Abstract
The Burkholderia pseudomallei quorum-sensing system (QSS), designated BpsIR, is encoded by five bpsR genes and three bpsI genes. This study investigated the roles and interactions of the QSS determinants in terms of gene regulation and protein interaction. We report two novel findings, that BpsR can function as an activator and a repressor for bpsI expression and that BpsR may form homodimers and heterodimers.
The pathogenic mechanism of a rapidly fatal infection known as melioidosis, caused by Burkholderia pseudomallei, is not well understood (3). In many other gram-negative organisms, virulence genes are under the control of a global cell density-dependent gene regulatory system known as a quorum-sensing system (QSS) (6, 22). In a QSS, expression of target genes is regulated by a complex consisting of a LuxR homologue transcriptional regulatory protein and its cognate N-acylhomoserine lactone (AHL) signal, whose production is directed by a LuxI homologue AHL synthase (6, 18, 22). Recently, several studies have shown that a QSS may play a role in B. pseudomallei pathogenesis because the 50% lethal doses of mutants lacking a QSS were found to be higher, the production of potential virulence factors by such mutants was different, or their pathogenicity in animal models was reduced (2, 17, 19, 21). The gene and protein nomenclature of the B. pseudomallei QSS determinants is confusing because several clinical isolates were used in different studies; the designation PmlIR was used for strains 008 (21) and DD503 (19), BpmIR was used for strain DD503 (19), and BpsIR was used for strains KHW (17) and PP844 (12). However, the QSS of reference strain K96243, whose complete genome sequence is publicly available (8; www.sanger.ac.uk), has not been investigated previously. In this paper, we describe a study of the QSS in strain K96243; for the sake of clarity, we designate this QSS BpsIR, because this designation was used in recent studies describing the QSS of B. pseudomallei (12, 17).
B. pseudomallei contains multiple QSS determinants.
The genome of B. pseudomallei is composed of two chromosomes. Chromosome 1 (4.07 × 106 bp) carries several required regulatory genes associated with growth, while chromosome 2 (3.17 × 106 bp) contains more supporting genes involved in environmental adaptation (8). An in silico genome search demonstrated that B. pseudomallei K96243 contains at least three luxIR homologues, designated bpsI1-bpsR1, bpsI2-bpsR2, and bpsI3-bpsR3, and two additional luxR homologues, designated bpsR4 and bpsR5. Most of these genes are located on chromosome 2; the only exception is bpsR5, which is located on chromosome 1. The orientations, chromosome locations, and GenBank accession numbers of DNA sequences of bpsIR genes identified in this study are shown in Fig. 1. The finding that bpsR4 and bpsR5 are not accompanied by an adjacent luxI homologue indicates that these genes encode solo quorum-sensing receptors (11). Gene regulation by the QSS is believed to occur through direct interaction of a DNA-binding region of a LuxR homologue with a lux box motif, an approximately 18- to 20-bp palindromic sequence located within the promoter region of its target genes (7). However, this may not always be the case as some QSS-controlled genes do not have an identifiable lux box-like motif in their promoters or binding of the LuxR homologue may not require a dyad symmetry recognition sequence (16). Nevertheless, a putative lux box motif of bpsI1 was identified previously (17), and putative lux box motifs of bpsI2 and bpsI 3 were identified in this study, suggesting that bpsI1, bpsI2, and bpsI3 are likely to be autoregulatory target genes of the BpsIR QSS. These motifs in the promoter regions of bpsI1, bpsI2, and bpsI 3 are centered at bp −70.5, −65, and −111.5 upstream of the start codon, respectively, and exhibit 75% (15/20 bp), 73.7% (14/19 bp), and 66.7% (12/18 bp) similarity to the lux box consensus (Fig. 1). In addition, when the genome of B. pseudomallei K96243 was searched, such a motif (at least a partial motif) was found to be present in the promoter region of several genes coding for both identified and hypothetical proteins, mostly on chromosome 2, suggesting that these genes potentially are QSS-controlled targets (data not shown). Previous studies showed that different B. pseudomallei strains produced various profiles of AHL molecules. For example, strain 008 produced only N-decanoyl-homoserine lactone (C10HSL) (21), strain KHW produced up to six types of AHLs, including N-octanoyl-homoserine lactone (C8HSL) and C10HSL (17), and strain PP844 also produced six identified AHLs, including N-(3-oxo)-octanoyl-homoserine lactone (3-oxo-C8HSL), C8HSL, and C10HSL (12). These findings suggested that QSS in B. pseudomallei may be highly complex.
FIG. 1.
Genetic map of bpsR and bpsI genes of B. pseudomallei K96243. The arrows indicate gene orientation. Most genes are located on chromosome 2; the only exception is bpsR5, which is located on chromosome 1 (asterisk). The chromosome locations (according to the GenBank accession number BX57196 and BX571966 sequences for chromosome 1 and chromosome 2, respectively) are indicated under the arrows, and the GenBank accession numbers for sequences are indicated in parentheses. The box at the bottom shows the lux box consensus sequence (6) and lux box-like sequences located upstream of genes bpsI1 to bpsI3; the positions relative to the start codon are indicated. The shaded nucleotides match nucleotides in the consensus sequence. The nucleotide abbreviations are as follows: N is A, T, C, or G; R is A or G; S is C or G; Y is T or C; and X is N or a gap in the sequence. The figure is not drawn to scale.
Upregulation of bpsI1 requires BpsR1 and is dependent on C8HSL levels.
It was shown previously that in a bpsI1 mutant of strain KHW harboring a plasmid-borne bpsI1′-lacZ transcriptional fusion, expression of bpsI1 could be restored by exogenously adding C8HSL (17). This suggested that C8HSL is required for bpsI1 expression. However, it has never been directly demonstrated that BpsR1 is needed in conjunction with C8HSL to activate bpsI and that the expression of bpsI1 is dependent on C8HSL levels. To investigate this, we monitored the expression of bpsI1 in a heterologous host, Escherichia coli DH5α. Expression of bpsI1 was measured by using the β-galactosidase activity of bpsI1, which contained an approximately 330-bp promoter region upstream of the transcriptional start site, fused to a promoterless lacZ gene using an assay described previously (14). Plasmids pPK2 and pPK3.1 containing a bpsI-lacZ fusion without and with an intact bpsR1 gene (under control of its own promoter), respectively, were constructed using the pLP170 vector (Table 1) and were used to transform E. coli DH5α. The results are shown in Fig. 2. Without BpsR1 and/or C8HSL, the basal level of expression of bpsI1 was observed. In the presence of BpsR1, bpsI1 expression was observed with C8HSL at levels as low as 0.01 μM. The expression of bpsI1 increased as the C8HSL concentration increased, and the maximum expression was observed with 1 μM C8HSL. Therefore, both BpsR1 and C8HSL are required for the expression of bpsI1, and bspsI1 expression is C8HSL dose dependent. Furthermore, these studies demonstrate that functional BpsR is expressed in this heterologous host.
TABLE 1.
Bacterial strains and plasmids used in this study
| Strain or plasmid | Relevant phenotype or characteristics | Reference or source |
|---|---|---|
| B. pseudomallei K92643 | Prototrophic; genome sequencing strain | 8 |
| E. coli strains | ||
| DH5α | F′ endA1 hsdR17 supE44 thi-1 recA gyrA relA1 Δ(argF-lac)U169 deoR [φ80dlacZΔM15 recA1] | 23 |
| SU101 | lexA71::Tn5 (Def)sulA211Δ(lacIPOZYA)169 F′ lacIqlacZΔM15::Tn9 sulA::lacZ lysogen | 5 |
| SU202 | Similar to SU101 but containing hybrid LexA operator sequence | 5 |
| Plasmids | ||
| pLP170 | Cloning vector containing promoterless lacZ; Apr | 15 |
| pPK2 | pLP170 carrying a 0.8-kb bpsI1-lacZ fragment; Apr | This study |
| pPK3.1 | pLP170 carrying a 1.1-kb bpsR1 fragment and a 0.8-kb bpsI1-lacZ fragment; Apr | This study |
| pPK3.2 | pLP170 carrying a 1.1-kb bpsR1 fragment and a 0.9-kb bpsI2-lacZ fragment; Apr | This study |
| pPK3.3 | pLP170 carrying a 1.1-kb bpsR1 fragment and a 0.8-kb bpsI3-lacZ fragment; Apr | This study |
| pPK5 | pLP170 carrying a 0.9-kb bpsI2-lacZ fragment; Apr | This study |
| pPK6.1 | pLP170 carrying a 1.2-kb bpsR2 fragment and a 0.8-kb bpsI1- lacZ fragment; Apr | This study |
| pPK6.2 | pLP170 carrying a 1.2-kb bpsR2 fragment and a 0.9-kb bpsI2-lacZ fragment; Apr | This study |
| pPK6.3 | pLP170 carrying a 1.2-kb bpsR2 fragment and a 0.8-kb bpsI3-lacZ fragment; Apr | This study |
| pPK8 | pLP170 carrying a 0.8-kb bpsI3-lacZ fragment; Apr | This study |
| pPK9.1 | pLP170 carrying a 1.1-kb bpsR3 fragment and a 0.8-kb bpsI1-lacZ fragment; Apr | This study |
| pPK9.2 | pLP170 carrying a 1.1-kb bpsR3 fragment and a 0.9-kb bpsI2-lacZ fragment; Apr | This study |
| pPK9.3 | pLP170 carrying a 1.1-kb bpsR3 fragment and a 0.8-kb bpsI3-lacZ fragment; Apr | This study |
| pPK11.1 | pLP170 carrying a 1.2-kb bpsR4 fragment and a 0.8-kb bpsI1-lacZ fragment; Apr | This study |
| pPK11.2 | pLP170 carrying a 1.2-kb bpsR4 fragment and a 0.9-kb bpsI2-lacZ fragment; Apr | This study |
| pPK11.3 | pLP170 carrying a 1.2-kb bpsR4 fragment and a 0.8-kb bpsI3-lacZ fragment; Apr | This study |
| pPK13.1 | pLP170 carrying a 1.2-kb bpsR5 fragment and a 0.8-kb bpsI1-lacZ fragment; Apr | This study |
| pPK13.2 | pLP170 carrying a 1.2-kb bpsR5 fragment and a 0.9-kb bpsI2-lacZ fragment; Apr | This study |
| pPK13.3 | pLP170 carrying a 1.2-kb bpsR5 fragment and a 0.8-kb bpsI3-lacZ fragment; Apr | This study |
| pSR658 | plac lexADBD, multiple cloning sites; Tcr | 5 |
| pSR659 | plac lexAmutDBD, multiple cloning sites; Apr | 5 |
| pBPR1 | pSR658 carrying a plac lexADBD-bpsR1 fragment; Tcr | This study |
| pBPR2 | pSR658 carrying a plac lexADBD-bpsR2 fragment; Tcr | This study |
| pBPR3 | pSR658 carrying a plac lexADBD-bpsR3 fragment; Tcr | This study |
| pBPR4 | pSR658 carrying a plac lexADBD-bpsR4 fragment; Tcr | This study |
| pBPR5 | pSR658 carrying a plac lexADBD-bpsR5 fragment; Tcr | This study |
| pBPRX1 | pSR659 carrying a plac lexAmutDBD-bpsR1 fragment; Apr | This study |
| pBPRX2 | pSR659 carrying a plac lexAmutDBD-bpsR2 fragment; Apr | This study |
| pBPRX3 | pSR659 carrying a plac lexAmutDBD-bpsR3 fragment; Apr | This study |
| pBPRX4 | pSR659 carrying a plac lexAmutDBD-bpsR4 fragment; Apr | This study |
| pBPRX5 | pSR659 carrying a plac lexAmutDBD-bpsR5 fragment; Apr | This study |
FIG. 2.
Expression of bpsI with various concentrations of AHL. The expression of bpsI was determined by assaying the β-galactosidase activity of a bpsI-lacZ fusion in a recombinant E. coli DH5α strain. The filled bars and bars with stripes indicate bpsI1 expression (from pPK2 or pPK3.1) in the presence of C8HSL and 3-oxo-C8HSL, respectively. The open bars indicate bpsI2 expression (from pPK5 or pPK3.2) in the presence of 3-oxo-C8HSL. AHLs were exogenously added at the final concentrations indicated. The asterisk indicates assays with no BpsR1, while other assays were performed with intact BpsR1. The data are averages ± standard deviations of three independent assays.
Expression of bpsI does not always require BpsR or AHL.
The roles of BpsR and AHLs other than BpsR1 and C8HSL have never been demonstrated. We wondered how the multiple QSS determinants in B. pseudomallei affect the expression of bpsI. To investigate this, we cloned bpsI2 and bpsI3 into the pLP170 vector in order to construct lacZ fusions in plasmids pPK5 and pPK8, respectively. We constructed a series of plasmids, each of which contained bpsI-lacZ and one of various bpsR genes in order to obtain different combinations of bpsR and bpsI-lacZ (Table 1). The primers used to clone each gene are shown in Table 2. Fusion expression was monitored in the E. coli DH5α host in order to exclude other factors that might affect bpsI expression in the indigenous B. pseudomallei background, which allowed the role of each BpsR protein and AHL to be directly evaluated. Exogenous AHL was added at a final concentration of 1 μM to ensure proper expression of bpsI. Four types of AHLs were selected for study; C8HSL, 3-oxo-C8HSL, and C10HSL were included because they were previously detected in strains of B. pseudomallei, and N-hexanoyl-homoserine lactone (C6HSL), which has never been detected in any strain of B. pseudomallei, was included for comparison. The expression of each bpsI gene in the presence of various BpsR proteins and AHLs is summarized in Table 3. The results show that bpsI1 expression was partially activated when BpsR1 was present with (in addition to C8HSL) 3-oxo-C8HSL or C10HSL. This suggests that C8HSL plays a major role in activating bpsI1 and that BpsR1 is not specific to only C8HSL but, to the lesser extent, also forms a functional complex with 3-oxo-C8HSL or C10HSL. These results correlated well with the results of the dose-dependent study using plasmid pPK3.1, as shown in Fig. 2. At similar AHL concentrations, activation of bpsI1 by 3-oxo-C8HSL was dose dependent but not as efficient as activation of bpsI1 by C8HSL, and the maximum activation occurred at a higher concentration than the maximum activation with C8HSL. Interestingly, we observed that in the presence of BpsR5, bpsI1 was partially activated regardless of the presence of AHL. Expression of bpsI2 apparently occurred even without any BpsR and AHL. In the presence of BpsR2 with any of the AHLs provided, bpsI2 expression was modestly enhanced. All four AHLs used in this study also slightly increased the expression of bpsI2 in the presence of BpsR4 or BpsR5. Additionally, 3-oxo-C8HSL exhibited stronger activity for activation of bpsI2 specifically in the presence of BpsR1 or BpsR3. A study of the dose dependence of bpsI2 in the presence of BpsR1 was then performed to evaluate the dose effect of 3-oxo-C8HSL (Fig. 2). As expected, bpsI2 exhibited moderate basal expression with no addition of AHL. When BpsR1 was provided using plasmid pPK3.2, bpsI2 was expressed in a 3-oxo-C8HSL dose-dependent manner, and its expression was saturated at approximately the same concentrations as BpsR1-3-oxo-C8HSL-dependent bpsI1 expression. Similar to bpsI2, bpsI3 was readily expressed in the absence of BpsR and AHL. When a BpsR protein was present with or without an AHL, however, the levels of bpsI3 expression were obviously reduced, and the repressive effect was milder with BpsR3. Addition of an AHL did not alter the repression of bpsI3. Therefore, these findings demonstrated that, unlike expression of bpsI1, there are intrinsic levels of expression of bpsI2 and bpsI3 that can be modulated by regulators and that BpsR proteins likely act as activators for bpsI2 and as repressors for bpsI3 with less specificity for types of AHLs.
TABLE 2.
Primers used to clone bpsIR genes
| Gene | Direction | Primer sequence (5′-3′) | Amplicon size (bp) |
|---|---|---|---|
| Genes used to study bpsI expression | |||
| bpsR1 | Forward | GTGCGGCCAAGCTTGGATCCAT | 1,157 |
| Reverse | CGGCGCTCGAGGCAATGCTT | ||
| bpsR2 | Forward | CTCAGCCCTCGAGCATTCGG | 1,195 |
| Reverse | GGCGGGAATTCGGAGGCGAG | ||
| bpsR3 | Forward | CACTTACTCGAGATCCGCGC | 1,151 |
| Reverse | GCGCTAACGAATTCGGATGG | ||
| bpsR4 | Forward | CGCCCGTCTAGAACGCTACG | 1,242 |
| Reverse | GCGGCGCGAATTCAGATCAACCC | ||
| bpsR5 | Forward | GCGCGCGAATTCACTCGCTG | 1,237 |
| reverse | GCGCTCGCGGCAAGCTTACG | ||
| bpsI1 | Forward | TGGATCCAAGCTTGGCCGCA | 778 |
| Reverse | GTCACGCGGATCCGTTGCTT | ||
| bpsI2 | Forward | CCTCTCCAAGCTTTGGGACC | 928 |
| Reverse | GCGCTTGGATCCTGATGTCG | ||
| bpsI3 | Forward | CATCCGGAAGCTTTAGCGCCG | 851 |
| Reverse | CGGCAGATGGATCCAGCATGC | ||
| Genes used to study BpsR dimerization | |||
| bpsR1 | Forward | ATGACAGCTCGAGGCTGCTGG | 761 |
| Reverse | CTCGAGGTACCGCTTACGGCG | ||
| bpsR2 | Forward | CAGTATTTCAACTCGAGGAT | 763 |
| Reverse | AGGCCGAGGTACCGCTCGT | ||
| bpsR3 | Forward | GCTTCAACTCGAGTATCGAAC | 784 |
| Reverse | TTCGGATGGTACCCGCGCTCA | ||
| bpsR4 | Forward | CATTGGCTCGAGAACGTAAC | 752 |
| Reverse | CGCGCCGGTACCATGACGAC | ||
| bpsR5 | Forward | TCGGCTTGCTCGAGCATGGAG | 769 |
| Reverse | GGCCCCGGTACCCCGAATC |
TABLE 3.
Expression of bpsI genes with BpsR and various AHLsa
| Plasmid | Genes expressed | Induction (fold) of lacZ expression with AHLsb
|
||||
|---|---|---|---|---|---|---|
| No AHL | C6HSL | C8HSL | 3-Oxo-C8HSL | C10HSL | ||
| pPK2 | bpsI1-lacZ | 6.8 ± 0.2 | NDc | ND | ND | ND |
| pPK3.1 | bpsR1, bpsI1-lacZ | 5.4 ± 0.6 | 5.2 ± 1.2 | 131.7 ± 21.4 | 60.4 ± 6.0 | 38.9 ± 5.7 |
| pPK6.1 | bpsR2, bpsI1-lacZ | 7.0 ± 0.5 | 7.3 ± 1.0 | 7.0 ± 0.5 | 8.4 ± 1.9 | 6.7 ± 0.4 |
| pPK9.1 | bpsR3, bpsI1-lacZ | 8.0 ± 0.4 | 8.2 ± 0.2 | 8.4 ± 0.6 | 11.8 ± 1.2 | 8.6 ± 0.1 |
| pPK11.1 | bpsR4, bpsI1-lacZ | 8.4 ± 0.3 | 9.8 ± 0.4 | 9.6 ± 0.6 | 10.2 ± 0.9 | 9.2 ± 0.7 |
| pPK13.1 | bpsR5, bpsI1-lacZ | 30.3 ± 1.3 | 32.7 ± 2.1 | 32.7 ± 2.8 | 31.5 ± 3.0 | 36.1 ± 1.0 |
| pPK5 | bpsI2-lacZ | 58.1 ± 3.5 | ND | ND | ND | ND |
| pPK3.2 | bpsR1, bpsI2-lacZ | 47.5 ± 2.5 | 52.2 ± 2.2 | 50.7 ± 2.8 | 112.2 ± 0.7 | 52.1 ± 3.6 |
| pPK6.2 | bpsR2, bpsI2-lacZ | 62.0 ± 5.9 | 102.5 ± 3.9 | 104.5 ± 3.9 | 104.9 ± 3.8 | 105.4 ± 5.9 |
| pPK9.2 | bpsR3, bpsI2-lacZ | 53.7 ± 2.9 | 61.4 ± 4.4 | 67.4 ± 3.8 | 92.6 ± 5.0 | 67.0 ± 1.4 |
| pPK11.2 | bpsR4, bpsI2-lacZ | 55.9 ± 5.4 | 72.0 ± 1.5 | 74.4 ± 2.5 | 72.8 ± 2.8 | 71.0 ± 3.8 |
| pPK13.2 | bpsR5, bpsI2-lacZ | 46.6 ± 3.0 | 73.7 ± 3.2 | 62.3 ± 8.6 | 62.4 ± 0.2 | 68.1 ± 6.7 |
| pPK8 | bpsI3-lacZ | 50.9 ± 1.8 | ND | ND | ND | ND |
| pPK3.3 | bpsR1, bpsI3-lacZ | 13.7 ± 0.3 | 14.2 ± 0.7 | 15.4 ± 0.9 | 14.7 ± 1.5 | 15.0 ± 0.8 |
| pPK6.3 | bpsR2, bpsI3-lacZ | 8.5 ± 0.2 | 8.6 ± 0.2 | 9.0 ± 0.3 | 9.9 ± 0.1 | 8.0 ± 0.2 |
| pPK9.3 | bpsR3, bpsI3-lacZ | 22.1 ± 2.8 | 29.0 ± 1.1 | 26.7 ± 2.0 | 29.5 ± 1.9 | 26.7 ± 1.1 |
| pPK11.3 | bpsR4, bpsI3-lacZ | 8.3 ± 0.6 | 8.9 ± 0.7 | 9.6 ± 0.6 | 9.6 ± 0.4 | 8.9 ± 0.5 |
| pPK13.3 | bpsR5, bpsI3-lacZ | 9.9 ± 0.4 | 11.8 ± 0.1 | 11.7 ± 0.1 | 10.1 ± 0.3 | 12.5 ± 0.3 |
The data are averages ± standard deviations of three independent assays.
Induction of lacZ expression was calculated by comparison to the basal β-galactosidase level of E. coli DH5α when 1 μM AHL was used.
ND, not determined.
BpsR proteins may form dimers.
It was hypothesized that LuxR-type proteins form dimers or probably multimers in order to bind the dyad symmetry structure of the lux box motif and function as transcriptional regulators. The formation of LuxR homologue dimers in different species may or may not require the cognate AHLs (9, 13). Using the previously described LexA-based bacterial protein interaction assay (4, 5), we investigated whether BpsR proteins form dimers and whether AHLs are required for dimer formation. Briefly, this assay is based on the ability of LexA dimers to suppress the expression of the sulA gene. A truncated LexA consisting of only the DNA-binding domain (LexADBD) is not able to form dimers, resulting in sulA expression. Fusion of LexADBD with a protein that forms dimers allows binding of LexADBD to the promoter region of sulA, thus inhibiting sulA expression. Dimer formation was monitored by measuring the expression of a LexA-repressible sulA-lacZ gene fusion located on the chromosome of the reporter strain E. coli SU101. To determine the possibility of BpsR dimer formation, the coding region of each bpsR gene was cloned in frame in pSR658 to construct a lexADBD-bpsR fusion, resulting in plasmids pBPR1 to pBPR5 (Table 1). The resultant constructs expressed a hybrid LexADBD-BpsR protein under control of the isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible lac promoter. The results of dimerization assays in the absence and presence of various AHLs are shown in Table 4. Expression of sulA was significantly inhibited in the presence of BpsR1 and C8HSL, suggesting that BpsR1 formed a dimer and that C8HSL was required for this dimer formation. In addition, 3-oxo-C8HSL and C10HSL also mediated dimerization of BpsR1, but not as effectively as C8HSL. This finding correlated with the ability of BpsR1 to activate the expression of bpsI1, as discussed above, which led to the hypothesis that dimerization may play a role in the function of BpsR1 and that C8HSL was dominant over 3-oxo-C8HSL and C10HSL. Intriguingly, dimerization of BpsR1 in the presence of 3-oxo-C8HSL may be specifically related to the activation of bpsI2, which did not occur with the dimer formation due to C8HSL and C10HSL. BpsR2, which induced bpsI2 expression in the presence of any of the AHLs, did not appear to form dimers in the presence of these AHLs. This finding suggests that BpsR2 requires nonspecific AHLs for its function but not for dimerization. The question of the mechanism that BpsR2 uses as a transcriptional activator is thus still unresolved. Similarly, 3-oxo-C8HSL modestly activated the expression of bpsI2 in the presence of BpsR3 but did not appear to induce BpsR3 dimer formation. Other AHLs used in this study appeared to have no significant role in the BpsR3 function or dimerization. It is possible that AHL molecules other than those tested here may be required for the function and/or dimerization of BpsR3. BpsR4 and, to a lesser degree, BpsR5 both formed homodimers in the absence of AHL. Adding any of the four AHLs did not change the status of dimer formation for these two proteins. This is in accord with the finding of this study that both BpsR4 and BpsR5 are capable of bpsI activation or repression regardless of the presence of AHL. The action of these solo BpsR proteins is unique and requires further investigation in order to explore their roles in gene regulation.
TABLE 4.
Dimerization assays for BpsR proteinsa
| BpsR protein | AHLb | % sulA expression in the presence of a second BpsR protein
|
||||
|---|---|---|---|---|---|---|
| BpsR1 | BpsR2 | BpsR3 | BpsR4 | BpsR5 | ||
| BpsR1 | None | 67.8 ± 4.2 | 84.8 ± 2.5 | 38.6 ± 3.2 | 27.8 ± 4.1 | 53.0 ± 0.8 |
| C6HSL | 72.7 ± 0.1 | 27.2 ± 1.1 | 35.9 ± 2.8 | 28.2 ± 1.2 | 42.5 ± 6.0 | |
| C8HSL | 10.1 ± 0.8 | 27.9 ± 2.5 | 38.9 ± 2.3 | 28.3 ± 4.5 | 21.2 ± 1.6 | |
| 3-Oxo-C8HSL | 28.3 ± 0.7 | 80.3 ± 3.3 | 36.1 ± 5.0 | 25.4 ± 8.9 | 46.1 ± 4.4 | |
| C10HSL | 27.5 ± 0.2 | 30.8 ± 2.9 | 38.0 ± 3.9 | 27.0 ± 2.0 | 46.1 ± 1.9 | |
| BpsR2 | None | 80.3 ± 1.9 | 80.2 ± 2.8 | 23.1 ± 2.0 | 67.9 ± 0.6 | |
| C6HSL | 90.2 ± 3.4 | 73.9 ± 1.8 | 21.4 ± 3.8 | 65.1 ± 0.5 | ||
| C8HSL | 76.8 ± 0.2 | 72.4 ± 1.1 | 22.1 ± 0.8 | 66.6 ± 2.3 | ||
| 3-Oxo-C8HSL | 76.9 ± 0.7 | 77.1 ± 4.7 | 20.0 ± 0.9 | 64.8 ± 0.7 | ||
| C10HSL | 84.8 ± 3.3 | 73.2 ± 5.3 | 20.9 ± 1.6 | 62.9 ± 2.6 | ||
| BpsR3 | None | 89.2 ± 7.0 | 33.6 ± 3.1 | 34.1 ± 4.5 | ||
| C6HSL | 88.7 ± 3.7 | 32.6 ± 3.3 | 32.1 ± 1.6 | |||
| C8HSL | 82.7 ± 3.4 | 32.7 ± 1.9 | 31.2 ± 2.1 | |||
| 3-Oxo-C8HSL | 83.0 ± 5.6 | 31.6 ± 5.0 | 31.6 ± 5.7 | |||
| C10HSL | 82.9 ± 7.3 | 32.8 ± 1.0 | 32.2 ± 2.5 | |||
| BpsR4 | None | 10.9 ± 2.6 | 67.9 ± 4.2 | |||
| C6HSL | 10.8 ± 1.7 | 64.9 ± 2.0 | ||||
| C8HSL | 10.5 ± 2.6 | 64.9 ± 3.7 | ||||
| 3-Oxo-C8HSL | 9.2 ± 1.1 | 63.5 ± 4.2 | ||||
| C10HSL | 10.9 ± 2.0 | 63.3 ± 4.4 | ||||
| BpsR5 | None | 22.8 ± 3.0 | ||||
| C6HSL | 23.0 ± 2.6 | |||||
| C8HSL | 23.1 ± 4.2 | |||||
| 3-Oxo-C8HSL | 16.4 ± 3.1 | |||||
| C10HSL | 24.0 ± 3.6 | |||||
The results are expressed as percentages of sulA expression, which were calculated by comparison to the β-galactosidase level of E. coli SU101 carrying pSR658 as a negative control (for homodimerization) or of E. coli SU202 carrying pSR658/pSR659 as a negative control (for heterodimerization). A decrease in sulA expression indicates that there was dimerzation of BpsR proteins. The data are averages ± standard deviations of three independent assays.
The concentration of each AHL used was 1 μM.
Given that B. pseudomallei contains multiple BpsR proteins and not all BpsR proteins are able to form homodimers, as discussed above, we investigated whether BpsR proteins form heterodimers consisting of different BpsR subunits and whether AHLs are required for heterodimer formation. To examine this, each bpsR gene was cloned in frame in pSR659 (5) to construct lexAmutDBD-bpsR fusions, resulting in plasmids pBPRX1 to pBPRX5 (Table 1). These plasmids allowed expression of IPTG-inducible mutated LexADBD-BpsR proteins. Using E. coli SU202, a strain having a hybrid sulA promoter with one half of the promoter mutated (5), we could determine heterodimerization between different proteins in which one protein was fused to lexADBD (pSR658 vector), which bound to the wild-type half of the promoter, and another protein was fused to lexAmutDBD (pSR659 vector), which bound to the mutated half of the promoter. If heterodimer formation occurred, both lexADBD and lexAmutDBD should have been in contact with the hybrid promoter, resulting in inhibition of sulA expression. As shown in Table 4, sulA expression was significantly reduced in the heterodimer assay with BpsR1 and BpsR2 in the presence of C6HSL, C8HSL, and C10HSL but not in the presence of 3-oxo-C8HSL, suggesting that a nonspecific AHL was required to form BpsR1-BpsR2 heterodimers. BpsR1 also showed a modest interaction with BpsR4 and, to a lesser degree, with BpsR3 and BpsR5 regardless of the AHL. The presence of AHL did not alter the heterodimers involving BpsR1 and BpsR3, BpsR4, or BpsR5, except for the BpsR1-BpsR5 heterodimer, which appeared to be more obvious in the presence of C8HSL. While BpsR2 did not form homodimers with the AHLs provided, it clearly formed dimers with (in addition to BpsR1) BpsR4 regardless of the AHL. BpsR3 evidently formed heterodimers with both BpsR4 and Bps5 without a requirement for AHLs. There was no significant interaction between BpsR4 and BpsR5. The formation of heterodimers of different LuxR-type proteins is very interesting, since these proteins may cooperate to regulate a complicated QSS network, and has been observed in other bacteria, such as Agrobacterium tumefaciens and Pseudomonas aeruginosa (1, 10). The solo BpsR proteins, particularly BpsR4, appeared to have a role in formation of heterodimers with other luxI-accompanied BpsR proteins.
In conclusion, here we present novel findings regarding B. pseudomallei QSS determinants. In terms of gene regulation, we demonstrated that (i) BpsR1 activates bpsI1 expression in the presence of C8HSL and also partially activates bpsI1 in the presence of 3-oxo-C8HSL or C10HSL, indicating that it is less specific for C8HSL; (ii) if AHL is required, activation of bpsI by BpsR appears to be AHL dose dependent; (iii) BpsR5 also partially activates bpsI1 expression regardless of the presence of AHLs; (iv) bpsI2 is constitutively expressed, and its expression is enhanced by BpsR2 and partially by BpsR4 and BpsR5 with any of the AHLs used and, more specifically, by BpsR1 and BpsR3 with 3-oxo-C8HSL; and (v) bpsI3 is also constitutively expressed but appears to be repressed in the presence of any BpsR protein regardless of the AHLs, although BpsR3 contributes less to this repression. For BpsR dimerization, we demonstrated that (i) BpsR1 forms homodimers in the presence of C8HSL or, partially, in the presence of 3-oxo-C8HSL or C10HSL; (ii) BpsR1 forms heterodimers with BpsR2 when C6HSL, C8HSL, or C10HSL is present and with BpsR3 to BpsR5 regardless of the AHLs present, and C8HSL appears to be more specific for the BpsR1-BpsR5 interaction; (iii) BpsR2 and BpsR3 do not form homodimers in the presence of the AHLs provided in this study, while BpsR4 and BpsR5 forms homodimers regardless of the AHLs present; (iv) BpsR4 forms heterodimers with BpsR1 to BpsR3 but not with BpsR5; and (v) BpsR5 forms heterodimers with only BpsR1 and BpsR3. We also found that BpsR could play a role as both a transcriptional activator and a repressor depending on the target genes and that dimer formation may be involved in the function of some BpsR proteins. In and of itself, the actual formation of heterodimers of the different BpsR proteins is feasible given the high degree of homology and domain conservation among the LuxR homologues. The potential to form heterodimers is, however, very interesting from a gene regulatory perspective. Additional studies are needed to determine whether such heterodimers may play a role in in vivo gene expression and the pathogenesis of B. pseudomallei. The identified limitations of this study include (i) the use of a heterologous E. coli host and multicopy plasmid vectors for gene expression, which resulted in data that may not be obtained with the indigenous B. pseudomallei host, and (ii) the use of selected AHLs that may not represent all identified AHLs in various B. pseudomallei strains. Other AHLs may also have at least partial roles in QSS gene regulation and/or BpsR dimerization in this complicated regulatory network. Although to date B. pseudomallei has not been shown to produce C6HSL, the finding that C6HSL is involved in the interaction and function of BpsR proteins may be consistent with the notion of bacterial interspecies cross talk, in which production of C6HSL was previously detected in the closely related species Burkholderia thailandensis, which inhabits similar niches (20). Thus, a signal produced by B. thailandensis may affect the QSS in B. pseudomallei. Further studies are required to correlate this information with the pathogenic mechanism in order to better understand how B. pseudomallei became such a highly virulent bacterium.
Acknowledgments
This work was financially supported by grants from the Thailand Research Fund and the Siriraj Research Fund Foundation (to P.K.).
We thank Stitaya Sirisinha for his mentorship, and we are also grateful to Luciano Passador for his helpful comments.
Footnotes
Published ahead of print on 29 August 2008.
REFERENCES
- 1.Chai, Y., J. Zhu, and S. C. Winans. 2001. TrlR, a defective TraR-like protein of Agrobacterium tumefaciens, blocks TraR function in vitro by forming inactive TrlR:TraR dimers. Mol. Microbiol. 40414-421. [DOI] [PubMed] [Google Scholar]
- 2.Chan, Y. Y., and K. L. Chua. 2005. The Burkholderia pseudomallei BpeAB-OprB efflux pump: expression and impact on quorum sensing and virulence. J. Bacteriol. 1874707-4719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cheng, A. C., and B. J. Currie. 2005. Melioidosis: epidemiology, pathophysiology, and management. Clin. Microbiol. Rev. 18383-416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Daines, D., and R. P. Silver. 2000. Evidence for multimerization of Neu proteins involved in polysialic acid synthesis in Escherichia coli K1 using improved LexA-based vectors. J. Bacteriol. 1825267-5270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Dmitrova, M., G. Younes-Cauet, P. Oertel-Buchheit, D. Porte, M. Schnarr, and M. Granger-Schnarr. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257205-212. [DOI] [PubMed] [Google Scholar]
- 6.Fuqua, W. C., S. C. Winans, and E. P. Greenberg. 1994. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol. 176269-275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gray, K. M., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1994. Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa. J. Bacteriol. 1763076-3080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Holden, M. T., R. W. Titball, S. J. Peacock, A. M. Cerdeno-Tarraga, T. Atkins, L. C. Crossman, T. Pitt, C. Churcher, K. Mungall, S. D. Bentley, M. Sebaihia, N. R. Thomson, N. Bason, I. R. Beacham, K. Brooks, K. A. Brown, N. F. Brown, G. L. Challis, I. Cherevach, T. Chillingworth, A. Cronin, B. Crossett, P. Davis, D. DeShazer, T. Feltwell, A. Fraser, Z. Hance, H. Hauser, S. Holroyd, K. Jagels, K. E. Keith, M. Maddison, S. Moule, C. Price, M. A. Quail, E. Rabbinowitsch, K. Rutherford, M. Sanders, M. Simmonds, S. Songsivilai, K. Stevens, S. Tumapa, M. Vesaratchavest, S. Whitehead, C. Yeats, B. G. Barrell, P. C. Oyston, and J. Parkhill. 2004. Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Proc. Natl. Acad. Sci. USA 10114240-14245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kiratisin, P., K. D. Tucker, and L. Passador. 2002. LasR, a transcriptional activator of Pseudomonas aeruginosa virulence genes, functions as a multimer. J. Bacteriol. 1844912-4919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ledgham, F., I. Ventre, C. Soscia, M. Foglino, J. N. Sturgis, and A. Lazdunski. 2003. Interactions of the quorum sensing regulator QscR: interaction with itself and the other regulators of Pseudomonas aeruginosa LasR and RhlR. Mol. Microbiol. 48199-210. [DOI] [PubMed] [Google Scholar]
- 11.Lee, J. H., Y. Lequette, and E. P. Greenberg. 2006. Activity of purified QSScR, a Pseudomonas aeruginosa orphan quorum-sensing transcription factor. Mol. Microbiol. 59602-609. [DOI] [PubMed] [Google Scholar]
- 12.Lumjiaktase, P., S. P. Diggle, S. Loprasert, S. Tungpradabkul, M. Daykin, M. Camara, P. Williams, and M. Kunakorn. 2006. Quorum sensing regulates dpsA and the oxidative stress response in Burkholderia pseudomallei. Microbiology 1523651-3659. [DOI] [PubMed] [Google Scholar]
- 13.Luo, Z.-Q., A. J. Smyth, P. Gao, Y. Qin, and S. K. Farrand. 2003. Mutational analysis of TraR. Correlating function with molecular structure of a quorum-sensing transcriptional activator. J. Biol. Chem. 27813173-13182. [DOI] [PubMed] [Google Scholar]
- 14.Miller, J. H. 1972. Experiments in molecular genetics, p. 352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
- 15.Preston, M. J., P. C. Seed, D. S. Toder, B. H. Iglewski, D. E. Ohman, J. K. Gustin, J. B. Goldberg, and G. B. Pier. 1997. Contribution of proteases and LasR to the virulence of Pseudomonas aeruginosa during corneal infections. Infect. Immun. 653089-3090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Schuster, M., M. L. Urbanowski, and E. P. Greenberg. 2004. Promoter specificity in Pseudomonas aeruginosa quorum sensing revealed by DNA binding of purified LasR. Proc. Natl. Acad. Sci. USA 10115833-15839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Song, Y., X. Chao, Y.-M. Ong, Y.-H. Gan, and K.-L. Chua. 2005. The BpsIR quorum-sensing system of Burkholderia pseudomallei. J. Bacteriol. 187785-790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Swift, S., J. A. Downie, N. A. Whitehead, A. M. Barnard, G. P. Salmond, and P. Williams. 2001. Quorum sensing as a population-density-dependent determinant of bacterial physiology. Adv. Microb. Physiol. 45199-270. [DOI] [PubMed] [Google Scholar]
- 19.Ulrich, R. L., D. Deshazer, E. E. Brueggemann, H. B. Hines, P. C. Oyston, and J. A. Jeddeloh. 2004. Role of quorum sensing in the pathogenicity of Burkholderia pseudomallei. J. Med. Microbiol. 531053-1064. [DOI] [PubMed] [Google Scholar]
- 20.Ulrich, R. L., H. B. Hines, N. Parthasarathy, and J. A. Jeddeloh. 2004. Mutational analysis and biochemical characterization of the Burkholderia thailandensis DW503 quorum-sensing network. J. Bacteriol. 1864350-4360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Valade, E., F. M. Thibault, Y. P. Gauthier, M. Palencia, M. Y. Popoff, and D. R. Vidal. 2004. The PmlI-PmlR quorum-sensing system in Burkholderia pseudomallei plays a key role in virulence and modulates production of the MprA protease. J. Bacteriol. 1862288-2294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu. Rev. Cell Dev. Biol. 21319-346. [DOI] [PubMed] [Google Scholar]
- 23.Woodcock, D. M., P. J. Crowther, J. Doherty, S. Jefferson, E. DeCruz, M. Noyer-Weidner, S. S. Smith, M. Z. Michael, and M. W. Graham. 1989. Quantitative evaluation of Escherichia coli host strain for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res. 173469-3478. [DOI] [PMC free article] [PubMed] [Google Scholar]