Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2008 Oct 13;76(12):5624–5631. doi: 10.1128/IAI.00534-08

A Conserved C-Terminal 13-Amino-Acid Motif of Gap1 Is Required for Gap1 Function and Necessary for the Biogenesis of a Serine-Rich Glycoprotein of Streptococcus parasanguinis▿

Meixian Zhou 1, Zhixiang Peng 1, Paula Fives-Taylor 2, Hui Wu 1,*
PMCID: PMC2583587  PMID: 18852249

Abstract

Adhesion of Streptococcus parasanguinis to saliva-coated hydroxyapatite (SHA), an in vitro tooth model, is mediated by long peritrichous fimbriae. Fap1, a fimbria-associated serine-rich glycoprotein, is required for fimbrial assembly. Biogenesis of Fap1 is controlled by an 11-gene cluster that contains gly, nss, galT1 and -2, secY2, gap1 to -3, secA2, and gtf1 and -2. We had previously isolated a collection of nine nonadherent mutants using random chemical mutagenesis approaches. These mutants fail to adhere to the in vitro tooth model and to form fimbriae. In this report, we further characterized these randomly selected nonadherent mutants and classified them into three distinct groups. Two groups of genes were previously implicated in Fap1 biogenesis. One group has a mutation in a glycosyltransferase gene, gtf1, that is essential for the first step of Fap1 glycosylation, whereas the other group has defects in the fap1 structural gene. The third group mutant produces an incompletely glycosylated Fap1 and exhibits a mutant phenotype similar to that of a glycosylation-associated protein 1 (Gap1) mutant. Analysis of this new mutant revealed that a conserved C-terminal 13-amino-acid motif was missing in Gap1. Site-directed mutagenesis of a highly conserved amino acid tryptophan within this motif recapitulated the deletion phenotype, demonstrating the importance of the Gap1 C-terminal motif for Fap1 biogenesis. Furthermore, the C-terminal mutation does not affect Gap1-Gap3 protein-protein interaction, which has been shown to mediate Fap1 glycosylation, suggesting the C-terminal motif has a distinct function related to Fap1 biogenesis.


Streptococcus parasanguinis is an early colonizer of the dental plaque and has been associated with the pathogenesis of infective endocarditis(5, 14, 17). Bacterial adhesion to hosts is important in these physiological and pathophysiological processes (16, 18). Therefore, investigation of molecular mechanisms of bacterial adhesion will facilitate our understanding the biology of streptococcal fitness and pathogenicity.

S. parasanguinis possesses long peritrichous fimbriae. Mature Fap1, a 200-kDa glycoprotein, is a major fimbrial subunit and is responsible for bacterial adhesion in an in vitro tooth model, saliva-coated hydroxyapatite (SHA) (29). Deficiency in an accessory Sec protein, SecA2, blocks Fap1 export and also inhibits secretion of FimA (7), a key virulence factor of S. parasanguinis-induced infective endocarditis (4). Fap1 homologs have been isolated as important adhesins in other gram-positive bacteria, including Streptococcus gordonii (2), Streptococcus sanguinis (20), Streptococcus pneumoniae (26), Streptococcus agalactiae (22), Staphylococcus aureus (23), and Staphylococcus epidermidis (31). Fap1-like proteins in S. gordonii and Staphylococcus aureus have been implicated in the pathogenesis of infective endocarditis (23, 25). Fap1, a glycosylated cell-wall-anchored adhesin, contains a long signal sequence at the amino terminus which directs Fap1 export in conjunction with its C-terminal classic cell wall sorting signal. Fap1 also possesses two extensive serine-rich repeat regions that appear to be modified by O-linked glycan moieties (28, 29). Biogenesis of Fap1 is mediated by a cluster of 11 genes (gly, nss, galT1 and -2, secY2, gap1 to -3, secA2, gtf1, and gtf2). The functions of many of these genes have been determined (27, 30). For instance, inactivation of the Gtfs renders the mutants unable to glycosylate Fap1 and leads to the production of an unglycosylated high-molecular-mass Fap1 precursor A (3, 27). SecY2 and Gap3 mutants fail to express mature Fap1 and instead produce an incompletely glycosylated and distinct high-molecular-mass Fap1 precursor B (19, 27).

In the process of identifying adhesins of S. parasanguinis that mediate bacterial interactions with salivary components, we had previously isolated a series of chemically mutagenized strains which do not attach to SHA and cannot form fimbriae (11, 13). These nonadherent mutants were isolated based on their inability to interact with SHA (13). Among these mutants, VT321 has been partially characterized and has already been linked to the Fap1 biogenesis defect (12), albeit the nature of mutation(s) has not been studied. However, it is unknown whether other nonadherent mutants also have defects in Fap1 and Fap1 biogenesis. Further characterization of these mutants will facilitate our understanding of Fap1 biogenesis and Fap1-dependent and -independent bacterial adhesion mechanisms.

In this report, we characterized these mutants using a forward genetic complementation strategy, determined that a new mutant group VT324 was defective in glycosylation-associated protein Gap1, and show for the first time that a conserved C-terminal 13-amino-acid motif of Gap1 is required for Gap1 function and is necessary for Fap1 maturation.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. S. parasanguinis strains were grown statically in 5% CO2 in Todd-Hewitt (TH) medium or on TH agar plates at 37°C. Erythromycin (10 μg/ml) and kanamycin (125 μg/ml) were used to select the designed streptococcal transformants. Escherichia coli cells were cultured in Luria-Bertani (LB) medium or on LB agar plates at 37°C. Erythromycin (300 μg/ml) and kanamycin (25 μg/ml) were used for E. coli transformants.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid Characteristic(s) Source or reference
Strains
    E. coli Top10 Host for recombinant plasmids Invitrogen
    S. parasanguinis FW213 Wild type 9
    fap1 mutant fap1::aphA3 Kanr 29
    secY2 mutant secY2::aphA3 Kanr 27
    gap1 mutant gap1::aphA3 Kanr Wu et al., unpublished
    gap3 mutant gap3::aphA3 Kanr 19
    secA2 mutant secA2::Tn5 7
    gtf1 mutant gtf1::aphA3 Kanr 27
    gtf2 mutant gtf2::aphA3 Kanr 3
    VT321 Nonadherent chemically mutagenized strain 13
    VT324 Nonadherent chemically mutagenized strain 13
    VT325 Nonadherent chemically mutagenized strain 13
    VT343 Nonadherent chemically mutagenized strain 13
    VT361 Nonadherent chemically mutagenized strain 13
    VT377 Nonadherent chemically mutagenized strain 13
    VT379 Nonadherent chemically mutagenized strain 13
    VT380 Nonadherent chemically mutagenized strain 13
    VT508 Spontaneous F51-negative nonadherent mutant 11
Plasmids
    pBD-Gap3 gap3 cloned in pGBKT7; Kanr Wu et al., unpublished
    pVT1666 E. coli-Streptococcus shuttle vector; Ermr 8
    pVPT-SecY2 secY2 cloned in pVT1666; Ermr This study
    pVPT-Gap1 gap1 cloned in pVT1666; Ermr This study
    pVPT-Gap1(W518A) gap1(W508A) cloned in pVT1666; Ermr This study
    pVPT-Gap1(W518Y) gap1(W508Y) cloned in pVT1666; Ermr This study
    pVPT-Gap3 gap3 cloned in pVT1666; Ermr This study
    pVPT-SecA2 secA2 cloned in pVT1666; Ermr 8
    pVPT-Gtf1 gtf1 cloned in pVPT1666; Ermr This study
    pVPT-Gtf2 gtf2 cloned in pVT1666; Ermr This study
    pVA838::VT1175 fap1 cloned in pVA838; Ermr 6

DNA manipulation.

The genomic DNA of S. parasanguinis was extracted using the Puregene DNA isolation kit (Gentra System). Plasmid DNA was isolated using the QIAgen spin miniprep kit (Qiagen, Inc., Santa Clarita, CA). The primers used in this study are listed in Table 2. PCR amplifications were performed using Taq DNA polymerase (Promega) or KOD hot start DNA polymerase (Novagen) according to the suppliers' instructions. DNA restriction enzyme digestion, ligation, and transformation were performed using standard methods (21).

TABLE 2.

Primers used in this study

Primer Characteristic(s) Sequencea
SecY2-KpnI-F Amplifies secY2 gene GATCAGGTACCTTGAGTATGTTAAGAAAACTTC
SecY2-KpnI-R Amplifies secY2 gene GATCAGGTACCGTACAAGTTTTTGTATTTTTTCCAAC
Gap1-SalI-F Amplifies gap1 gene CGTCAGTCGACATGTTTTATTTTGTACCTTC
Gap1-KpnI-R Amplifies gap1 gene CCGCGCGGTACCTTTCTTTTTTAGCATACCTTTC
Gap1-EcoRI-F Amplifies gap1 gene CGGAATTCATGTTTTATTTTGTACCTTC
Gap1-BamHI-R Amplifies gap1 gene CGGGATCCTTTCTTTTTTAGCATACCTTTCC
Gap1(Δ513-525)-BamHI-R Amplifiese gap1 (Δ513-525) gene GATCAGGATCCGCCACTTGTGTAATCAGAC
Gap1(W518A)-F Amplifies gap1 site-directed mutation allele GTGGCAAAATTTTGAAGCAAGCGAAAGGTATGCTAAAAAAG
Gap1(W518A)-R Amplifies gap1 site-directed mutation allele CTTTTTTAGCATACCTTTCGCTTGCTTCAAAATTTTGCCAC
Gap1(W518Y)-F Amplifies gap1 site-directed mutation allele CAAGTGGCAAAATTTTGAAGCAATACAAAGGTATGCTAAAAAAG
Gap1(W518Y)-R Amplifies gap1 site-directed mutation allele CTTTTTTAGCATACCTTTGTATTGCTTCAAAATTTTGCCACTTG
Gap3-SalI-F Amplifies gap3 gene CGGCCGTCGACATGACTAAACAGTTAATTTC
Gap3-KpnI-R Amplifies gap3 gene CGCCGCGGTACCAATATATTCTATTAAATTTTTC
Gtf1-BglII-F Amplifies gtf1 gene GATCAAGATCTATGACAATCTATAATATTAATTTAG
Gtf1-BglII-R Amplifies gtf1 gene GATCAAGATCTATCATTTAACATCTCCTC
Gtf2-SalI-F Amplifies gtf2 gene GCAGCGTCGACATGATTAGGTTGTTTGAATG
Gtf2-KpnI-R Amplifies gtf2 gene CGGCCCGGTACCATCTACATTACTAACCAATAC
Fap1-N-F Amplifies N-terminal region of Fap1 TTGGAATACGGTGCTAAAATG
Fap1-N-R Amplifies N-terminal region of Fap1 CTGGTTGTATCTGAAGGTAT
Fap1-C-F1 Amplifies for CWA domain of Fap1 ATCCGTATCAGAATCAGTG
Fap1-C-F2 Amplifies for C-terminal region of Fap1 GTCAGTATCAGAGTCAGTAAG
Fap1-C-R Amplifies for CWA domain of Fap1 CATCCATGTAAATCTCTG
a

Restriction enzyme sites are underlined.

Expression of Fap1 in nonadherent mutants.

To examine the Fap1 expression in nonadherent mutants, 1 ml of mutant cells grown to exponential phase (optical density at 470 nm of ≈0.6) were harvested and lysed in 40 μl lysis buffer (1:10 dilution of LambdaSa2 lysin [GenBank no. AE014275] in phosphate-buffered saline buffer [0.1 M NaCl, 0.01 M NaH2PO4, pH 7.4]) for 10 min at room temperature before adding 5× sodium dodecyl sulfate (SDS) loading buffer (250 mM Tris-HCl [pH 6.8], 10% SDS, 0.5% bromophenol blue, 50% glycerol; 500 mM β-mercaptoethanol). The extracted cell lysates were subjected to electrophoresis on 4 to 12% precast gradient gels (Cambrex) and Western blotting analysis. Culture supernatants of nonadherent mutants were prepared as described previously (27). In brief, proteins precipitated from 0.5 ml of culture media of each nonadherent mutant were dissolved in 30 μl 1× SDS loading buffers. Fifteen microliters of each of the prepared samples was subjected to Western blotting analysis using Fap1-specific antibodies. Expression of Fap1 in wild-type strain FW213 and expression in the fap1 mutant were used as a positive and negative control, respectively. The defined secY2, gap1, gap3, secA2, gtf1, and gtf2 mutants were used as reference strains to determine relevant gene mutations in nonadherent mutants.

Genetic complementation of nonadherent mutants analyzed by BactELISA and Western blotting.

BactELISA and Western blotting analyses were performed to assay the genetic complementation of nonadherent mutants. The full-length DNA sequences coding for SecY2, Gap1, Gap3, Gtf1, and Gtf2 were amplified from the genomic DNA of S. parasanguinis FW213 using the gene-specific primers listed in Table 2. The amplified PCR products for SecY2, Gap1, Gap3, and Gtf2 were digested with the restriction enzymes SalI and KpnI and inserted into the same restriction sites of the E. coli-Streptococcus shuttle vector pVT1666 (8) to create corresponding recombinant plasmids. The Gtf1 PCR product was digested with the restriction enzyme BglII and cloned into the BamHI site of the E. coli-Streptococcus shuttle vector pVT1666 to yield pVPT-Gtf1. The resulting pVPT derivatives were transformed into related mutants. Plasmid pVA838::VT1175 (6, 28) with the full-length fap1 gene was transformed into the fap1-defective nonadherent mutants. The chosen nonadherent mutants and their complemented strains were analyzed by BactELISA as previously described (10). Fap1-specific antibody mAbF51 was used as a primary antibody to detect Fap1 expression. The assays were performed in triplicate in three independent experiments.

Western blot analyses were used to further confirm the genetic complementation of nonadherent mutants with three Fap1-specific antibodies, mAbE42, mAbD10, and mAbF51.

Adhesion of complemented strains to SHA.

Adhesion of S. parasanguinis FW213 to SHA was performed as described previously (29). FW213, the fap1 mutant, nonadherent mutants, and their complemented strains were labeled with [3H]thymidine and grown to an optical density at 470 nm of 0.8. One milliliter of radiolabeled bacteria was incubated with pretreated SHA beads in scintillation vials at 37°C for 2 h. The unbound bacteria remaining in supernatants were transferred to new scintillation vials, the beads bound with bacteria were washed three times with 0.05 M phosphate buffer (pH 6.0), and the corresponding radioactivities were counted and used to calculate adhesion levels of the tested strains. Fifty microliters of radiolabeled bacteria was used to calculate the labeling efficiency of the chosen strains.

Sequence analysis.

PCR products of the gtf1 gene were amplified from the genomic DNA of strains VT343 and VT508 using the primer pair Gtf1-BglII-F and Gtf1-BglII-R. The PCR product of the gap1 gene was amplified from the genomic DNA of VT324 using the primer pair Gap1-SalI-F and Gap1-KpnI-R. The PCR product corresponding to the N-terminal region of Fap1 was amplified from the genomic DNA of VT325 using the primer pair Fap1-N-F and Fapl-N-R. PCR products encoding the cell wall anchor (CWA) domain of Fap1 were amplified from the genomic DNA samples of VT321, VT361, VT377, VT379, and VT380 using the primer pair Fap1-C-F1/F2 and Fapl-C-R. The amplified PCR products were sequenced using same gene-specific primer pairs and analyzed with ClustalW, DNAstar, and NCBI tools.

Gap1 C-terminal site-directed mutagenesis.

Plasmid pVPT-Gap1 (Table 1) containing the full-length gap1 gene was used as a template for Gap1 C-terminal site-directed mutagenesis to mutate a conserved amino acid, tryptophan (W), into a disfavored amino acid, alanine (A), and favored amino acid, tyrosine (Y). Site-directed mutagenesis was carried out by PCR utilizing a QuickChange XL mutagenesis kit (Stratagene, La Jolla, CA). Two primer pairs, Gap1 (W518A)-F and Gap1 (W518A)-R and Gap1 (W518Y)-F and Gap1 (W518Y)-R (Table 2), were used to construct site-directed mutations. The resulting plasmids, pVPT-Gap1(W518A) and pVPT-Gap1(W518Y) (Table 1), were confirmed by DNA sequencing and then transformed into a Gap1-null mutant, respectively, to detect the Fap1 expression profile. The expression of FimA in the wild-type strain, fap1 mutant, VT324, Gap1 W518A mutant, and Gap1 W518Y mutant was used as a loading control.

In vitro GST pull-down assays.

To examine the in vitro interaction between Gap1, Gap1(Δ513-525), and Gap3, the DNA sequences of the full-length Gap1 and the truncated Gap1 were amplified from the genomic DNA samples of S. parasanguinis FW213 and VT324, respectively, using primer pairs Gap1-EcoRI-F and Gap1-BamHI-R or Gap1(Δ513-525)-BamHI-R (Table 2). The amplified PCR products were then digested with the restriction enzymes EcoRI and BamHI and inserted into the same restriction sites of pGEX-5X-1 to produce fusion plasmids pGEX-5X-1::Gap1 and pGEX-5X-1::GST-Gap1(Δ513-525), respectively. The glutathione S-transferase (GST), GST-Gap1, and GST-Gap1(Δ513-525) fusion proteins were purified using glutathione Sepharose 4B beads (Amersham) according to the manufacturer's instructions. The purified proteins were subjected to SDS-polyacrylamide gel electrophoresis analysis by Coommassie brilliant blue staining. Plasmid pBD-Gap3 (Table 1) was used as a template to in vitro translate the c-Myc-tagged Gap3 using the TnT quick-coupled transcription/translation system (Promega) following the manufacturer's instructions. The expression of c-Myc-Gap3 protein was detected by Western blot analysis using anti-c-Myc antibody (1:500 dilution). For the in vitro GST pull-down assay, 5 μg of GST, GST-Gap1, or GST-Gap1(Δ513-525) fusion proteins in NETN binding buffer (20 mM Tris-HCl [pH 7.2], 50 mM NaCl, 1 mM EDTA, 0.2% NP-40) was mixed with 5 μl of in vitro-translated c-Myc-Gap3 separately in a final volume of 200 μl NETN binding buffer and incubated on a rotary shaker at 4°C overnight. The beads were washed three times with 600 μl NETN binding buffer, and the bound proteins were eluted by boiling in the SDS sample loading buffer and subjected to Western blotting analysis with anti-c-Myc antibody (1:500 dilution).

RESULTS AND DISCUSSION

Using chemical mutagenesis schemes, we had previously isolated nine nonadherent mutants of S. parasanguinis (11, 13). They have been classified into different phenotypic groups based on their twitching motility, relative hydrophobicity, saliva-induced aggregation, and coaggregation (13). A close association between the loss of adherence ability and a decrease in cell fimbriation exists, albeit the nature of mutations is unknown. In this report we further characterized these mutants.

Phenotypes of gtf1 and fap1 nonadherent mutants.

Since Fap1 is required for bacterial adhesion, we examined Fap1 expression profile of the isolated mutants by Western blotting analysis using three available Fap1-specific antibodies. mAbE42 is a peptide-specific antibody, whereas mAbD10 and mAbF51 are glycan-specific antibodies recognizing different epitopes. Only mature Fap1 reacts with mAbF51 (27). Wild-type bacteria expressed the mature 200-kDa Fap1 that reacts with all three monoclonal antibodies (Fig. 1A, lane 1). The first group of mutants, VT343 and VT508, expressed a 360-kDa polypeptide when probed with mAbE42 (Fig. 1A, top panel, lanes 3 and 4). This high-molecular-mass protein did not react with glycan-specific antibodies (Fig. 1A, middle and bottom panels, lanes 3 and 4), suggesting it is not glycosylated. This Fap1 expression profile is similar to that observed with the gtf1 or gtf2 mutant (Fig. 1A, lanes 5 and 6). Therefore, we transformed VT343 and VT508 with pVPT-Gtf1 and pVPT-Gtf2, respectively, to carry out genetic complementation experiments. Only pVPT-Gtf1 restored the production of mature Fap1 (Fig. 1B), suggesting both mutants are defective in the gtf1 gene. The complementation was further confirmed by Western blot analysis. Like the wild-type bacteria, the complemented strains all produced mature 200-kDa Fap1 (Fig. 1C, lanes 1, 4, and 6). These results demonstrate that VT343 and VT508 are gtf1 mutants.

FIG. 1.

FIG. 1.

Characterization of nonadherent gtf1 mutants. (A) Fap1 expression profile of the first group of mutants. The Fap1 expression profiles of cell lysates of the wild type (WT) (lane 1), fap1 mutant (lane 2), VT343 (lane 3), VT508 (lane 4), gtf1 mutant (lane 5), and gtf2 mutant (lane 6) were determined by Western blotting analysis with three Fap1-specific antibodies, mAbE42 (top panel), mAbD10 (middle panel), and mAbF51 (bottom panel). (B) Genetic complementation of VT343 and VT508 with genes coding for glycosyltransferases Gtf1 and Gtf2 and analyzed by BactELISA using mAbF51. (C) Western blotting analyses of the wild type (lane 1), fap1 mutant (lane 2), VT343 (lane 3), and VT508 (lane 5) and their complemented strains (lanes 4 and 6) using Fap1-specific antibodies. (D) Diagrammatic depiction of gtf1 alleles from VT343 and VT508. (E) Adhesion of S. parasanguinis FW213 and its derivatives. Wild type FW213, the fap1 mutant, VT343, and VT508 and their complemented strains were assayed for their ability to bind to SHA.

Sequence analysis of the mutated gtf1 alleles revealed a G-to-T substitution at codon 67 and 203 in VT343 and VT508, respectively (Fig. 1D). Such changes led to premature terminations of Gtf1 at the amino acid residues G67 in VT343 and Y203 in VT508.

Since Fap1 is responsible for bacterial adhesion, we performed adhesion assays to characterize the complemented mutants. VT343 and VT508 can be partially complemented by the full-length gtf1 gene; the adherence levels of the complemented VT343 and VT508 reached 70% and 65% of the wild-type level (Fig. 1E). VT508 was selected by bacterial inability to agglutinate Fap1-specific mAbF51; therefore, it is not surprising to find that the mutant has a defect in Gtf1 as Gtf1 is essential to catalyze the first step of the Fap1 glycosylation (3). However, it is interesting to note that VT343 selected by its adhesion deficiency had the same mutation, indicating the importance of Gtf1 in the Fap1 biogenesis. Failure to fully complement the adhesion defect in spite of complete restoration of mature Fap1 expression may indicate that the overexpression of glycosyltransferase Gtf1 deregulates some Fap1-dependent or -independent adhesion process.

The second mutant group contains six mutants. Five of them, including VT321 (Fig. 2A, lane 3), VT361 (lane 5), VT377 (lane 6), VT379 (lane 7), and VT380 (lane 8), secreted a large amount of mature Fap1 into their culture media. This secreted protein reacted with all three Fap1-specific antibodies (Fig. 2A, lanes 3 and 5 to 8). Notably, these mutants did not retain detectable mature Fap1 in the cell lysates (Fig. 2B, lanes 3 and 5 to 8), suggesting a defect in the CWA domain of Fap1. Another mutant, VT325, did not react with any Fap1-specific antibody (Fig. 2A and B, lane 4), implying a defect in the fap1 structural gene. We transformed the full-length fap1 gene into each mutant and then analyzed the mature Fap1 production in the complemented strains. All six mutants were complemented by the full-length fap1 as determined by enzyme-linked immunosorbent assay (ELISA) analysis (data not shown), demonstrating that they have defects in fap1. Western blot analysis with Fap1-specific antibodies confirmed that fap1-complemented strains expressed mature 200-kDa Fap1 in both culture media (Fig. 2C, lanes 4, 6, 8, 10, 12, and 14) and cell lysates (Fig. 2D, lanes 4, 6, 8, 10, 12, and 14), further supporting the conclusion that these mutants belong to fap1 mutant groups.

FIG. 2.

FIG. 2.

Characterization of nonadherent fap1 mutants. (A and B) Fap1 expression profiles of culture supernatants (A) and cell lysates (B) of the wild type (WT) (lane 1), fap1 mutant (lane 2), VT321 (lane 3), VT325 (lane 4), VT361 (lane 5), VT377 (lane6), VT379 (lane 7), and VT380 (lane 8), as determined by Western blotting analysis with three Fap1-specific antibodies. Arrows point to the positions corresponding to the Fap1 protein. (C and D) Western blotting analyses of culture media (C) and cell lysates (D) of the wild type (lane 1), fap1 mutant (lane 2), and fap1 chemically mutagenized strains and their complemented counterparts VT321 (lane 3), VT321/fap1+ (lane 4), VT325 (lane 5), VT325/fap1+ (lane 6), VT361 (lane 7), VT361/fap1+ (lane 8), VT377 (lane 9), VT377/fap1+ (lane 10), VT379 (lane 11), VT379/fap1+ (lane 12), VT380 (lane 13), and VT380/fap1+ (lane 14) with Fap1-specific peptide antibodies. (E) Diagrammatic depiction of fap1 alleles from VT321, VT325, and FW213. (F) Adhesion of S. parasanguinis FW213 and its fap1 mutant derivatives. Wild-type strain FW213, the fap1 mutant, and VT321, VT325, VT361, VT377, VT379, and VT380 and their complemented strains were evaluated for their ability to bind to SHA.

As the fap1 gene is large (8,000 bp) and contains extensive repetitive sequence (28), it is difficult to reliably clone and sequence the entire gene, especially the large repetitive region; therefore, we analyzed different fap1 regions based on the Fap1 expression profile. As five mutants may have defects in their ability to anchor, we analyzed the DNA sequence from the anchor domain of these mutants. Examination of the amplified anchor region of VT321 revealed two mutation sites, leucine (L) 2545 to histidine (H) and valine (V) 2548 to aspartic acid (D) (Fig. 2E). The L and V residues are located in the CWA domain of Fap1. The CWA is highly conserved in many gram-positive cell surface proteins and contains three motifs, the LPxTG motif, followed by a hydrophobic region and a small charged tail (24). Fap1 possesses a typical cell anchor domain (28). Mutagenesis of two nonpolar amino acids, L and V, into the basic amino acid H and the acidic amino acid D altered the Fap1 secretion profile (Fig. 2C and D, lanes 1 and 3), suggesting the hydrophobic region in the anchor domain is very important for Fap1 secretion. The mutations in the hydrophobic region can alter the polarity of the anchor domain of Fap1, thereby inhibiting the function of the Fap1 anchor domain and consequently leading to the export of Fap1 into culture media. This new information can help to design surface proteins that are readily secreted into culture media to facilitate protein purification in gram-positive bacteria.

There was no mutation identified in the CWA domain of Fap1 from the VT361, VT377, VT379, and VT380 mutants, despite the fact that the mutant phenotypes are very similar to that observed for VT321, suggesting that the mutation in these fapl genes is located in the RII region that is adjacent to the CWA domain of Fap1. We attempted to amplify this region but failed to obtain satisfactory PCR products that are amenable to sequencing. This is likely due to the presence of extensive repeated DNA sequences (28). In fact, a defined mutant constructed by inserting an erythromycin resistance cassette at the junction regions between RII and CWA displayed a very similar phenotype (28).

As VT325 failed to produce any Fap1-reactive band, we hypothesize that it might have a mutation at the very beginning of the amino terminus. Sequencing analysis of the 5′ fap1 fragment revealed the presence of a mutation in the NRII region of fap1. A C-to-T substitution at codon 224 led to pretermination of Fapl translation (Fig. 2E). The truncated Fap1 does not react with Fap1-peptide specific antibody mAbE42, indicating the E42 epitope is located outside of this region.

The adherence levels of VT321, VT361, VT377, VT379, and VT380 were well restored by the fap1 complementation (Fig. 2F). These data suggest the identified mutations are responsible for the observed adhesion phenotypes, supporting the concept that Fap1 is a major bacterial adhesin.

Interestingly another fap1-related mutant, VT325, behaved differently. The complemented strain could produce mature Fap1 (Fig. 2C and D, lane 6); however, it failed to restore bacterial adhesion, suggesting this strain may have an additional Fap1-independent mutation. To further characterize the strain, we determined the labeling efficiency of each mutant. VT325 and its fap1-complemented derivative had remarkably low efficiency to incorporate [3H]thymidine (data not shown), suggesting a global defect in bacterial DNA metabolism. This may explain why even the complemented VT325 cannot adhere well. The global defects may affect the Fap1-independent bacterial adhesion mechanism as diverse adhesion molecules are present in oral streptococci and can interact with host cells in a concerted or independent manner.

Gap1 is required for complete glycosylation of Fap1.

The third mutant group, VT324 (Fig. 3A, lane 3), displayed a distinct Fap1 expression profile which is similar to the phenotype observed in secY2, gap1, gap3, and secA2 mutants (Fig. 3A, lanes 4 to 7). They all expressed a 470-kDa polypeptide that reacted with peptide-specific antibody mAbE42 (Fig. 3A, top panel, lanes 3 to 7) and one glycan-specific antibody, mAbD10 (Fig. 3A, middle panel, lanes 3 to 7), but not with the other glycan-specific antibody, mAbF51 (Fig. 3A, bottom panel, lanes 3 to 7). These data suggest that the Fap1 precursor lacks F51-specific glycan epitope(s) and is not completely glycosylated in VT324.

FIG. 3.

FIG. 3.

Characterization of a nonadherent gap1 mutant. (A) The Fap1 expression profiles of cell lysates of the wild type (lane 1), fap1 mutant (lane 2), VT324 (lane 3), secY2 mutant (lane 4), gap1 mutant (lane 5), gap3 mutant (lane 6), and secA2 mutant (lane 7) were determined by Western blotting analysis with three Fap1-specific antibodies. (B) Western blotting analyses of the wild type (lane 1), fap1 mutant (lane 2), VT324 (lane 3), and VT324 complemented with the full-length gap1 (lane 4), secY2 (lane 5), gap3 (lane 6), and secA2 (lane 7) genes. (C) Adhesion of S. parasanguinis FW213 and gap1 mutant derivatives to SHA.

Since gap1, secY2, gap3, and secA2 mutants exhibited the same phenotype as VT324, we transformed these full-length genes into VT324, respectively, and determined Fap1 expression. Only pVPT-Gap1 restored the mature Fap1 production by ELISA (data not shown), suggesting that VT324 is a gap1 mutant. Western blotting analysis confirmed this result. VT324 can be complemented only by a full-length gap1 gene (Fig. 3B, lane 4) but not by other genes (Fig. 3B, lanes 5 to 7). Like the wild type strain, the complemented strain produced mature Fap1 (Fig. 3B, lanes 1 and 4), demonstrating VT324 is a gap1 mutant. The adhesion level of VT324 can be fully complemented (Fig. 3C), concurrent with the production of the mature Fap1 protein.

The C-terminal 13-amino-acid motif is required for Gap1 function.

The mutation in the gap1 gene of VT324 was determined to be an A-to-T substitution at codon 513 (Fig. 4A). This mutation led to premature termination of Gap1. Loss of the C-terminal 13 amino acids inhibited mature Fap1 production, suggesting the C terminus is very important for the maintenance of the Gap1 function. The 13 amino acids are conserved in other Gap1 homologs from S. agalactiae, S. gordonii, S. sanguinis, S. pneumoniae, Staphylococcus haemolyticus, or Lactobacillus johnsonii (Fig. 4B).

FIG. 4.

FIG. 4.

The Gap1 C-terminal motif is important for Gap1 function and Fap1 biogenesis. (A) Diagrammatic depiction of a gap1 allele from VT324. (B) Homology comparison of the C-terminal domain of Gap1 of S. parasanguinis and its homologs from S. agalactiae (AAZ95528), S. gordonii (AAK16998), S. sanguinis (ABN44261), S. pneumoniae (AAK75837), Staphylococcus haemolyticus (BAE03637), and Lactobacillus johnsonii (AAS08375). The conserved amino acid residues are highlighted. (C) A key amino acid residue in the C-terminal motif is important for Gap1 function. Cell lysates prepared from the wild type (lane 1), fap1 mutant (lane 2), and VT324 (lane 3) as well as Gap1 site-directed mutants W518A (lane 4) and W518Y (lane 5) were analyzed by Western blotting with three Fap1-specific antibodies, mAbE42 (I), mAbD10 (II), and mAbF51 (III), or anti-FimA antibody (IV). Arrows point to the positions corresponding to Fap1 or FimA.

Based on the aligned sequence in this region (Fig. 4B), we determined that the W518 residue is conserved across many species, suggesting it is important for Gap1 function. To support this, we performed site-directed mutagenesis and changed the amino acid W into disfavored amino acid A and favored amino acid Y and then transformed the mutant alleles into the Gap1-null mutant, respectively. Western blot analysis revealed that the W518A mutation significantly increased the expression of the 470-kDa partially glycosylated protein (Fig. 4CI, lane 4) that is characteristic of the Gap1 mutant (Fig. 4CI, lane 3), while the production of mature Fap1 in the mutant was minimal (Fig. 4C, lane 4). However, the W518Y mutation did not promote the production of the 470-kDa protein: the mutant retained the ability to produce mature Fap1 (Fig. 4C, lane 5). These data further support the concept that this C-terminal region is important for Gap1 function and necessary for Fap1 glycosylation. In fact, this region is structurally aligned and shows homology to a functional domain of several known glycosyltransferases, including PimA of mycobacteria (15), as determined by the Protein Homology/analogY Recognition Engine (PHYRE) program (1). Among these functional domains, W is predicted to be the key amino acid responsible for the glycosylation function.

The C-terminal 13-amino-acid motif is not required for the interaction between Gap1 and Gap3.

Recently we have determined that Gap1 interacts with Gap3 and an N-terminal motif in Gap1 is important for the interaction and also required for biogenesis of Fap1. The involvement of the C-terminal motif in the Fap1 glycosylation suggests that Gap1 has a distinct functional domain. As the C-terminal motif is structurally aligned to a functional glycosylation domain, it may not be involved in the interaction between Gap1 and Gap3. To test this, we constructed and purified recombinant GST, GST-Gap1, and GST-Gap1(Δ513-525) proteins (Fig. 5A) and performed in vitro GST pull-down assays to determine the effect of the C-terminal deletion on the Gap1-Gap3 interaction. The interaction was not affected by the deletion (Fig. 5B, lanes 2 and 3), suggesting the C-terminal Gap1 is not required for the protein-protein interaction. This result is consistent with the notion that the C terminus has a glycosylation functional domain and represents a distinct functional domain for Gap1.

FIG. 5.

FIG. 5.

The C-terminal deletion does not affect interaction between Gap1 and Gap3. Gap1(Δ513-525) and Gap1 interactions with Gap3 were determined by in vitro GST pull-down assays. (A) SDS-polyacrylamide gel electrophoresis analyses of GST (lane 1), GST-Gap1 (lane 2), and GST-Gap1(Δ513-525) (lane 3) fusion proteins purified using glutathione Sepharose beads from respective bacterial strains. The gel was stained with Coomassie blue. M, protein marker. (B) In vitro GST pull-down assays. The purified GST (lane 1), GST-Gap1 (lane 2), or Gap1(Δ513-525) (lane 3) glutathione Sepharose beads were incubated with in vitro-translated c-Myc-Gap3. The captured protein complexes were subjected to Western blot analyses with c-Myc antibody. “Input” represents in vitro-translated c-Myc-Gap3.

In summary, we have shown that all nonadherent mutants we isolated via their ability to interact with the in vitro tooth model are defective in Fap1 and Fap1 biogenesis. The forward genetic approach demonstrated the importance of Fap1 in bacterial adhesion and revealed the important function of Gap1 and its last 13 amino acid residues in Fap1 biogenesis. As Fap1-like proteins are highly conserved in many streptococci and staphylococci as adhesins, such approaches are invaluable in determining genes related to the biogenesis of Fap1-dependent and -independent adhesion molecules.

Acknowledgments

This study was supported by K22 DE014726, R01DE017954, and R01DE11000 (H. Wu) from the National Institute of Dental and Craniofacial Research.

Editor: A. Camilli

Footnotes

▿

Published ahead of print on 13 October 2008.

REFERENCES

  • 1.Bennett-Lovsey, R. M., A. D. Herbert, M. J. Sternberg, and L. A. Kelley. 2008. Exploring the extremes of sequence/structure space with ensemble fold recognition in the program Phyre. Proteins 70611-625. [DOI] [PubMed] [Google Scholar]
  • 2.Bensing, B. A., and P. M. Sullam. 2002. An accessory sec locus of Streptococcus gordonii is required for export of the surface protein GspB and for normal levels of binding to human platelets. Mol. Microbiol. 441081-1094. [DOI] [PubMed] [Google Scholar]
  • 3.Bu, S., Y. Li, M. Zhou, P. Azadin, M. Zeng, P. Fives-Taylor, and H. Wu. 2008. Interaction between two putative glycosyltransferases is required for glycosylation of a serine-rich streptococcal adhesin. J. Bacteriol. 1901256-1266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Burnette-Curley, D., V. Wells, H. Viscount, C. L. Munro, J. C. Fenno, P. Fives-Taylor, and F. L. Macrina. 1995. FimA, a major virulence factor associated with Streptococcus parasanguis endocarditis. Infect. Immun. 634669-4674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Carlsson, J., H. Grahnen, G. Jonsson, and S. Wikner. 1970. Establishment of Streptococcus sanguis in the mouths of infants. Arch. Oral Biol. 151143-1148. [DOI] [PubMed] [Google Scholar]
  • 6.Chen, Q., B. Sun, H. Wu, Z. Peng, and P. M. Fives-Taylor. 2007. Differential roles of individual domains in selection of secretion route of a Streptococcus parasanguinis serine-rich adhesin, Fap1. J. Bacteriol. 1897610-7617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chen, Q., H. Wu, and P. M. Fives-Taylor. 2004. Investigating the role of secA2 in secretion and glycosylation of a fimbrial adhesin in Streptococcus parasanguis FW213. Mol. Microbiol. 53843-856. [DOI] [PubMed] [Google Scholar]
  • 8.Chen, Q., H. Wu, R. Kumar, Z. Peng, and P. M. Fives-Taylor. 2006. SecA2 is distinct from SecA in immunogenic specificity, subcellular distribution and requirement for membrane anchoring in Streptococcus parasanguis. FEMS Microbiol. Lett. 264174-181. [DOI] [PubMed] [Google Scholar]
  • 9.Cole, R. M., G. B. Calandra, E. Huff, and K. M. Nugent. 1976. Attributes of potential utility in differentiating among “group H” streptococci or Streptococcus sanguis. J. Dent. Res. 55A142-A153. [DOI] [PubMed] [Google Scholar]
  • 10.Elder, B. L., D. K. Boraker, and P. M. Fives-Taylor. 1982. Whole-bacterial cell enzyme-linked immunosorbent assay for Streptococcus sanguis fimbrial antigens. J. Clin. Microbiol. 16141-144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Elder, B. L., and P. Fives-Taylor. 1986. Characterization of monoclonal antibodies specific for adhesion: isolation of an adhesin of Streptococcus sanguis FW213. Infect. Immun. 54421-427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fachon-Kalweit, S., B. L. Elder, and P. Fives-Taylor. 1985. Antibodies that bind to fimbriae block adhesion of Streptococcus sanguis to saliva-coated hydroxyapatite. Infect. Immun. 48617-624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fives-Taylor, P. M., and D. W. Thompson. 1985. Surface properties of Streptococcus sanguis FW213 mutants nonadherent to saliva-coated hydroxyapatite. Infect. Immun. 47752-759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Froeliger, E. H., and P. Fives-Taylor. 2001. Streptococcus parasanguis fimbria-associated adhesin Fap1 is required for biofilm formation. Infect. Immun. 692512-2519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Guerin, M. E., J. Kordulakova, F. Schaeffer, Z. Svetlikova, A. Buschiazzo, D. Giganti, B. Gicquel, K. Mikusova, M. Jackson, and P. M. Alzari. 2007. Molecular recognition and interfacial catalysis by the essential phosphatidylinositol mannosyltransferase PimA from mycobacteria. J. Biol. Chem. 28220705-20714. [DOI] [PubMed] [Google Scholar]
  • 16.Jenkinson, H. F., and R. J. Lamont. 2005. Oral microbial communities in sickness and in health. Trends Microbiol. 13589-595. [DOI] [PubMed] [Google Scholar]
  • 17.Jenkinson, H. F., and R. J. Lamont. 1997. Streptococcal adhesion and colonization. Crit. Rev. Oral Biol. Med. 8175-200. [DOI] [PubMed] [Google Scholar]
  • 18.Klemm, P., V. Hancock, M. Kvist, and M. A. Schembri. 2007. Candidate targets for new antivirulence drugs: selected cases of bacterial adhesion and biofilm formation. Future Microbiol. 2643-653. [DOI] [PubMed] [Google Scholar]
  • 19.Peng, Z., H. Wu, T. Ruiz, Q. Chen, M. Zhou, B. Sun, and P. Fives-Taylor. 2008. Role of gap3 in Fap1 glycosylation, stability, in vitro adhesion, and fimbrial and biofilm formation of Streptococcus parasanguinis. Oral Microbiol. Immunol. 2370-78. [DOI] [PubMed] [Google Scholar]
  • 20.Plummer, C., H. Wu, S. W. Kerrigan, G. Meade, D. Cox, and C. W. Ian Douglas. 2005. A serine-rich glycoprotein of Streptococcus sanguis mediates adhesion to platelets via GPIb. Br. J. Haematol 129101-109. [DOI] [PubMed] [Google Scholar]
  • 21.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  • 22.Seifert, K. N., E. E. Adderson, A. A. Whiting, J. F. Bohnsack, P. J. Crowley, and L. J. Brady. 2006. A unique serine-rich repeat protein (Srr-2) and novel surface antigen (epsilon) associated with a virulent lineage of serotype III Streptococcus agalactiae. Microbiology 1521029-1040. [DOI] [PubMed] [Google Scholar]
  • 23.Siboo, I. R., H. F. Chambers, and P. M. Sullam. 2005. Role of SraP, a serine-rich surface protein of Staphylococcus aureus, in binding to human platelets. Infect. Immun. 732273-2280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Siezen, R. J. 1999. Multi-domain, cell-envelope proteinases of lactic acid bacteria. Antonie van Leeuwenhoek 76139-155. [PubMed] [Google Scholar]
  • 25.Takahashi, Y., E. Takashima, K. Shimazu, H. Yagishita, T. Aoba, and K. Konishi. 2006. Contribution of sialic acid-binding adhesin to pathogenesis of experimental endocarditis caused by Streptococcus gordonii DL1. Infect. Immun. 74740-743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293498-506. [DOI] [PubMed] [Google Scholar]
  • 27.Wu, H., S. Bu, P. Newell, Q. Chen, and P. Fives-Taylor. 2007. Two gene determinants are differentially involved in the biogenesis of Fap1 precursors in Streptococcus parasanguis. J. Bacteriol. 1891390-1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wu, H., and P. M. Fives-Taylor. 1999. Identification of dipeptide repeats and a cell wall sorting signal in the fimbriae-associated adhesin, Fap1, of Streptococcus parasanguis. Mol. Microbiol. 341070-1081. [DOI] [PubMed] [Google Scholar]
  • 29.Wu, H., K. P. Mintz, M. Ladha, and P. M. Fives-Taylor. 1998. Isolation and characterization of Fap1, a fimbriae-associated adhesin of Streptococcus parasanguis FW213. Mol. Microbiol. 28487-500. [DOI] [PubMed] [Google Scholar]
  • 30.Wu, H., M. Zeng, and P. Fives-Taylor. 2007. The glycan moieties and the N-terminal polypeptide backbone of a fimbria-associated adhesin, Fap1, play distinct roles in the biofilm development of Streptococcus parasanguinis. Infect. Immun. 752181-2188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang, Y. Q., S. X. Ren, H. L. Li, Y. X. Wang, G. Fu, J. Yang, Z. Q. Qin, Y. G. Miao, W. Y. Wang, R. S. Chen, Y. Shen, Z. Chen, Z. H. Yuan, G. P. Zhao, D. Qu, A. Danchin, and Y. M. Wen. 2003. Genome-based analysis of virulence genes in a non-biofilm-forming Staphylococcus epidermidis strain (ATCC 12228). Mol. Microbiol. 491577-1593. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES