Abstract
Neostatin-7, with an anti-angiogenic potential, is generated from the proteolytic action of matrix metalloproteinase-7 on collagen XVIII. We previously reported that neostatin-7 inhibited angiogenesis in vitro and in vivo. Here we demonstrate that neostatin-7/collagen XVIII may possess anti-lymphangiogenic activities by: 1) corneal micropellet implantation of neostatin-7 reduced bFGF-induced corneal lymphangiogenesis; 2) neostatin-7 bound to VEGF receptor-3 in vitro; and 3) enhanced corneal lymphangiogenesis and VEGF-C expression in collagen XVIII knockout mice in a corneal wounding model. Understanding the mechanism of neostatin-7/collagen XVIII on corneal lymphangiogenesis may provide therapeutic interventions to treat lymphangiogenesis-related disorders, such as lymphedema, transplantation rejection and cancers.
1. Introduction
Lymphangiogenesis is defined as proliferation of new lymphatics by sprouting from veins or de novo from lymphangioblasts [1]. The lymphatic networks play an important physiological role in the regulation of tissue fluid homeostasis in immune responses to pathogens and fat absorption [2]. In pathological disorders, lymphangiogenesis frequently occurs in corneal wound healing, the inflammatory setting of corneal transplantation, and the spreading of malignant tumors [3].
In the normal state, the cornea is avascular. Corneal angiogenesis and lymphangiogenesis are mediated by the growth factors of the VEGF family. VEGF-A induces corneal vasculogenesis and angiogenesis by binding to VEGF receptor-1 (VEGFR1/flt-1) and -2 (VEGFR2/flk-1/KDR). VEGF-C and VEGF-D, lymphangiogenic factors, both bind to their high-affinity receptors, VEGFR2 and VEGFR3. Recently, soluble VEGFR1 in corneal epithelium was shown to mediate primarily inhibitory or decoy functions for corneal angiogenesis [4]. Similarly, VEGFR3 expression in corneal epithelium acts as a sink for VEGF-C and –D [5].
Vascular endothelial growth factor receptor (VEGFR)-3 has also been shown to be involved in lymphangiogenesis during development. VEGFR-3 is localized mainly to the lymphatic vessels, and mutations of VEGFR-3 may cause primary lymphedema [6]. Additionally, inhibition of VEGFR-3 signaling by soluble VEGFR-3 or a neutralizing antibody lead to lymphatic vessel regression in a transgenic mouse model [3,7–9]. VEGF-C is a known ligand of VEGFR-3 and has been shown to be able to induce the growth of new lymphatic vessels in vivo. VEGF-C belongs to the larger VEGF family of growth factors and is required for the initial sprouting and migration of lymphatic endothelial cells from embryonic veins. Mice lacking VEGF-C die prenatally [10, 11].
Collagen XVIII has been shown to be cleaved by several proteases, including MMP-7, MMP-14, and Cathepsin L, to generate endostatin containing fragments and endostatin [12–14]. MMP-7 cleaves NC-1 fragments of collagen XVIII to generate neostatin-7, which contains an additional 60 amino acids at the N-terminal of endostatin. MMP-14 cleaves NC-1 fragments to generate neostatin-14, which contains 14 additional amino acids at the N-terminal of endostatin.
Endostatin, an anti-angiogenic factor, is a 20 kDa proteolytic fragment of collagen XVIII [15]. This fragment has been shown to inhibit bFGF- and VEGF-induced vascular endothelial cell migration and proliferation in vitro, and to diminish tumor progression in mice in vivo [16],[17]. Similarly, endostatin-containing fragments also possess anti-angiogenic properties. The mechanisms of endostatin in anti-angiogenic and anti-tumor growth have been intensively investigated. For example, Kim et al. showed that endostatin binds directly to VEGF receptor 2 but not to VEGF. This specific binding blocked VEGF-induced tyrosyl phosphorylation of VEGFR2, MAP kinase, and focal adhesion kinase in human umbilical vein endothelial cells [18].
Recently, Teodoro et al. demonstrated a genetic and biochemical linkage between the p53 tumor suppressor pathway and the synthesis of antiangiogenic collagen XVIII fragments [19]. Based on our previous study of neostatin-7 inhibiting bFGF-induced corneal neovascularization [5,16,20], we further investigated the effects of neostatin-7on bFGF-induced corneal lymphangiogenesis in vivo and its interaction with VEGFR3 in vitro. Our data was in agreement with Brideau et al. who showed diminished-lymphangiogenesis in carcinogen-induced skin tumors in transgenic J4 mice overexpressing endostatin in their keratinocytes [21].
In this report, we showed an involvement of collagen XVIII/neostatin-7 in corneal lymphangiogenesis through: 1) enhanced corneal lymphangiogenesis and VEGF-C expression in collagen XVIII knockout mice after corneal keratectomy; 2) inhibited bFGF-induced corneal lymphangiogenesis in vivo with recombinant neostatin-7 treatment; and 3) binding of recombinant neostatin-7 to VEGFR3-Fc in vitro. These findings provide a basis for further understanding the mechanism of neostatin-7 in corneal lymphangiogenesis. In addition, this information may lead to future therapeutic interventions for the treatment of lymphangiogenesis-related disorders, such as transplantation rejection and cancer metastasis.
2. Materials and Methods
2.1. Animals
Col18a1−/− mice were generously provided by Drs. B. Olsen and N. Fukai (Department of Oral and Developmental Biology, Harvard School of Dental Medicine, Boston, Massachusetts). This study was conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and has been approved by the Animal Care and Use Committee at the University of Illinois at Chicago.
2.2. Generation of recombinant GST-neostatin-7
Mouse collagen XVIII cDNAs containing neostatin-7 were amplified through polymerase chain reactions (PCR) from the NC1 fragment and subcloned into the pGEX vector (pharmacia). The primers used were 5’ XVIII neostatin-7 CCTGAGGCACGGAATTCCAGGTGGCTGCTTTCC and 3’ XVIII endostatin CTGCCACCCTAGCTGGCGGCCGCCTATTTGGAGAAAGAGG. These constructs were transformed into E. coli (BL21DE3, Novagen, Madison, WI), and a single colony was isolated for each construct. The bacteria were grown to semi-log phase isopropyl thiogalactopyanoside (Gibco BRL, Gaithersburg, MD), at which point they were induced with 0.3 mM of IPTG to produce GST-neostatin-7 fusion protein. The bacteria were then lysed with lysis buffer (RIPA containing lysozyme), and the protein was isolated using glutathione sepharose 4B beads (Pharmacia). GST-endostatin--containing fragments were eluted with 10 mM glutathione (in 50 mM Tris-HCl pH 8.0) and dialyzed against PBS. The purity of the GST-fusion protein was determined by Coomassie Brilliant Blue staining.
2.3. Corneal pocket assay with bFGF in the presence of GST or GST-endostatin-containing fragments
A corneal micropocket assay was performed as described previously [22,23]. Briefly, wild-type mice (C57BL/6) were anesthetized by intraperitoneal injection of ketamine and xylazine. Corneal micropockets were created using a modified von Graefe knife. Uniformly sized hydron pellets containing 80 ng of human bFGF (R&D Systems, Minneapolis, MN, USA) with either 500ng of GST or GST-neostatin-7 and 40 µg of sucrose aluminum sulfate were implanted into corneal pockets. The eyes were then examined and photographed on day seven with post-pellet implantation by slit lamp microscopy (Nikon, Tokyo, Japan). The neovascular area was calculated using the NIH ImageJ program. Corneas were whole mount immunostained with anti-LYVE-1 and CD31 antibodies and then analyzed by confocal microscopy.
2.4. Mouse corneal keratectomy model
The whole mount immunohistochemistry staining was used to assay corneal lymphangiogenesis. Trephine (1.5 mm) was used to make an incision to the mid stroma. The central part of the corneal stroma was dissected seven days post keratectomy wounding. Corneal lymphatic and vascularized vessels were immunostained with anti-LYVE-1 and CD31 antibodies, and were examined with confocal microscopy.
2.5. Whole-mount immunohistochemistry of corneal lymphangiogenesis
Whole corneas, treated with bFGF pellets or keratectomy, were fixed in a 4:1 mixture of 100% methanol and dimethyl sulfoxide for two hours at room temperature and then in 100% methanol at −20°C. The corneas were treated further with 70%, 50%, and 30% methanol (in phosphate-buffered saline) for 30 minutes each. The corneas were then blocked with 1% bovine serum albumin in PBS for 30 minutes, immunostained with anti-LYVE-1 and CD31 antibodies, and incubated overnight at 4°C. After washing with PBS, the secondary antibodies, FITC-conjugated donkey anti-rabbit and Cy5-conjugated donkey anti-rat IgG (Jackson ImmunoResearch, West Grove, PA), were incubated for four hours. After immunostaining, the corneas were cut using four radial incisions from the peripheral rim, flattened on the glass slide, and subsequently examined by confocal microscopy (Leica, Heidelberg, Germany).
3. Results
3.1. GST-neostatin-7 reduced bFGF-induced corneal angiogenesis and lymphangiogenesis
A schematic diagram of type XVIII collagen, NC1, and neostatin-7 is depicted in Figure 1A. To isolate sufficient amounts of GST-neostatin-7 for neostatin-7 and VEGF receptor binding assays in vitro and corneal implantation in vivo, GST and GST-neostatin-7 constructs were used to generate proteins from E. coli. The Coomassie Brilliant Blue staining bands in Figure 1B correspond to the molecular weight of GST (~26 kDa) and GST-neostatin-7 (~54 kDa).
Figure 1.
Purification of GST-neostatin-7 from E. coli. A) Schematic diagram of type XVIII collagen, NC1, and neostatin-7. B) GST and GST-neostatin-7 were isolated, subjected to SDS gel electrophoresis, and stained with Coomassie Brilliant Blue. Lane 1 = molecular weight markers; Lane 2 = GST; lane 3 = GST-neostatin-7.
We previously demonstrated that the injection of neostatin-7-naked DNA into mouse corneas reduced bFGF-induced corneal neovascularization when compared to vector-injected control corneas [16]. To address whether or not co-implantation of neostatin-7 proteins and bFGF in the cornea can reduce bFGF-induced cornea neovascularization, bFGF (80ng/pellet) plus GST (500ng/pellet), bFGF (80ng/pellet), and GST-neostatin-7 (500ng/pellet) were implanted into mouse corneas, and corneal neovascularization images were taken by slit lamp seven days post-implantation (Figure 2A, 2E[A1]). bFGF-induced corneal neovascularization was significantly reduced in corneas that were implanted with pellets containing GST-neostatin-7 (Figure 2E) relative to that in bFGF and GST implanted cornea controls (Figure 2A). The NIH ImageJ digitized neovascularized areas from these two types of implanted corneas were calculated and compared, as shown in Figure 2I (p < 0.05).
Figure 2.
[A2] GST-neostatin-7 reduced bFGF-induced corneal hem- and lymphangiogenesis. Mouse corneas were implanted with bFGF (80ng/pellet) plus either GST (500ng/pellet) (A) or GST-neostatin-7 protein (500ng/pellet) (B). Corneal neovascularization images were taken by slit lamp microscopy seven days after pellet implantation. The pellet containing GST-neostatin-7 significantly reduced bFGF-induced neovascularization (I). Corneal lymphangiogenesis was visualized by whole mount immunohistochemical staining using anti-LYVE-1 antibody on day seven after pellet implantation. Enhanced corneal lymphangiogenesis was visualized in GST plus bFGF implanted corneas (B)[A3]; however, diminished corneal lymphatic vessels were observed in GST-neostatin-7 plus bFGF implanted corneas (F). Overlay images of corneal angiogenesis and lymphangiogenesis are shown in D and H, respectively. Quantification of lymphatic vessels showed a reduction in corneal lymphatic vessels in GST-neostatin-7 implanted cornea (J). * represents p < 0.05.
Corneal lymphangiogenesis and neovascularization were visualized on day seven, after either bFGF plus GST or bFGF plus GST-neostatin-7 implantation. Diminished corneal lymphatic vessels were observed in the GST-neostatin-7 plus bFGF implanted cornea (Figure 2F) relative to that in the GST plus bFGF implanted cornea (Figure 2B). The areas of cornea lymphangiogenesis in the GST-neostatin-7 plus bFGF were smaller than those of the GST plus bFGF implanted corneas (Figure 2J).
3.2. GST-neostatin-7 binds to recombinant VEGFR3-Fc in vitro
Kubo et al. showed that blockage of VEGF receptor 3 signaling inhibited bFGF-induced corneal lymphangiogenesis [24]. To determine if neostatin-7 is associated with VEGFR3 in vitro, we performed an in vitro pull-down assay and subsequent Western blot analysis. We detected GST-neostatin-7 association with recombinant VEGFR3-Fc in vitro (Figure 4, lane 4), but GST did not associate with VEGFR3-Fc as a negative control (Figure 4, lane 3).
Figure 4.
Enhanced corneal lymphangiogenesis in col18a1−/− mouse corneas after keratectomy wounding. Corneas were wounded by 1.5 mm keratectomy in WT and col18a1−/− mice. A slit lamp photograph of col18a1−/− mice (A) and WT mice (E) on day seven after keratectomy displayed no obvious corneal neovascularization. Mouse corneas were wholemount immunostained with anti-LYVE-1 and CD31 antibodies, and visualized by confocal microscopy. Little or no corneal lymphatic vessels were visualized in WT mouse corneas after keratectomy (F), but keratectomy-induced corneal lymphatic vessels were visualized in the col18a1−/− mouse corneas (B). Overlay images of corneal angiogenesis and lymphangiogenesis are[A4] shown in (D) and (H), respectively. Quantification of lymphatic vessel areas were compared between anti-LYVE immunostained col18a1−/− and WT mouse corneas (I). * represents p < 0.05.
3.3. Enhanced corneal lymphangiogenesis in col18a1−/− mouse cornea after keratectomy wounds
To address whether or not collagen XVIII (the parent molecule of neostatin-7) plays a role in the regulation of corneal lymphangiogenesis, corneas of WT and col18a1−/− mice were wounded by 1.5 mm keratectomy. Enhanced corneal lymphatic and vascular vessels were visualized in the col18a1−/− mouse corneas (Figures 4B and 4C), and few to no corneal lymphatic vessels were detected in WT mouse corneas seven days after corneal keratectomy (Figures 4F, 4G). The areas of lymphatic vessels in keratectomy-treated col18a1−/− corneas were three times larger than those of wild type keratectomy-treated mouse corneas (Figure 4I). Additionally, enhanced corneal VEGF-C expression was detected in the keratectomy-treated cornea in col18a1−/− mice relative to that in wild-type mice (Figure 5).
Figure 5.
Enhanced VEGF-C production in col18a1−/− mouse after corneal keratectomy. VEGF-C expression increased in the limbal area with little expression in the central cornea in col18a1−/− mice. The level of VEGF-C expression in keratectomy-treated col18a1−/− mouse corneas was approximately three times that of wild type mouse corneas.
4. Discussion
Neostatin-7, a 28 kDa fragment, is generated by MMP-7 cleavage of type XVIII collagen. Neostatin-7 is one of several naturally occurring endostatin-spanning fragments identified in human blood [13,25]. Type XVIII collagen is a basement membrane protein and is expressed in ocular basement membranes, including the vascular endothelial membrane and Bowman’s membrane of the cornea [26,27]. The location of collagen XVIII and its proteolytic degraded fragments in corneal tissues may imply that it plays a role in corneal angiogenesis and lymphangiogenesis.
Endostatin and neostatin-7 are generated by different protease cleavages of collagen XVIII. It has been shown that endostatin is generated by the cleavage of collagen XVIII by Cathepsin B, D, and L [12,14]. Endostatin inhibits cell migration and cell proliferation, decreases tumor size, and enhances vascular endothelial cell apoptosis in vitro and in vivo [21]. The mechanisms involved in the effect of endostatin on vascular endothelial cells have been extensively investigated, and several endostatin-associated molecules have been isolated and characterized, including matrix metalloproteinase-2, L-selectin, integrin αvβ3, VEGF receptor, tropomyosin, glypican, laminin, and heparin-like glycosaminoglycans [28,29]. Such data suggests that endostatin binds to these cellular counterparts, and this binding may facilitate the inhibitory function of endostatin in vascular endothelial cell proliferation.
The anti-angiogenic properties of endostatin and neostatin-7 have been revealed by the knockout of the parent molecule collagen XVIII gene in mice. The potency difference between the effects of neostatin-7 and endostatin on corneal lymphangiogenesis remains to be determined. A delayed regression of blood vessels in the vitreous along the surface of the retina after birth as well as an abnormal outgrowth of retinal vessels in col18a1−/− mice have been shown [30]. Loss of collagen XVIII in mice has shown increased angiogenic response in aortic explants and enhanced neovascularization and vascular permeability in atherosclerosis [31], [32]. Investigations of injury-induced corneal lymphangiogenesis in collagen XVIII knockout mice imply that collagen knockout mice may be deficient in anti-lymphangiogenic molecules (i.e. proteolytic fragments of collagen XVIII such as endostatin and neostatin-7).
In the cornea, the balance between lymphangiogenic, angiogenic, and anti-angiogenic factors controls the avascular milieu of the cornea and is governed by many variable factors. Stimuli from injuries generate various responses aimed to produce factors and prevent hemangiogenesis and lymphangiogenesis. Our previously published data demonstrated an up-regulation of MMP-7 in wild-type animal wounding models and an increased vascular response in MMP-7-deficient littermates [33]. It is our hypothesis that MMP-7-derived, endostatin-containing fragments (including neostatin-7) may be among factors that prevent new vascular and lymphatic vessel formation after wounding.
Lymphangiogenesis is an essential component in many physiologic and pathologic processes such as development, tissue growth, wound repair, and cancer metastasis. The onset of corneal lymphangiogenesis is regulated by the balance between pro-lymphangiogenic and anti-lymphangiogenic factors. Corneal lymphangiogenesis may require not only the up-regulation of pro-lymphangiogenic factors, but also the down-regulation of anti-lymphangiogenic factors. Use of the cornea as a model has allowed the study of lymphangiogenic and anti-lymphangiogenic molecules in vivo. Although the involvement of neostatin-7 is not proved in the corneal model of the enhanced effect of injury-induced corneal lymphangiogenesis in collagen XVIII knockout mice, our injury-induced corneal lymphangiogenesis model in collagen XVIII knockout mice showed that collagen XVIII or one of its degradation products is involved in regulating corneal lymphangiogenesis during wound healing. Our data also showed that enhanced corneal lymphangiogenesis and VEGF-C expression were present in keratectomy-treated collagen XVIII knockout mice.
In addition, reduced bFGF-induced corneal lymphangiogenesis by neostatin-7 was demonstrated by administration of recombinant GST-neostatin-7 and bFGF in corneal micropellet implantation. These results confirm and expand upon previous findings in mouse skin [21]. In addition, the novel observation of the neostatin-7 binding with VEGFR3 in vitro may provide a role for neostatin-7 in the regulation of corneal lymphangiogenesis. The significance of this finding may provide new target molecules for the treatment of corneal and ocular angiogenic- and lymphangiogenic-related disorders, as well as neoplasm, wounds, and infections.
Figure 3.
GST-neostatin-7 bound to recombinant VEGFR3-Fc in vitro. Purified GST and GST-neostatin-7 from E. coli were mixed with or without recombinant VEGFR3-Fc in the RIPA buffer. GST-neostatin-7 associated VEGFR3-Fc was pulled down by glutathione beads and assayed by Western blot using an anti-VEGFR3 antibody. GST-neostatin-7 associated with recombinant VEGFR3-Fc (lane 4), and GST that did not associate with VEGFR3-Fc served as a negative control (lane 3). Recombinant VEGFR3-Fc served as a positive control (lane 5). Lane 1=GST only, and lane 2=GST-neostatin-7 only.
Acknowledgements
We thank Drs. Björn Olsen and Naomi Fukai for providing Col18a1−/− mice.
Supported by EY01792, EY10101 (DTA), NIH EY14048 (JHC), the Illinois Society for the Prevention of Blindness, and Research to Prevent Blindness grant.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- 1.Ji RC. Lymphatic endothelial cells, lymphangiogenesis, and extracellular matrix. Lymphat Res Biol. 2006;4:83–100. doi: 10.1089/lrb.2006.4.83. [DOI] [PubMed] [Google Scholar]
- 2.Hirakawa S, Detmar M. New insights into the biology and pathology of the cutaneous lymphatic system. J Dermatol Sci. 2004;35:1–8. doi: 10.1016/j.jdermsci.2003.10.006. [DOI] [PubMed] [Google Scholar]
- 3.He Y, et al. Vascular endothelial cell growth factor receptor 3-mediated activation of lymphatic endothelium is crucial for tumor cell entry and spread via lymphatic vessels. Cancer Res. 2005;65:4739–4746. doi: 10.1158/0008-5472.CAN-04-4576. [DOI] [PubMed] [Google Scholar]
- 4.Ambati BK, et al. Corneal avascularity is due to soluble VEGF receptor-1. Nature. 2006;443:993–997. doi: 10.1038/nature05249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cursiefen C, et al. Nonvascular VEGF receptor 3 expression by corneal epithelium maintains avascularity and vision. Proc Natl Acad Sci U S A. 2006;103:11405–11410. doi: 10.1073/pnas.0506112103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Karkkainen MJ, Ferrell RE, Lawrence EC, Kimak MA, Levinson KL, McTigue MA, Alitalo K, Finegold DN. Missense mutations interfere with VEGFR-3 signalling in primary lymphoedema. Nat Genet. 2000;25:153–159. doi: 10.1038/75997. [DOI] [PubMed] [Google Scholar]
- 7.Hamada K, Oike Y, Takakura N, Ito Y, Jussila L, Dumont DJ, Alitalo K, Suda T. VEGF-C signaling pathways through VEGFR-2 and VEGFR-3 in vasculoangiogenesis and hematopoiesis. Blood. 2000;96:3793–3800. [PubMed] [Google Scholar]
- 8.Lin J, et al. Inhibition of lymphogenous metastasis using adeno-associated virus-mediated gene transfer of a soluble VEGFR-3 decoy receptor. Cancer Res. 2005;65:6901–6909. doi: 10.1158/0008-5472.CAN-05-0408. [DOI] [PubMed] [Google Scholar]
- 9.Laakkonen P, et al. Vascular endothelial growth factor receptor 3 is involved in tumor angiogenesis and growth. Cancer Res. 2007;67:593–599. doi: 10.1158/0008-5472.CAN-06-3567. [DOI] [PubMed] [Google Scholar]
- 10.Karkkainen MJ, et al. Vascular endothelial growth factor C is required for sprouting of the first lymphatic vessels from embryonic veins. Nat Immunol. 2004;5:74–80. doi: 10.1038/ni1013. [DOI] [PubMed] [Google Scholar]
- 11.Karkkainen MJ, Petrova TV. Vascular endothelial growth factor receptors in the regulation of angiogenesis and lymphangiogenesis. Oncogene. 2000;19:5598–5605. doi: 10.1038/sj.onc.1203855. [DOI] [PubMed] [Google Scholar]
- 12.Sasaki T, Fukai N, Mann K, Gohring W, Olsen BR, Timpl R. Structure, function and tissue forms of the C-terminal globular domain of collagen XVIII containing the angiogenesis inhibitor endostatin. Embo J. 1998;17:4249–4256. doi: 10.1093/emboj/17.15.4249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ferreras M, Felbor U, Lenhard T, Olsen BR, Delaisse J. Generation and degradation of human endostatin proteins by various proteinases. FEBS Lett. 2000;486:247–251. doi: 10.1016/s0014-5793(00)02249-3. [DOI] [PubMed] [Google Scholar]
- 14.Ma DH, et al. Generation of endostatin by matrix metalloproteinase and cathepsin from human limbocorneal epithelial cells cultivated on amniotic membrane. Invest Ophthalmol Vis Sci. 2007;48:644–651. doi: 10.1167/iovs.06-0884. [DOI] [PubMed] [Google Scholar]
- 15.O'Reilly MS, et al. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell. 1997;88:277–285. doi: 10.1016/s0092-8674(00)81848-6. [DOI] [PubMed] [Google Scholar]
- 16.Chang JH, Javier JA, Chang GY, Oliveira HB, Azar DT. Functional characterization of neostatins, the MMP-derived, enzymatic cleavage products of type XVIII collagen. FEBS Lett. 2005;579:3601–3606. doi: 10.1016/j.febslet.2005.05.043. [DOI] [PubMed] [Google Scholar]
- 17.Folkman J. Antiangiogenesis in cancer therapy--endostatin and its mechanisms of action. Exp Cell Res. 2006;312:594–607. doi: 10.1016/j.yexcr.2005.11.015. [DOI] [PubMed] [Google Scholar]
- 18.Kim YM, Hwang S, Kim YM, Pyun BJ, Kim TY, Lee ST, Gho YS, Kwon YG. Endostatin blocks vascular endothelial growth factor-mediated signaling via direct interaction with KDR/Flk-1. J Biol Chem. 2002;277:27872–27879. doi: 10.1074/jbc.M202771200. [DOI] [PubMed] [Google Scholar]
- 19.Teodoro JG, Parker AE, Zhu X, Green MR. p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase. Science. 2006;313:968–971. doi: 10.1126/science.1126391. [DOI] [PubMed] [Google Scholar]
- 20.Chen L, Hamrah P, Cursiefen C, Zhang Q, Pytowski B, Streilein JW, Dana MR. Vascular endothelial growth factor receptor-3 mediates induction of corneal alloimmunity. Nat Med. 2004;10:813–815. doi: 10.1038/nm1078. [DOI] [PubMed] [Google Scholar]
- 21.Brideau G, Makinen MJ, Elamaa H, Tu H, Nilsson G, Alitalo K, Pihlajaniemi T, Heljasvaara R. Endostatin overexpression inhibits lymphangiogenesis and lymph node metastasis in mice. Cancer Res. 2007;67:11528–11535. doi: 10.1158/0008-5472.CAN-07-1458. [DOI] [PubMed] [Google Scholar]
- 22.Kato T, Kure T, Chang JH, Gabison EE, Itoh T, Itohara S, Azar DT. Diminished corneal angiogenesis in gelatinase A-deficient mice. FEBS Lett. 2001;508:187–190. doi: 10.1016/s0014-5793(01)02897-6. [DOI] [PubMed] [Google Scholar]
- 23.Kenyon BM, Voest EE, Chen CC, Flynn E, Folkman J, D'Amato RJ. A model of angiogenesis in the mouse cornea. Invest Ophthalmol Vis Sci. 1996;37:1625–1632. [PubMed] [Google Scholar]
- 24.Kubo H, Cao R, Brakenhielm E, Makinen T, Cao Y, Alitalo K. Blockade of vascular endothelial growth factor receptor-3 signaling inhibits fibroblast growth factor-2-induced lymphangiogenesis in mouse cornea. Proc Natl Acad Sci U S A. 2002;99:8868–8873. doi: 10.1073/pnas.062040199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lin HC, Chang JH, Jain S, Gabison EE, Kure T, Kato T, Fukai N, Azar DT. Matrilysin cleavage of corneal collagen type XVIII NC1 domain and generation of a 28-kDa fragment. Invest Ophthalmol Vis Sci. 2001;42:2517–2524. [PubMed] [Google Scholar]
- 26.Bhutto IA, Kim SY, McLeod DS, Merges C, Fukai N, Olsen BR, Lutty GA. Localization of collagen XVIII and the endostatin portion of collagen XVIII in aged human control eyes and eyes with age-related macular degeneration. Invest Ophthalmol Vis Sci. 2004;45:1544–1552. doi: 10.1167/iovs.03-0862. [DOI] [PubMed] [Google Scholar]
- 27.Halfter W, Dong S, Schurer B, Cole GJ. Collagen XVIII is a basement membrane heparan sulfate proteoglycan. J Biol Chem. 1998;273:25404–25412. doi: 10.1074/jbc.273.39.25404. [DOI] [PubMed] [Google Scholar]
- 28.Reis RC, Schuppan D, Barreto AC, Bauer M, Bork JP, Hassler G, Coelho-Sampaio T. Endostatin competes with bFGF for binding to heparin-like glycosaminoglycans. Biochem Biophys Res Commun. 2005;333:976–983. doi: 10.1016/j.bbrc.2005.06.011. [DOI] [PubMed] [Google Scholar]
- 29.Vazquez F, Hastings G, Ortega MA, Lane TF, Oikemus S, Lombardo M, Iruela-Arispe ML. METH-1, a human ortholog of ADAMTS-1, and METH-2 are members of a new family of proteins with angio-inhibitory activity. J Biol Chem. 1999;274:23349–23357. doi: 10.1074/jbc.274.33.23349. [DOI] [PubMed] [Google Scholar]
- 30.Fukai N, et al. Lack of collagen XVIII/endostatin results in eye abnormalities. Embo J. 2002;21:1535–1544. doi: 10.1093/emboj/21.7.1535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li Q, Olsen BR. Increased angiogenic response in aortic explants of collagen XVIII/endostatin-null mice. Am J Pathol. 2004;165:415–424. doi: 10.1016/S0002-9440(10)63307-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Moulton KS, Olsen BR, Sonn S, Fukai N, Zurakowski D, Zeng X. Loss of collagen XVIII enhances neovascularization and vascular permeability in atherosclerosis. Circulation. 2004;110:1330–1336. doi: 10.1161/01.CIR.0000140720.79015.3C. [DOI] [PubMed] [Google Scholar]
- 33.Kure T, et al. Corneal neovascularization after excimer keratectomy wounds in matrilysin-deficient mice. Invest Ophthalmol Vis Sci. 2003;44:137–144. doi: 10.1167/iovs.01-1058. [DOI] [PubMed] [Google Scholar]





