.72 ± 0.38 (15.0) 9.03 ± 0.31 (28.6)
After 9.89 ± 0.00 (7.7) 9.77 ± 0.26 (15.0) 8.96 ± 0.54 (28.6)
Bacteroides coprophilus Before 7.70 ± 0.33 (23.1) 8.99 ± 0.00 (5.0) NDb (0)
After 7.95 ± 0.00 (7.7) 9.28 ± 1.72 (10.0) 7.72 ± 0.20 (14.3)
Bacteroides dorei Before 8.98 ± 0.89 (92.3) 8.82 ± 0.62 (75.0) 8.49 ± 0.57 (92.9)
After 9.52 ± 0.94 (100)* 9.16 ± 1.15 (95.0)** 8.74 ± 0.67 (92.9)
Bacteroides eggerthii Before 7.89 ± 0.58 (46.2) 8.15 ± 0.90 (30.0) 7.94 ± 0.63 (21.4)
After 8.97 ± 0.77 (53.9)* 8.64 ± 0.76 (50.0)* 9.26 ± 0.56 (21.4)
Bacteroides finegoldii Before 7.76 ± 0.30 (30.8) 7.53 ± 0.24 (15.0) 8.05 ± 0.30 (14.3)
After 8.70 ± 0.37 (30.8) 8.52 ± 0.22 (15.0) 8.41 ± 0.11 (21.4)
Bacteroides fragilis Before 8.80 ± 0.78 (92.3)† 8.30 ± 0.51 (70.0) 8.19 ± 0.37 (35.7)
After 9.43 ± 0.78 (92.3)*†‡ 9.12 ± 0.65 (50.0) 8.36 ± 0.79 (42.9)
Bacteroides intestinalis Before 8.13 ± 0.41 (23.1) 8.60 ± 0.83 (45.0) 8.54 ± 0.00 (7.1)
After 8.87 ± 1.45 (69.2)*† 9.37 ± 0.93 (35.0) 7.70 ± 0.10 (14.3)
Bacteroides ovatus Before 8.24 ± 0.51 (84.6) 8.41 ± 0.47 (60.0) 8.25 ± 0.50 (50.0)
After 8.88 ± 0.55 (92.3)* 8.78 ± 0.71 (70.0)* 8.61 ± 0.64 (71.4)**
Bacteroides plebeius Before 8.42 ± 0.65 (23.1) 8.04 ± 0.58 (35.0) 7.87 ± 0.81 (28.6)
After 9.50 ± 1.60 (30.8) 9.97 ± 1.76 (40.0)* 8.86 ± 0.51 (28.6)
Bacteroides stercoris Before 9.04 ± 0.42 (23.1) 8.05 ± 0.00 (5.0) ND (0)
After 9.04 ± 0.23 (15.4) 8.85 ± 0.64 (20.0) ND (0)
Bacteroides thetaiotaomicron Before 9.24 ± 0.97 (46.2) 8.88 ± 0.21 (40.0) 8.64 ± 0.24 (57.1)
After 9.50 ± 0.62 (69.2)* 9.53 ± 0.61 (55.0)* 9.04 ± 0.48 (64.3)
Bacteroides uniformis Before 9.04 ± 0.88 (76.9) 9.03 ± 0.69 (75.0) 8.94 ± 0.68 (100)
After 10.43 ± 0.59 (84.6)** 9.76 ± 0.98 (85.0)** 9.46 ± 0.71 (100)**
Bacteroides vulgatus Before 9.16 ± 1.22 (53.9) 9.37 ± 0.77 (65.0) 9.40 ± 0.56 (71.4)
After 9.36 ± 1.42 (76.9)* 9.22 ± 1.11 (85.0) 9.26 ± 0.47 (71.4)
Total (14 species) Before 9.85 ± 0.88 (100) 9.66 ± 0.81 (100) 9.68 ± 0.56 (100)
After 10.93 ± 0.50 (100)**† 10.45 ± 0.94 (100)** 9.93 ± 0.55 (100)
a

Cell numbers were determined as log 10 cells per gram (wet weight) of feces, with prevalence given as a percentage in parentheses. Detection limits for each bacterial species by real-time PCR were 106/g (wet weight) of feces. Statistical analyses were performed with SPSS version 14.0 statistical software (SPSS, Japan). Intra- and intergroup differences were analyzed using the Wilcoxon signed-rank test and Kruskal-Wallis H test with Bonferroni's correction, respectively. Both statistical analyses were conducted on cell numbers after logarithmic transformation, by substituting data with log 106 values for individuals under detection limits. * and **, P < 0.05 and P < 0.01, respectively, for significant intragroup difference from baseline (before); †, P < 0.01 for significant intergroup difference from the healthy group at each time point; ‡, P < 0.01 for significant intergroup difference between the placebo and BB536 groups at each time point.

b

ND, not detected (<log 106 cells/g).

Comparing cell numbers after pollen season, significant intergroup differences were found for Bacteroides fragilis and Bacteroides intestinalis between the placebo and healthy groups and significant intergroup differences were found for Bacteroides fragilis between the placebo and BB536 groups.

Correlation analyses.

Significant positive correlations with clinical symptom scores and JCP-specific IgE levels were observed for cell numbers of Bacteroides fragilis and Bacteroides intestinalis either before or after the pollen season (Table 4). Conversely, significant negative correlations with JCP-specific IgE level were observed for cell numbers of Bacteroides uniformis and Bacteroides caccae before the pollen season.

TABLE 4.

Correlations between cell number of Bacteroides species and composite symptom score and JCPsis-specific IgE

Species ρ value fora:
AUC of composite symptom scoresb
JCP IgE
Before pollen season After pollen season Before pollen season After pollen season
Bacteroides caccae −0.151 −0.088 −0.337* −0.110
Bacteroides coprocola −0.092 −0.103 0.024 −0.024
Bacteroides coprophilus 0.245 0.236 0.073 −0.020
Bacteroides dorei 0.182 0.298* 0.172 0.349*
Bacteroides eggerthii 0.067 0.131 −0.005 0.070
Bacteroides finegoldii 0.077 0.130 0.034 −0.039
Bacteroides fragilis 0.345* 0.412** 0.320* 0.363*
Bacteroides intestinalis 0.491** 0.622** 0.301* 0.304*
Bacteroides ovatus 0.186 0.238 0.073 0.173
Bacteroides plebeius 0.000 0.030 0.130 0.133
Bacteroides stercoris 0.321* 0.041 0.163 0.195
Bacteroides thetaiotaomicron −0.060 0.008 0.042 0.180
Bacteroides uniformis −0.176 0.097 −0.420** −0.043
Bacteroides vulgatus −0.116 0.108 −0.163 0.187
Total (14 species) 0.067 0.330* −0.042 0.419**
a

Analyses were performed using SPSS version 14.0 statistical software (SPSS, Japan). Spearman's ρ coefficients and P values were calculated on cell numbers after logarithmic transformation, by substituting data with log 106 values for individuals under detection limits. * and **, P < 0.05 and P < 0.01, respectively, for significant correlation.

b

Weekly total scores for sneezing, rhinorrhea, nasal blockage, nasal itching, eye symptoms and throat symptoms recorded during the pollen season were totaled as composite scores. Areas under the curves (AUC) were then calculated using changes in score during pollen dispersion (21).

Conclusions.

We observed that cell numbers of Bacteroides fragilis and Bacteroides intestinalis were significantly higher in the JCPsis group than in the healthy group before and after the pollen season. Furthermore, significant positive correlations were found between the cell numbers of these two species with composite symptom scores and JCP-specific IgE. Our data suggest that prevalence of Bacteroides fragilis and Bacteroides intestinalis might represent risk factors for JCPsis. In addition, no significant change was observed in cell numbers of Bacteroides fragilis or Bacteroides intestinalis in the BB536 group, suggesting that intake of B. longum BB536 may play a role in stabilizing the microbiota, which might in turn exert suppressive effects on sensitization to pollen and/or symptom development.

Increased prevalence of the Bacteroides fragilis group has been observed in individuals with allergic diseases or under stress conditions (5, 7, 8, 16, 17). In vitro studies have demonstrated that Bacteroides fragilis perturbed host immunity (11, 12, 18, 19). These lines of evidence implied an exacerbating effect of the Bacteroides fragilis group on allergic disorders. To the best of our knowledge, this is the first report to outline a possible association between the species of the Bacteroides fragilis group and allergic diseases, although we cannot deny that there might be some biases in the cell numbers of each species since they have only been determined by the quantitative PCR method. Nevertheless, the results from the intra/intergroup differences should have not been influenced greatly. Further studies are needed to confirm these results, especially for Bacteroides intestinalis since the prevalence was relatively low.

Acknowledgments

We thank Hidenori Hayashi of the Maebashi Institute of Technology for guidance with novel species of the Bacteroides fragilis group.

Footnotes

▿

Published ahead of print on 12 September 2008.

REFERENCES

  • 1.Bakir, M. A., M. Kitahara, M. Sakamoto, M. Matsumoto, and Y. Benno. 2006. Bacteroides intestinalis sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 56:151-154. [DOI] [PubMed] [Google Scholar]
  • 2.Bakir, M. A., M. Sakamoto, M. Kitahara, M. Matsumoto, and Y. Benno. 2006. Bacteroides dorei sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 56:1639-1643. [DOI] [PubMed] [Google Scholar]
  • 3.Bakir, M. A., M. Kitahara, M. Sakamoto, M. Matsumoto, and Y. Benno. 2006. Bacteroides finegoldii sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 56:931-935. [DOI] [PubMed] [Google Scholar]
  • 4.Enomoto, T. 2004. Reevaluation of hygiene theory. Arerugi 53:465-468. (In Japanese.) [PubMed] [Google Scholar]
  • 5.Fukuda, S., H. Ishikawa, Y. Koga, Y. Aiba, K. Nakashima, L. Cheng, and T. Shirakawa. 2004. Allergic symptoms and microflora in schoolchildren. J. Adolesc. Health 35:156-158. [DOI] [PubMed] [Google Scholar]
  • 6.Hayashi, H., K. Shibata, M. A. Bakir, M. Sakamoto, S. Tomita, and Y. Benno. 2007. Bacteroides coprophilus sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 57:1323-1326. [DOI] [PubMed] [Google Scholar]
  • 7.Holdeman, L. V., I. J. Good, and W. E. Moore. 1976. Human fecal flora: variation in bacterial composition within individuals and a possible effect of emotional stress. Appl. Environ. Microbiol. 31:359-375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kirjavainen, P. V., T. Arvola, S. J. Salminen, and E. Isolauri. 2002. Aberrant composition of gut microbiota of allergic infants: a target of bifidobacterial therapy at weaning? Gut 51:51-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kitahara, M., M. Sakamoto, M. Ike, S. Sakata, and Y. Benno. 2005. Bacteroides plebeius sp. nov. and Bacteroides coprocola sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 55:2143-2147. [DOI] [PubMed] [Google Scholar]
  • 10.Matsuda, K., H. Tsuji, T. Asahara, Y. Kado, and K. Nomoto. 2007. Sensitive quantitative detection of commensal bacteria by rRNA-targeted reverse transcription-PCR. Appl. Environ. Microbiol. 73:32-39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Obiso, R. J., Jr., A. O. Azghani, and T. D. Wilkins. 1997. The Bacteroides fragilis toxin fragilysin disrupts the paracellular barrier of epithelial cells. Infect. Immun. 65:1431-1439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Odamaki, T., J. Z. Xiao, N. Iwabuchi, M. Sakamoto, N. Takahashi, S. Kondo, K. Iwatsuki, S. Kokubo, H. Togashi, T. Enomoto, and Y. Benno. 2007. Fluctuation of fecal microbiota in individuals with Japanese cedar pollinosis during pollen season. J. Investig. Allergol. Clin. Immunol. 17:92-100. [PubMed] [Google Scholar]
  • 13.Odamaki, T., J. Z. Xiao, N. Iwabuchi, M. Sakamoto, N. Takahashi, S. Kondo, K. Miyaji, K. Iwatsuki, H. Togashi, T. Enomoto, and Y. Benno. 2007. Influence of Bifidobacterium longum BB536 intake on faecal microbiota in individuals with Japanese cedar pollinosis during the pollen season. J. Med. Microbiol. 56:1301-1308. [DOI] [PubMed] [Google Scholar]
  • 14.Ririe, K. M., R. P. Rasmussen, and C. T. Witter. 1997. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal. Biochem. 245:154-160. [DOI] [PubMed] [Google Scholar]
  • 15.Sakamoto, M. 2007. Recent classification of the genus Bacteroides and related taxa. Microbiol. Cult. Coll. 23:1-16. (In Japanese.) [Google Scholar]
  • 16.Songjinda, P., J. Nakayama, A. Tateyama, S. Tanaka, M. Tsubouchi, C. Kiyohara, T. Shirakawa, and K. Sonomoto. 2007. Differences in developing intestinal microbiota between allergic and non-allergic infants: a pilot study in Japan. Biosci. Biotechnol. Biochem. 71:2338-2342. [DOI] [PubMed] [Google Scholar]
  • 17.Takatsuka, H., Y. Takemoto, T. Okamoto, Y. Fujimori, S. Tamura, H. Wada, M. Okada, A. Kanamaru, and E. Kakishita. 2000. Changes in microbial flora in neutropenic patients with hematological disorders after the Hanshin-Awaji earthquake. Int. J. Hematol. 71:273-277. [PubMed] [Google Scholar]
  • 18.Vieira, J. M., D. C. Vallim, E. O. Ferreira, S. H. Seabra, R. C. Vommaro, T. E. Avelar, W. De Souza, M. C. Ferreira, and R. M. Domingues. 2005. Bacteroides fragilis interferes with iNOS activity and leads to pore formation in macrophage surface. Biochem. Biophys. Res. Commun. 326:607-613. [DOI] [PubMed] [Google Scholar]
  • 19.Wu, S., J. Powell, N. Mathioudakis, S. Kane, E. Fernandez, and C. L. Sears. 2004. Bacteroides fragilis enterotoxin induces intestinal epithelial cell secretion of interleukin-8 through mitogen-activated protein kinases and a tyrosine kinase-regulated nuclear factor-κB pathway. Infect. Immun. 72:5832-5839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Xiao, J. Z., S. Kondo, N. Yanagisawa, N. Takahashi, T Odamaki, N. Iwabuchi, K. Iwatsuki, S. Kokubo, H. Togashi, K. Enomoto, and T. Enomoto. 2006. Effect of probiotic Bifidobacterium longum BB536 in relieving clinical symptoms and modulating plasma cytokine levels of Japanese cedar pollinosis during the pollen season, a randomized, double-blind, placebo-controlled trial. J. Investig. Allergol. Clin. Immunol. 16:86-93. [PubMed] [Google Scholar]
  • 21.Xiao, J. Z., S. Kondo, N. Yanagisawa, N. Takahashi, T. Odamaki, N. Iwabuchi, K. Miyaji, K. Iwatsuki, H. Togashi, K. Enomoto, and T. Enomoto. 2006. Probiotics in the treatment of Japanese cedar pollinosis: a double-blind placebo-controlled trial. Clin. Exp. Allergy 36:1425-1435. [DOI] [PubMed] [Google Scholar]
  • 22.Xiao, J. Z., S. Kondo, N. Takahashi, T. Odamaki, N. Iwabuchi, K. Miyaji, K. Iwatsuki, and T. Enomoto. 2007. Changes in plasma TARC levels during Japanese cedar pollen season and relationships with symptom development. Int. Arch. Allergy Immunol. 144:123-127. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES