Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Jul 1.
Published in final edited form as: Cytometry A. 2008 Jul;73(7):637–642. doi: 10.1002/cyto.a.20579

A long-term flow cytometry assay to analyze the role of specific genes of Drosophila melanogaster S2 cells in surviving genotoxic stress

Xia Yi 1,2, Willy Lemstra 1, Michel J Vos 1, Yongfeng Shang 2, Harm H Kampinga 1, Tin Tin Su 3, Ody CM Sibon 1,*
PMCID: PMC2579795  NIHMSID: NIHMS75890  PMID: 18496848

Abstract

Background

Drosophila S2 cells are easy to manipulate and to culture and are a versatile model system for high throughput screens such as genome-wide siRNA screens to find genes involved in stress or therapy resistance or for screening through large compound libraries to identify cytotoxins. Clonogenic assays are considered the gold-standard to investigate the cytotoxicity of specific treatments or to compare the sensitivity of various cell types for a specific treatment. However, this assay cannot be used for Drosophila S2 cells as they are virtually unable to grow in distinct colonies.

Methods

We designed a novel fluorescence-based flow cytometry assay to study long-term proliferation of S2 cells under various conditions and in the presence of specific gene products or after downregulation of specific gene products.

Results

Here we validate this assay and we used this novel method to investigate the role of checkpoint genes grapes/Dchk1 and DmChk2 in cell survival responses.

Conclusions

Our data demonstrate that Grapes/Dchk1 but not DmChk2 is required to survive hydroxyurea. Our assay will be of use to investigate long-term effects of various treatments in S2 cells and to evaluate the role of specific proteins therein.

Keywords: viability, sensitivity, Drosophila S2 cells, FCM, DNA damage, survival assay, RNAi technology, grapes/Dchk1, DmChk2

Introduction

The ability of cells to form clones after a certain treatment is often used to study the survival potential of specific cells (1). This so-called clonogenic assay is a method to determine proliferation capacity because this assay determines the actual ability of a cell to repeatedly divide and thereby form a visible colony. For clonogenic assays, cells under investigation must be able to form colonies on a solid surface (for adherent cells) or in fluid medium or substrates such as agar for non-adherent cells. Besides clonogenic assays there are alternative methods to evaluate proliferation or viability of cells under specific conditions or after specific treatments. In these assays, incorporation rates of radiolabeled nucleotides such as 3H-thymidine can be used as an indication for proliferation (2). Other well-known assays to quantify viability, such as the MTT assay (3) or the MTS assay (4), measure the concentration of products generated or converted by viable cells. Using these alternative assays it is not possible to distinguish between actual cell death or delayed cell death, temporary growth inhibition or permanent growth inhibition and this may hamper proper data analysis. Therefore, (although time-consuming) the long-term clonogenic assay is considered as a golden standard to investigate the proliferation capacity of dividing cells. Drosophila melanogaster Schneider line 2 (S2) cells are derived from a primary culture of 20 to 24-hour-old Drosophila embryos. These cells are relatively easy to culture because the cells can grow at room temperature without controlled CO2 levels. S2 cells normally grow in semisuspension and do not need trypsinization prior to passaging. Another powerful characteristic of S2 cells is that multiple transcripts can be simultaneously downregulated with near to 100 % efficiency by using RNAi technology in transient assays (5,6). In addition, S2 cells are highly permeable and no expensive transfection carriers are needed to perform RNAi studies. Finally, S2 cells do not induce an interferon response that interferes with RNAi gene silencing (7). Consequently, S2 cells are relatively easy to manipulate and provide a powerful model system to investigate the pro- or anti- survival functions of specific genes. Unfortunately, clonogenic assays can not be used for S2 cells because they are not adherent and do not grow as discrete colonies. Here, we present a simple method using flow cytometry (FCM) to accurately compare the proliferation capacity of S2 cells in response to specific treatments and in the presence or absence of specific proteins over an extended period of time. A unique feature of our assay is continual adjustment of cell density in various samples under analysis, using two methods. First we use “feeder cells” (which are differentially marked from experimental cells) to equalize total cell densities in cultures subjected to different treatments in order to rule out indirect effects on survival due to differences in cell number. Second, our protocol includes adjustment of cell densities every two days in order to extend the period of exponential growth thus allowing us to analyze long-term effects. In addition to established methods, this approach will be useful to study long-term effects in other suspension cells as well, especially for cells that cannot be analyzed by clonogenic assays.

Materials and methods

Cell culture

Drosophila Schneider’s S2 cells (S2 cells), S2 cells that stably express nuclear luciferase-eGFP and S2 cells that stably express H2B-GFP were cultured in Schneider’s Drosophila medium (GIBCO, Paisley, UK) supplemented with 10% heat-inactivated Fetal Bovine Serum (Greiner, Netherlands), 100 units/ml penicillin and 100 μg/ml streptomycin in T25 flasks at 25°C. Nuclear luciferase-eGFP (eGFP-tagged firefly luciferase fused to the Large T Antigen nuclear localization signal) expressing cells were generated according to the protocol of the manufacturer (Drosophila expression system, Invitrogen). H2B-GFP expressing S2 cells are a generous gift of P.H. O’Farrell (San Francisco, California, USA). In order to continue exponential cell growth, cell density was kept between 3×105 cells/ml and 3×106 cells/ml. For experimental use the cells were cultured in 6 well plates or in 35 mm dishes.

RNA interference

RNA interference was performed as previously described (5,8). In short, a grp/Dchk1 or DmChk2 DNA fragment of 700~800 bp in length containing a coding sequence of the grp/Dchk (GenBank accession no. AF057041, sense primer 493–509 and anti-sense primer 1185–1200) or DmChk2 cDNA (Gen Bank accession no. NM-165318: sense primer 666–683 and anti-sense primer 1395–1413) were amplified using PCR. Each primer used in the PCR contained a 5′ T7 RNA polymerase binding site (GAATTAATACGACTCACTATAGGGAGA) followed by the sequence specific for grp/Dchk1 or DmChk2. dsRNA was generated by using a MEGASCRIPT T7 transcription kit (Ambion, Austin, TX) and stored at −20°C. Nuclear luciferase-eGFP-expressing S2 cells, H2B-GFP-expressing S2 cells or S2 cells were diluted to a final concentration of 1×106 cells/ml in Drosophila Serum Free Medium (GIBCO, Paisley, UK). 1 ml of cells was plated in 35 mm dishes and 10 μg dsRNA was added to the Serum Free Medium of each dish. No additional transfection agent was added, because it was demonstrated previously that no transfection carriers are required to perform successful RNAi experiments in S2 cells (5,6). The cells were incubated for 1 hour at 25°C followed by addition of 2 ml complete Schneider’s medium. Cells were incubated for 96 hours to downregulate Grp/Dchk1 and/or DmChk2 proteins. Downregulation of Grp/Dchk1 and/or DmChk2 by RNAi was controlled by Western Blot analysis using antibodies specific to Grp/Dchk1 or DmChk2 during the course of every experiment (Supplementary Figure 1). As control cells (further referred to as mock RNAi-treated cells), GFP-expressing S2 cells were transfected with a non-relevant dsRNA construct or no dsRNA was added in the medium. As a non-relevant dsRNA construct, a fragment of the coding sequence of stonewall was used, stonewall is a gene required for oogenesis (9)(see supplementary file). Kinetics of downregulation of Grp/Dchk1 and DmChk2 is comparable in nuclear luciferase-eGFP-expressing cells, in H2B-GFP-expressing cells and in S2 cells.

Proliferation Assay

GFP-expressing-S2 cells (Figure 1) were transfected with dsRNA of interest (e.g. dsRNA of Grp/Dchk1 and/or DmChk2). After 4 days, RNAi-treated GFP-S2 cells were mixed 1:1 with non-GFP expressing S2 cells (further referred to as feeder cells). All the experiments shown in this manuscript were performed using Nuclear luciferase-eGFP expressing cells or H2B-GFP-expressing cells. After an overnight incubation, mixed cells were treated with 10 mM of HU (Sigma, St Louis, MO, USA) for 6 hours or left untreated. This time point is considered as day 0 of the experiment. Subsequently, the fraction of living cells was calculated by staining with trypan blue which detects dead cells (note: immediately after HU treatment, no increase was observed in the amount of dead cells compared to untreated cells). For every condition the following protocol was used. The mixed populations of cells (containing GFP-expressing cells and feeder cells) were subcultured and split into two fractions: cohort Ia and cohort Ib. Cohort Ia was seeded in a density of 3 × 105 living cells per ml medium and cultured in 6-well plates until FCM analysis on day 2 was performed. For detailed describtion of FCM analysis, see supplementary Figure 3. Cohort Ib was seeded in a density of 3 × 105 living cells per ml and were cultured in T25 flask for FCM analysis on later time points (day 4, 6, 9, 11, 13). At day 2 (48 hours after HU treatment), the percentage of GFP-expressing cells of cohort Ia was measured using FCM analysis. Cells of cohort Ib were split again into two fractions (cohort IIa and cohort IIb), suspended and again 3 × 105 (cohort IIa) viable cells per ml medium were seeded in 6-well plates for FCM analysis on day 4 and 3 × 105 viable cells (cohort IIb) per ml were cultured in a T25 flask for FCM analysis on later time points (day 6, 9, 11, 13) etc. During the course of the experiment, every 2 days the density of the cells was adjusted by diluting the mixed populations of cells with fresh medium until a density of 3 × 105 living cells per ml was reached. The percentage of viable cells was calculated using trypan blue staining and cell density was corrected resulting in a constant and narrow range of viable cell density throughout the experiment (see also supplementary file for further details). For every condition, 3 independent experiments were performed and data were presented as mean ± standard deviation of the mean (SDM).

Figure 1. Long-term survival assay.

Figure 1

Schematic representation of the survival assay.

FCM analysis

Cells were harvested by centrifugation, washed once with phosphate-buffered saline (PBS), and cell pellets were resuspended in 0.2–0.5 ml of PBS. The percentage of GFP-expressing cells was determined using a FACSCalibur Flow Cytometer (Becton Dickinson, San Jose, CA), using a 488 nm Argon laser (15 mWatt) and standard filters. 10,000 events were measured from each sample. FL1 was used to detect GFP fluorescence and FL2 for autofluorescence. Data analysis was done with WinList (version 6.0) from Verity Software House (Topsham, ME) (see also supplementary file). In one typical experiment every condition was independently performed and measured in triplicate.

Western blot analysis

Western blot analysis of S2 cells were prepared as previously described using primary rabbit polyclonal antibodies to Grp/Dchk1 and DmChk2 (5)commercial available secondary antibodies and ECL detection reagents (Amersham Biosciences, Amersham Place, UK). γ-tubulin (Sigma T6557, St Louis, MO, USA) was used as a loading control (see also supplementary file).

Results

Drosophila S2 cells are widely used to study the function of specific genes (6,1012). Recently, it was demonstrated that S2 cells possess a functional checkpoint that delays entry of cells into mitosis when DNA is damaged after ionizing radiation (IR) or when DNA replication is inhibited by hydroxyurea (HU) (5). In order to further investigate the role of specific Drosophila genes in responses to DNA damaging agents, a long-term survival assay, applicable for S2 cells, is required. Firstly, we investigated whether S2 cell survival could be investigated using a clonogenic assay. Despite several attempts we were unable to obtain reproducible results using clonogenic assays and S2 cells did not form colonies when grown in various types of agar (data not shown).

As for most (mammalian) tissue culture cells, S2 cells under investigation should be cultured under conditions in which cell densities do not extensively fluctuate and in which cells still grow exponentially. In our laboratory S2 cells are routinely cultured at cell density between 3 × 105 cells/ml and 3 × 106 cells/ml. S2 cell doubling time is hampered when density is lower than 3 × 105 cells/ml or higher than 3 × 106 cells/ml. The cell doubling time of S2 cells is approximately 24 hours. Therefore survival responses need to be investigated within 3–4 days, during which cells grow exponentially. The aim of this study was to design a long-term (>4 days) survival assay for S2 cells to provide a method to study the function of specific genes (such as grapes/Dchk1 (further referred to as grp/Dchk1) and DmChk2) in survival response to various DNA damaging treatments. Because cell density influences S2 cell proliferation, during this long-term assay, cell density needs to be kept under strict control allowing the cells to grow exponentially.

A long-term survival assay to investigate the role of Grp/Dchk1 in DNA damage response pathways

As an alternative method for the clonogenic assay we designed a method depicted in Figure 1. In this assay the proliferation rate of a specific cell type can be compared with the proliferation rate of this specific cell type when a protein of interest is downregulated (e.g. Grp/DmChk1). This can be measured in the presence or absence of a specific treatment (e.g. HU). In this assay two types of cells are being mixed in a 1:1 ratio: GFP-expressing cells in which specific proteins can be downregulated and non-GFP-expressing cells that serve to compensate for cell density (and further referred to as feeder cells). As GFP-expressing cells, nuclear luciferase-eGFP-expressing cells were used. The percentage of GFP-expressing cells within this mixture with feeder cells is measured by FCM analysis. As a control GFP-expressing cells can be mock transfected or transfected with non-relevant dsRNA. These control cells are also being mixed with the same type of feeder cells. To validate this method, the effect on the proliferation capacity of Grp/Dchk1-downregulated cells was compared to the survival of mock-RNAi treated (= Grp/Dchk1 containing) cells under control conditions and after treatment with the DNA synthesis inhibitor HU. Grp/Dchk1 is required for cell cycle checkpoint regulation in response to HU (5). In the absence of Grp/Dchk1 and in the presence of replication inhibition, cells do not show a cell cycle delay, enter mitosis in the presence of incompletely replicated DNA and abnormal cytokineses are observed (5,13). Based on this, the prediction is that Grp/Dchk1-downregulated cells show a decrease in proliferative capacity after HU treatment compared to mock-RNAi treated cells.

Firstly, the efficiency of the RNAi treatment was examined by Western blot analysis and 4 days after the start of the RNAi treatment, Grp/Dchk1 levels were undetectable and remained undetectable for at least 9 more days (Figure 2). Because Grp/Dchk1 protein levels were undetectable 4 days after the start of the RENAi treatment, experiments with the mixed populations of cells were started at this time point (4 days after RNAi treatment therefore corresponds with 0 days after HU treatment). Subsequently, it was tested whether Grp/Dchk1-downregulation affects the proliferation rate of cells. Hereto the percentage of mock RNAi-treated GFP-expressing cells (within the mixture with the feeder cells) was measured at various times and compared to the percentage of Grp/Dchk1-downregulated GFP-expressing cells (within the mixture with the feeder cells). As presented in Figure 3A, there is no large difference in proliferation rate between mock-RNAi treated GFP-expressing cells and Grp/Dchk1-RNAi treated GFP-expressing cells (see supplementary file for statistical analysis). Next, we tested the role of Grp/Dchk1 in surviving HU treatment. Hereto the percentage of GFP-positive cells after HU treatment was measured at various time points. Figure 3A demonstrates that HU reduces proliferation to a larger extent in Grp/Dchk1-downregulated cells compared to mock-RNAi treated cells. In order to exclude that the observed decrease in proliferation capacity in Grp/Dchk1-downregulated cells after HU is only specific for the nuclear luciferase-eGFP-expressing cells, Grp/Dchk1 was downregulated in H2B-GFP-expressing cells and (although the absolute ratios were different) this resulted in a comparable outcome and cells in which Grp/Dchk1 is downregulated show an increased sensitivity to HU compared to cells in which Grp/Dchk1 is not being downregulated (Figure 3B). Note that regardless of normal Grp/Dchk1 expression or downregulation of Grp/Dchk1, the GFP-expressing cells appear to have a growth advantage over the feeder cells because the percentage of fluorescent cells increased to more than 50% during the course of 13 days. However, this does not affect the outcome of the experiments because when the reverse experiment was performed and Grp/Dchk1 was downregulated in non-GFP expressing cells (and the GFP-expressing cells served as feeder cells), this resulted in the same outcome and the Grp/Dchk1-downregulated cells showed an impaired proliferation capacity after HU treatment compared to mock-RNAi treated cells (Supplementary Figure 4). These data are consistent with previous observations demonstrating that grp/Dchk1 mutant larvae are sensitive to HU (1315) and with data that Grp/Dchk1 is required to prevent mitotic catastrophe in the presence of HU (5), demonstrating the validity of our assay.

Figure 2. Downregulation of Grp/Dchk1 after RNAi treatment.

Figure 2

Grp/Dchk1 protein levels were downregulated using RNAi and protein levels were analyzed using a polyclonal rabbit antibody specifically binding to the Grp/DChk1 protein (migrating at 58kD)(5)(see also Supplementary Figure 1). 4 days after RNAi treatment Grp/Dchk1 protein levels were below detection levels. Therefore for the long-term survival assays, the RNAi treated cells were mixed with the feeder cells and HU was added always 4 days after RNAI treatment. 4 days after RNA treatment corresponds therefore with 0 days after HU treatment. Grp/Dchk1 remain undetectable until day 13 after RNAi treatment. These data indicate that during the long-term survival assays Grp/Dchk1 was efficiently downregulated in RNAi treated cells untill 9 days after HU treatment. γ-tubulin was used as a loading control. − = in the presence of mock RNAi treatment; + = in the presence of Grp/Dchk1 RNAi constructs.

Figure 3. Decreased long-term survival after HU treatment of Grp/Dchk1 downregulated cells.

Figure 3

A) Nuclear-luciferase GFP-expressing cells (NucLuc cells) were mock transfected or transfected with specific Grp/Dchk1 dsRNAi constructs, DmChk2 dsRNAi constructs or with both Grp/Dchk1 and DmChk2 dsRNAi constructs 4 days before the start of the experiment. The NucLuc cells were then mixed with non-GFP-expressing cells at a 1:1 ratio. The percentage of GFP-expressing cells under different conditions was measured over time using FCM analysis (explained in Figure 1) and was depicted on the y-axis (day 0 is 4 days after the start of the RNAi treatment, when protein levels are below detection).

B) H2B GFP-expressing cells (H2B cells) were mock transfected or transfected with Grp/Dchk1 dsRNAi constructs or with Stonewall dsRNAi constructs (as a control) 4 days before the start of the experiment. The H2B GFP-expressing cells were then mixed with non-GFP-expressing cells at a 1:1 ratio. The percentage of GFP-expressing cells under different conditions was measured over time using FCM analysis and was depicted on the y-axis (day 0 is 4 days after the start of the RNAi treatment, when protein levels are below detection). For statistical analysis see supplementary file.

DmChk2 is not required to survive HU treatment

After validation of the survival assay, we tested the effect of downregulation of another protein in response to HU. DmChk2 (or Dmnk) is a conserved checkpoint kinase involved in various aspects of DNA damage responses. DmChk2 mediates p53-mediated transcription of DNA repair genes (16), is required for cell cycle checkpoint function during cycle 14 of embryogenesis (17) and is involved in apoptosis (16). However, we previously demonstrated that DmChk2 depleted cells show a normal cell cycle delay in response to HU and that Grp/Dchk1 but not DmChk2 is required for G2/M checkpoint function in the presence of damaged or incompletely replicated DNA (5).

Firstly, it was investigated whether downregulation of DmChk2 was successful during the course of the experiment and it was demonstrated that DmChk2 was not detectable until day 10 after RNAi treatment (Figure 4). Comparable to Grp/Dchk1 RNAi treatment, downregulation of DmChk2 did not change the proliferation rate when cells were cultured under control conditions (Figure 3A). Remarkably, after HU treatment, the proliferation rate of DmChk2-downregulated cells was comparable to HU-treated control cells and DmChk2 downregulated cells are not as sensitive to HU compared to Grp/Dchk1-downregulated cells (Figure 3A).

Figure 4. Downregulation of DmChk2 after RNAi treatment.

Figure 4

DmChk2 protein levels were downregulated using RNAi and protein levels were analyzed using a polyclonal rabbit anti-Dmnk-L antibody (21) recognizing DmChk2 (54 kD). 4 days after RNAi treatment DmChk2 protein levels were below detection levels. Therefore for the long-term survival assays, the RNAi treated cells were mixed with the feeder cells and HU was added always 4 days after RNAi treatment. 4 days after RNA treatment corresponds therefore with 0 days after HU treatment. DmChk2 remain undetectable until day 10 after RNAi treatment. These data indicate that during the long-term survival assays DmChk2 was efficiently downregulated in RNAi treated cells untill 6 days after HU treatment. γ-tubulin was used as a loading control. − = in the presence of mock RNAi treatment; + = in the presence of Grp/Dchk1 RNAi constructs.

Finally, we investigated the proliferative capacity of cells in which both Grp/Dchk1 and DmChk2 were downregulated. Double downregulation of Grp/Dchk1 and DmChk2 was as efficient as downregulation of a single protein (Figure 5). Downregulation of Grp/Dchk1 or DmChk2 alone or downregulation of Grp/Dchk1 and DmChk2 simultaneously did not alter cell proliferation of S2 cells under normal culturing conditions (Figure 3A). Double downregulation of Grp/Dchk1 and DmChk2 did result in a similar decrease in cell proliferation after HU treatment as compared to downregulation of Grp/Dchk1 alone (Figure 3A). Together, these data demonstrate that Grp/Dchk1 and not (or at least to a far lesser extent) DmChk2 is required for maintenance of proliferation of HU-treated cells and although DmChk2 plays multiple roles in DNA damage responses (16,17), none of these DmChk2-dependent responses are required in S2 cells to recover after HU treatment.

Figure 5. Downregulation of Grp/Dchk1 and DmChk2 after RNAi treatment.

Figure 5

DmChk2 protein (54kD) levels and Grp/Dchk1 (58kD) protein levels were downregulated simultaneously using RNAi and protein levels were analyzed using Western blot analysis. 4 days after RNAi treatment both proteins were below detection levels and remain undetectable untill 14 days after RNAi treatment. γ-tubulin was used as a loading control. − = in the presence of mock RNAi treatment; + = in the presence of DmChk2 and Grp/Dchk1 RNAi constructs.

Discussion

In addition to existing methods, the survival assay as we describe here can measure the proliferative capacity of cells in the presence of specific proteins or after downregulation of these proteins, under control culturing conditions or after specific treatments. One characteristics of this assay is that during the course of the experiment cell density is compensated by two means; 1) RNAi-treated (or mock RNAi-treated) GFP-positive cells are mixed with feeder cells and 2) during the course of the experiment, the amount of viable cells per condition is adjusted every 2 days. The adjustment of cell density overcomes the complication that low cell density hampers growth and affects the outcome of the survival experiments. Compensating cell density is especially important when the cells under investigation need to be cultured following strict density protocols. When cell density is not compensated for, in theory, it is possible that a specific treatment is eliminating a large proportion of viable cells and the remaining cells are unable to grow because of the resulting decrease in density below a critical concentration. Their inability to proliferate is now not due to the treatment itself but due to their low density. Thus an assay in which cell density is not compensated for can not be used to distinguish between these two possibilities. In contrast, the assay described here can be applied to investigate the proliferation capacity of cells after treatments that eliminate large proportions of cells.

In the presented assay the percentage of GFP-expressing (RNAi-treated) cells within the mixture with feeder cells is measured over time. In case the percentage of GFP expressing cells is increasing over time, this indicates that the GFP-expressing cells have a growth advantage compared to the feeder cells. Under normal culturing conditions (in the absence of HU) the percentage of GFP-expressing cells increases over time, most likely reflecting a slightly shorter doubling time of GFP expressing cells. This phenomenon is observed in control GFP-expressing cells, mock RNAi-treated, Grp/Dchk1- and DmChk2-downregulated cells. This phenomenon is also observed after HU treatment in control GFP-expressing cells, mock-RNAi treated GFP-expressing cells and in DmChk2-downregulated GFP-expressing cells, demonstrating that the growth advantage of GFP expressing cells is not influenced by HU or by the presence or absence of DmChk2. However, after downregulation of Grp/Dchk1 and in the presence of HU, the percentage of GFP-expressing cells is decreasing over time, indicative for a growth disadvantage of Grp/Dchk1-downregulated cells. Possible explanations for this growth disadvantage are increased cell death, induced cell cycle delay or cell cycle arrest. The observed increased sensitivity of Grp/Dchk1-downregulated cells is not an exclusive phenomenon for GFP-expressing cells because Grp/Dchk1-depleted non-GFP-expressing cells are also more sensitive to HU compared to mock-RNAi treated or DmChk2-downregulated cells (Supplementary Figure 4). The increased sensitivity of Grp/Dchk1-downregulated cells is consistent with previous data published by us and others (5,15,18). However, the observation that downregulation of DmChk2 does not influence proliferation capacity after HU is remarkable. DmChk2 plays a role in various cell cycle checkpoints and DNA damage responses. Based on this, it was prediction that DmChk2-downregulated cells would have been hypersensitive to DNA damaging insults. However, a possible role in cell checkpoint regulation has only been demonstrated during specific stages of embryogenesis (19,20) but not in S2 cells (5). The downregulation of DmChk2 also did not further decrease the proliferation capacity of Grp/Dchk1-downregulated cells, further indicating that DmChk2 in S2 cells does not play a role in recovering from HU-induced impaired DNA integrity.

In summary, the presented assay is a useful tool to evaluate proliferation capacities of cells in suspension and provides an effective method to investigate the function of proteins (individual or simultaneously) involved in responses to various treatments. Because specific proteins are being downregulated in GFP-expressing cells, these cells can subsequently be sorted by FACS and various biochemical assays or expression profile studies can be performed to analyze the consequences of treatments when specific gene products are downregulated. The effect of single treatments can be analyzed but because survival can be investigated over a long period of time, the effect of repeated treatments can be investigated as well as the role of specific genes required for survival of these repeated treatments. When proteins of interest are stably downregulated (or up-regulated), the role of these proteins in survival responses can even be analyzed during an extended period of time.

Acknowledgments

We thank Geert Mesander and Henk Moes for assistence with the FCM analysis. This work was supported by a UMCG Bernouilli Bursary grant (809003) to X.Y, by a grant from the National Institute of Health (GM66441) to T.T.S and by a VIDI grant from the Netherlands Organization for Scientific Research NWO (917-36-400) to O.C.M.S.

Reference List

  • 1.Baroffio A, Dupin E, Le Douarin NM. Clone-forming ability and differentiation potential of migratory neural crest cells. Proc Natl Acad Sci USA. 1988;85:5325–5329. doi: 10.1073/pnas.85.14.5325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bodycote J, Wolff S. Metabolic breakdown of [3H]thymidine and the inability to measure human lymphocyte proliferation by incorporation of radioactivity. Proc Natl Acad Sci USA. 1986;83:4749–4753. doi: 10.1073/pnas.83.13.4749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ferrari M, Fornasiero MC, Isetta AM. MTT colorimetric assay for testing macrophage cytotoxic activity in vitro. J Immunol Methods. 1990;131:165–172. doi: 10.1016/0022-1759(90)90187-z. [DOI] [PubMed] [Google Scholar]
  • 4.Buttke TM, McCubrey JA, Owen TC. Use of an aqueous soluble tetrazolium/formazan assay to measure viability and proliferation of lymphokine-dependent cell lines. J Immunol Methods. 1993;157:233–240. doi: 10.1016/0022-1759(93)90092-l. [DOI] [PubMed] [Google Scholar]
  • 5.de Vries HI, Uyetake L, Lemstra W, Brunsting JF, Su TT, Kampinga HH, Sibon OC. Grp/DChk1 is required for G2-M checkpoint activation in Drosophila S2 cells, whereas Dmnk/DChk2 is dispensable. J Cell Sci. 2005;118:1833–1842. doi: 10.1242/jcs.02309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Goshima G, Vale RD. The roles of microtubule-based motor proteins in mitosis: comprehensive RNAi analysis in the Drosophila S2 cell line. J Cell Biol. 2003;162:1003–1016. doi: 10.1083/jcb.200303022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dykxhoorn DM, Novina CD, Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nat Rev Mol Cell Biol. 2003;4:457–467. doi: 10.1038/nrm1129. [DOI] [PubMed] [Google Scholar]
  • 8.Clemens JC, Worby CA, Simonson-Leff N, Muda M, Maehama T, Hemmings BA, Dixon JE. Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc Natl Acad Sci USA. 2000;97:6499–6503. doi: 10.1073/pnas.110149597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Clark KA, McKearin DM. The Drosophila stonewall gene encodes a putative transcription factor essential for germ cell development. Development. 1996;122:937–950. doi: 10.1242/dev.122.3.937. [DOI] [PubMed] [Google Scholar]
  • 10.Goshima G, Wollman R, Goodwin SS, Zhang N, Scholey JM, Vale RD, Stuurman N. Genes required for mitotic spindle assembly in Drosophila S2 cells. Science. 2007;316:417–421. doi: 10.1126/science.1141314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lents NH, Baldassare JJ. RNA interference takes flight: a new RNAi screen reveals cell cycle regulators in Drosophila cells. Trends Endocrinol Metab. 2006;17:173–174. doi: 10.1016/j.tem.2006.05.003. [DOI] [PubMed] [Google Scholar]
  • 12.Radyuk SN, Klichko VI, Spinola B, Sohal RS, Orr WC. The peroxiredoxin gene family in Drosophila melanogaster. Free Radic Biol Med. 2001;31:1090–1100. doi: 10.1016/s0891-5849(01)00692-x. [DOI] [PubMed] [Google Scholar]
  • 13.Sibon OC, Stevenson VA, Theurkauf WE. DNA-replication checkpoint control at the Drosophila midblastula transition. Nature. 1997;388:93–97. doi: 10.1038/40439. [DOI] [PubMed] [Google Scholar]
  • 14.Sibon OC, Laurencon A, Hawley R, Theurkauf WE. The Drosophila ATM homologue Mei-41 has an essential checkpoint function at the midblastula transition. Curr Biol. 1999;9:302–312. doi: 10.1016/s0960-9822(99)80138-9. [DOI] [PubMed] [Google Scholar]
  • 15.Radcliffe CM, Silva EA, Campbell SD. A method for assaying the sensitivity of Drosophila replication checkpoint mutants to anti-cancer and DNA-damaging drugs. Genome. 2002;45:881–889. doi: 10.1139/g02-051. [DOI] [PubMed] [Google Scholar]
  • 16.Brodsky MH, Weinert BT, Tsang G, Rong YS, McGinnis NM, Golic KG, Rio DC, Rubin GM. Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA damage. Mol Cell Biol. 2004;24:1219–1231. doi: 10.1128/MCB.24.3.1219-1231.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Masrouha N, Yang L, Hijal S, Larochelle S, Suter B. The Drosophila chk2 gene loki is essential for embryonic DNA double-strand-break checkpoints induced in S phase or G2. Genetics. 2003;163:973–982. doi: 10.1093/genetics/163.3.973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jaklevic BR, Su TT. Relative contribution of DNA repair, cell cycle checkpoints, and cell death to survival after DNA damage in Drosophila larvae. Curr Biol. 2004;14:23–32. doi: 10.1016/j.cub.2003.12.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Takada S, Kelkar A, Theurkauf WE. Drosophila checkpoint kinase 2 couples centrosome function and spindle assembly to genomic integrity. Cell. 2003;113:87–99. doi: 10.1016/s0092-8674(03)00202-2. [DOI] [PubMed] [Google Scholar]
  • 20.Xu J, Xin S, Du W. Drosophila Chk2 is required for DNA damage-mediated cell cycle arrest and apoptosis. FEBS Lett. 2001;508:394–398. doi: 10.1016/s0014-5793(01)03103-9. [DOI] [PubMed] [Google Scholar]
  • 21.Oishi I, Sugiyama S, Otani H, Yamamura H, Nishida Y, Minami Y. (1998) A novel Drosophila nuclear protein serine/threonine kinase expressed in the germline during its establishment. Mech Dev. 1998;71:49–63. doi: 10.1016/s0925-4773(97)00200-1. [DOI] [PubMed] [Google Scholar]

RESOURCES