Abstract
Staphylococcus epidermidis is a major nosocomial pathogen primarily infecting immunocompromised individuals or those with implanted biomaterials (e.g., catheters). Biomaterial-associated infections often involve the formation of a biofilm on the surface of the medical device. In S. epidermidis, polysaccharide intercellular adhesin (PIA) is an important mediator of biofilm formation and pathogenesis. Synthesis of PIA is regulated by at least three DNA binding proteins (IcaR, SarA, and σB) and several environmental and nutritional conditions. Previously, we observed the environmental conditions that increased PIA synthesis decreased tricarboxylic acid (TCA) cycle activity. In this study, S. epidermidis TCA cycle mutants were constructed, and the function of central metabolism in PIA biosynthesis was examined. TCA cycle inactivation altered the metabolic status of S. epidermidis, resulting in a massive derepression of PIA biosynthetic genes and a redirection of carbon from growth into PIA biosynthesis. These data demonstrate that the bacterial metabolic status is a critical regulatory determinant of PIA synthesis. In addition, these data lead us to propose that the TCA cycle acts as a signal transduction pathway to translate external environmental cues into intracellular metabolic signals that modulate the activity of transcriptional regulators.
Staphylococcus epidermidis is the most frequently isolated nosocomial pathogen from the blood cultures of adult and pediatric intensive care unit patients in the United States of America (48). Frequently, S. epidermidis infections involve the formation of a biofilm on the surfaces of biomaterials (e.g., catheters) (77). A biofilm is a complex aggregation of bacteria usually encapsulated by an adhesive exopolysaccharide matrix. The exopolysaccharide matrix provides structural stability to the biofilm, enhanced adhesion to surfaces, and protection from host defenses and antibiotics (2, 50, 79). In S. epidermidis, the exopolysaccharide facilitating bacterial adherence in a biofilm is polysaccharide intercellular adhesin (PIA). PIA is an N-acetylglucosamine polymer (44) of at least 130 residues (42) whose synthesis requires the enzymes encoded by genes in the intercellular adhesin (ica) operon (icaADBC) (27). The synthesis of PIA is required for the maturation of biofilms (27), important for evasion of the host innate immune system (79, 80), and critical in biomaterial-associated infections (55, 57).
Bacteria live in environments subject to rapid changes in the availability of the nutrients necessary to provide energy and biosynthetic intermediates for the synthesis of macromolecules. Consequently, bacterial survival depends on the ability to regulate expression of genes coding for enzymes required for growth in the altered environment. In pathogenic bacteria, adaptation to an altered environment often includes activating transcription of virulence genes; hence, synthesis of many virulence determinants is regulated by environmental/nutritional signals (e.g., nitrogen, iron, and calcium) (47). Because PIA is the most important virulence determinant of S. epidermidis (2, 7, 38, 56, 57, 84), it is not surprising that PIA synthesis is regulated by environmental and nutritional signals (13, 16, 18, 22, 53).
Regulation of the icaADBC operon is complex, involving at least two DNA binding proteins (IcaR and SarA) and the alternative sigma factor σB. IcaR binds immediately 5′ to the icaA transcriptional start site and represses transcription of the ica operon (9, 29). SarA is an essential positive effector of icaADBC transcription that binds to the icaA promoter region (26, 74). σB affects PIA synthesis indirectly by regulating the expression of icaR (34, 35, 52). In addition, the luxS quorum-sensing system has a minimal effect on PIA synthesis and biofilm formation; however, the mechanism remains to be determined (82).
In Staphylococcus aureus, σB is activated during stress conditions and growth phase transitions (3, 81). Because S. epidermidis icaADBC transcription and PIA synthesis are induced by environmental and nutritional stresses, stress-dependent activation of σB has been a focal point of research into the environmental regulation of PIA synthesis and biofilm formation (10, 26, 35). Importantly, σB does not respond directly to environmental signals; therefore, a second area of research interest has focused on identifying the regulatory network controlling σB activation, which is involved in responding to environmental signals. The activation of σB involves an anti-sigma factor (RsbW) and an anti-anti-sigma factor (RsbV) and resembles the process in the closely related organism Bacillus subtilis (35). In the absence of environmental stimuli, σB is bound in a complex with RsbW. Stress-inducing stimuli are hypothesized to activate the RsbU phosphatase to dephosphorylate (activate) the anti-anti-sigma factor RsbV, which then binds RsbW in a competitive manner to increase the concentration of free σB (34, 35). Based on several published studies, it seems likely that the σB posttranslational regulatory network is responsible for responding to some environmental stresses (i.e., osmotic stress) but is only minimally involved in responding to nutritional signals (e.g., glucose), suggesting that there are other means for S. epidermidis to “sense” nutritional signals (18, 35, 52).
Previously, we observed the environmental and nutritional signals that enhance PIA synthesis also repress tricarboxylic acid (TCA) cycle activity, leading us to hypothesize that repression of TCA cycle activity would increase PIA accumulation (78). To test this hypothesis, we incubated S. epidermidis strain 1457 with very low concentrations of fluorocitrate, which minimally inhibited TCA cycle activity, and determined the amount of cell-associated PIA. As the concentration of fluorocitrate in the culture medium was increased, the amount of PIA produced increased proportionally (78). Fluorocitrate is a highly toxic compound when metabolized to 4-hydroxy-trans-aconitate by the TCA cycle enzyme aconitase, severely limiting the usable concentration range (40, 46). In the present study, we overcame this limitation by genetically inactivating the aconitase gene in S. epidermidis strain 1457. The aconitase mutant and complemented strains permitted a detailed analysis of the function of central metabolism in PIA synthesis.
MATERIALS AND METHODS
Bacterial strains, bacteriophage, plasmids, and growth conditions.
Bacterial strains, bacteriophage, and plasmids used in this study are listed in Table 1. S. epidermidis strain 1457 (43) was used in these studies because it is a known PIA- and biofilm-producing strain. Escherichia coli strains were grown in 2× YT broth or on 2× YT agar (58). S. aureus and S. epidermidis strains were grown in tryptic soy broth without dextrose (TSB; BD Biosciences) supplemented with 0.25% glucose or on TSB containing 1.5% (wt/vol) agar. S. epidermidis cultures were inoculated 1:200 from overnight cultures (normalized for growth) into TSB, incubated at 37°C, and aerated at 225 rpm with a flask-to-medium ratio of 7:1. Bacterial growth was assessed by measuring the optical density at 600 nm or by determining the number of CFU ml−1. Antibiotics were purchased from Fisher Scientific or Sigma Chemical and were used at the following concentrations: ampicillin (100 μg/ml for E. coli), chloramphenicol (8 μg/ml), erythromycin (8 μg/ml), minocycline (2 μg/ml), and trimethoprim (10 μg/ml).
TABLE 1.
Bacterial strain, bacteriophage, or plasmid | Relevant propertiesa | Source or reference |
---|---|---|
Bacterial strains | ||
DH5α | E. coli cloning host | Invitrogen |
RN4220 | S. aureus restriction-deficient strain 8325-4 | 49 |
1457 | S. epidermidis biofilm-forming strain | 43 |
1457-acnA | Strain 1457 acnA inactivated mutant; Minr | This study |
1457-citZC | Strain 1457 citCZ deletion mutant; Ermr | This study |
1457-Δica | Strain 1457 icaADBC deletion mutant; Tmpr | 26 |
1457-icaR | Strain 1457 icaR inactivated mutant; Minr | 26 |
1457-sigB | Strain 1457 sigB inactivated mutant; Tmpr | 26 |
1457-sarA | Strain 1457 sarA inactivated mutant; Minr | 26 |
Bacteriophage 71 | S. epidermidis transducing phage | 15 |
Plasmids | ||
pCL15 | Expression vector; derivative of pSI-1; Camr | Chia Lee |
pEC4 | pBluescript II KS(+) with ermB inserted into ClaI site; Ampr Ermr | 5 |
pJF12 | Plasmid pCR2.1 containing tetM; Ampr Minr | J. Finan and G. Archer |
pGEM-T | E. coli TA cloning vector; Ampr | Promega |
pMRS2 | pCL15 with acnA gene under the control of the Pspac promoter; Camr | This study |
pMRS5 | Derivative of pTS1-d with citZC::ermB fragment; Ampr Camr Ermr | This study |
pNF103 | pUC19 with 1.7-kb internal fragment of acnA; Ampr | This study |
pNF117 | pNF103 with tetM inserted into EcoRI site; Ampr Minr | This study |
pNF118 | pRO6448::pNF117; Ampr Ermr Minr | This study |
pRO6448 | pE194(ts) with AluI fragment (oriT) of pC221 cloned into the unique ClaI site; Ermr | 51 |
pTS1 | Shuttle vector; pE194orits; ColE1; Ampr Camr | 24 |
pTS1-d | Derivative of pTS1 with deletion of plasmid-encoded 3′ region of ermC | This study |
pUC19 | E. coli cloning vector; Ampr | 83 |
Ampr, ampicillin resistant; Camr, chloramphenicol resistant; Ermr, erythromycin resistant; Minr, minocycline resistant; Tmpr, trimethoprim resistant; ts, temperature-sensitive origin of replication.
Staphylococcus epidermidis mutant construction. (i) Aconitase (acnA) mutant.
A 1.7-kb internal PCR product of the acnA gene of S. epidermidis strain 1457 was amplified using primers 663 forward (contains a KasI restriction site) and 664 reverse (contains a PstI restriction site) (Table 2) and cloned into pGEM-T (Promega). The 1.7-kb PCR product was excised from pGEM-T by digestion with KasI and PstI and ligated into the KasI and PstI sites of pUC19 (83) to generate the plasmid pNF103. The tetM cassette from plasmid pJF12 (from J. Finan and G. Archer) was inserted into a unique EcoRI site of pNF103 at nucleotide position 856 of the 2,702-bp acnA gene to generate the pNF117 plasmid. The temperature-sensitive plasmid pROJ6448 (51) was digested with PstI and ligated into the unique PstI site of pNF117. The resulting temperature-sensitive plasmid pNF118 was passaged through S. aureus strain RN4220 and introduced into S. epidermidis strain 1457 by electroporation (59). Strain 1457 containing plasmid pNF118 was used to construct an acnA::tetM mutant as described previously (19). The resulting mutant was backcrossed into wild-type strain 1457 using transducing phage 71 (15). Inactivation of the acnA gene by tetM cassette was verified by PCR, Southern blot analysis (68), and enzymatic assays (64).
TABLE 2.
Primer | Nucleotide sequence (5′→3′) |
---|---|
663 forward | GCGCGCGGCGCCGGGATATAAAATGGCTTCTA |
664 reverse | GCGCGCCTGCAGACCAGCAAGCGCATAAGCTA |
SERP1762(glmM)-f | CACCTGAATTGGCTTTTAAACTAGG |
SERP1762(glmM)-r | TCAACACGATATTTGTCAGTCACTC |
SERP1760(glmS)-f | GTGTGGAATTGTTGGTTATATTGGC |
SERP1760(glmS)-r | GCTTCACGTGATAATGTTGAACC |
glmU-f | CGATTATTCTGGCAGCAGGTAAG |
glmU-r | CGATTGATACGTTGTTGCAAAGC |
icaProbeforward | GACAGTCGCTACGAAAAG |
icaProbereverse | CCGAATAATTTGTAAATTTCC |
icaR-r | GGAGGCTCTAAAATACCAAGTCTC |
icaR-f | GGTACGATGGTACTACACTTGATG |
pgi-f | GCATGAACTAGATCAGCAAAAGGATATTG |
pgi-r | GCTGTAAGAACAGAATAACGACCTCC |
sarA-f | GGCTATTTCAAAAATCAATGACTGCTTTG |
sarA-r | GCTTCTGTGATACGGTTGTTTACTC |
sigB-f | CGAAAGAGTCGAAATCAGCTAGTG |
sigB-r | GTGAAACATGCATTTGACTAAGACC |
SalI-SD-acnA-f | CTAAGTCGACAATATCAAGGGGGATATAAAATGGCTTC |
SacI-acnA-r | CAAGAGCTCATGACTG CTTGTACTCAATAGTGAG |
pCL15-f | GTTCTACATCCAGAACAACCTCTGC |
pCL15-r | GAAATGATGACCTCGTTTCCACCG |
citC-r-ermB2 | GACGTTCTGTACCTTCTTTAGGCGACTCATAGAATTATTTCCTCCC |
citZ-f-ermB | CACTTTGAGGAGTATGTGACGAAGGAGGGATTCGTCATGTTG |
phoP-BamHI | GGaGGATCCACGTACAGTCTTTATCAATTTAGGTTGC |
ermB-citC-f2 | GGAAATAATTCTATGAGTCGCCTAAAGAAGGTACAGAACGTCTAGTAAGAG |
ansP-SacI | GCAGAGCTCACTAAGTGTCGATGTAAATTTTATCGTGC |
ermB-citZ-r | GACGAATCCCTCCTTCGTCACATACTCCTCAAAGTGCTTGTATAC |
(ii) Citrate synthase (citZ) and isocitrate dehydrogenase (citC) double mutant.
The genes coding for citrate synthase and isocitrate dehydrogenase are present in a two-gene operon and cotranscribed. To inactivate the citZC operon, a gene splicing by overlap extension technique was used to replace a 2-kb internal DNA region of citZC by the ermB gene. The ermB gene was amplified from pEC4 (5) using primers citC-r-ermB2 and citZ-f-ermB (Table 2), containing sequences homologous to the citC and citZ genes. Genomic DNA from S. epidermidis strain 1457 was used as a template for PCR amplification of the DNA flanking the internal citZC region. Primers ansP-SacI and ermB-citZ-r (Table 2) were used for amplification of a 1.9-kb region of the citZ upstream region. A 1.7-kb region of the citC downstream region was amplified using phoP-BamHI and ermB-citC-f2 primers (Table 2). The resulting 4.6-kb PCR product consisted of a 1-kb ermB gene with DNA flanking the internal citZC regions. The 4.6-kb PCR product contained SacI and BamHI sites that were used for ligation into pTS1-d digested with SacI and BamHI to generate pMRS5. The temperature-sensitive plasmid pTS1-d is a derivative of pTS1 (24) with deletion of the plasmid-encoded 3′ region of the ermC gene. It was constructed by PCR amplification of pTS-1 DNA using primers pTS1dErm-f and pTS1dErm-r, and the resulting PCR product was self-ligated as described previously (45). Plasmid pMRS5 was used to construct a strain 1457 citZC double mutant (1457-citZC::ermB) (19). Allelic replacement of the internal region of citZC genes by the ermB cassette was verified by PCR and Southern blot analysis.
Construction of the complementation plasmid.
Plasmid pCL15 (a kind gift of Chia Lee), containing a Pspac promoter, was used for the construction of an acnA complementation plasmid. The pMRS2 complementation plasmid was constructed by amplifying the 2.7-kb promoterless acnA gene from S. epidermidis strain 1457 using SalI-SD-acnA-f and SacI-acnA-r primers, followed by ligation of the PCR product into plasmid pCL15 digested with SalI and SacI. Plasmid pMRS2 was isolated from S. aureus strain RN4220 and electroporated into S. epidermidis strain 1457 (59). Plasmid pMRS2 was introduced into strain SE1457-acnA using transducing phage 71 (49). Induction of expression from the Pspac promoter was performed by supplementing bacterial cultures with isopropyl-β-d-thiogalactopyranoside (IPTG) (1 mM).
Measurement of acetic acid and glucose concentrations in culture medium.
Aliquots of bacteria (2 ml) were centrifuged for 3 min at 14,000 rpm at 4°C, and the supernatants were removed and stored at −20°C until use. Acetate and glucose concentrations were determined with kits purchased from R-Biopharm and used according to the manufacturer's protocol.
Determination of NAD+, NADH, and ATP concentrations.
Intracellular NAD+ and NADH concentrations were determined with an enzymatic cycling assay kit (Biovision). Briefly, aliquots (5 to 20 ml) were harvested at 2, 3, 4, 5, and 6 h by centrifugation at 4°C for 10 min at 4,000 rpm. Bacterial pellets were suspended in 1 ml of extraction buffer (Biovision) and lysed using lysing matrix B tubes (Qbiogene) in a FastPrep instrument (Qbiogene). The lysate was centrifuged at 4°C for 5 min at 14,000 rpm. NAD+ and NADH concentrations were determined according to the manufacturer's protocol and normalized to the cell density. All assays were performed in duplicate for two independent experiments.
Intracellular ATP concentrations were determined using the Enliten ATP assay (Promega). Briefly, 2 × 107 bacteria were collected at 2, 3, 4, 5, and 6 h, washed three times with 1 ml of phosphate-buffered saline, and suspended in 100 μl of phosphate-buffered saline. Bacteria were lysed by the addition of 900 μl of dimethyl sulfoxide (23). ATP concentrations were determined according to the manufacturer's protocol and normalized to the cell density. All assays were performed in duplicate for two independent experiments.
Determination of aconitase activity.
Cell-free lysates of S. epidermidis were prepared as follows: aliquots of bacteria (2 ml) were harvested by centrifugation and suspended in 750 μl of lysis buffer containing 90 mM Tris (pH 8.0) and 100 μM fluorocitrate. The samples were lysed using lysing matrix B tubes (Qbiogene) in a FastPrep instrument (Qbiogene). The lysate was centrifuged for 5 min at 14,000 rpm and 4°C. Aconitase activity was assayed in the resulting cell-free lysate as previously described (63). One unit of aconitase activity is defined as the amount of enzyme necessary to give a ΔA240 min−1 of 0.0033 (1). Protein concentrations were determined by the method of Lowry (41).
PIA immunoblot assay.
PIA accumulation was determined as described previously (78). Briefly, TSB medium containing 0.25% glucose was inoculated with equal numbers of bacteria from overnight cultures. The cultures were grown at 37°C, with a flask-to-medium ratio of 7:1, and aerated at 225 rpm. Every 2 h, equal numbers of bacteria (0.25 A600 unit) were harvested by centrifugation, and the PIA was extracted in 0.5 M EDTA (pH 8.0) by boiling for 5 min. Aliquots of PIA were applied to a polyvinylidene difluoride membrane (Immobilon-P; Millipore) and blocked with 5% skim milk overnight. The polyvinylidene difluoride membrane was incubated for 2 h with PIA-specific antiserum (generously provided by Michael Otto), which was followed by a 2-h incubation with an anti-rabbit immunoglobulin G peroxidase conjugate. The presence of PIA was detected using SuperSignal West Pico chemiluminescent substrate (Pierce). The integrated density values of bands on autoradiographs were determined with the TotalLab software (Nonlinear Dynamics Ltd.)
Northern blot analysis.
Northern blot analysis of transcripts was performed as described previously (58), except that total RNA was isolated using the FastRNA Pro Blue kit (Qbiogene) and purified using an RNeasy kit (Qiagen). Oligonucleotide primers (Table 2) used in making DNA probes were designed using the S. epidermidis RP62A genome sequence (GenBank accession number CP000029). Probes for Northern blotting were generated by PCR amplification of unique internal regions of glmM, glmS, glmU, icaD, icaR, pgi, sarA, and sigB genes and labeled using the North2South random prime labeling kit (Pierce). Electrophoresis, transfer of the RNA to the Nytran SPC nylon membrane (Whatman), and hybridization were done using the NorthernMax kit (Ambion). Detection was performed using the chemiluminescent nucleic acid detection module (Pierce). When necessary, reprobing of blots was done according to the manufacturer's protocol.
NMR data collection, processing, and analysis.
Nuclear magnetic resonance (NMR) samples were prepared from three independent cultures (50 ml) of S. epidermidis strains 1457 and 1457-acnA during the exponential growth phase (2 h) and postexponential growth phase (6 h) using [13C6]glucose (Cambridge Isotope Laboratories) in place of glucose in the growth medium. Bacteria were rapidly harvested, lysed using lysing matrix B tubes (Qbiogene) in a FastPrep instrument (Qbiogene), and centrifuged to remove the cell debris. Samples were lyophilized, suspended in a 99.8% D2O (Isotec) 50 mM phosphate buffer, and an aliquot (500 μl) was transferred to an NMR tube for analysis.
The NMR spectra were collected on a Bruker 500-MHz Avance spectrometer equipped with a triple-resonance, z-axis gradient cryoprobe. A BACS-120 sample changer with Bruker Icon software was used to automate the NMR data collection. Two-dimensional (2D) 1H-13C-heteronuclear single quantum coherence (1H-13C-HSQC) spectra were collected with a Bruker pulse sequence (HSQCETGP), solvent presaturation, and relaxation delay of 0.5 s. A total of 1,024 data points with a sweep width of 4734.85 Hz and 64 data points with a sweep width of 13834.26 Hz were collected in the 1H and 13C dimensions, respectively. A total of eight dummy scans and 128 scans were used to obtain each of the 2D 1H-13C HSQC NMR spectra. Spectra were processed using the NMRPipe software package (17) and zero-filled with 2,048 and 1,024 points in the 1H and 13C dimensions, respectively. Additionally, the spectra were Fourier transformed, manually phased, and baseline corrected.
Spectra were analyzed using Primitive Interactive Peak Picker (PIPP) (20) to determine chemical shifts and peak intensities. The chemical shifts were divided into three groups (Tables 3 and 4) based on the intensities of similar peaks between the wild-type and acnA mutant strains during the exponential and postexponential phases of growth. Peak intensities were normalized for each spectrum by dividing by the average peak intensity. The triplicate data sets were then used to calculate average peak intensities for each peak observed in the 2D 1H-13C HSQC spectra for the wild-type and acnA mutant. Similarly, a percent error was calculated for each peak by dividing the standard deviation by the average peak intensity. The average peak intensities were then used to calculate a percent difference between the wild-type and acnA mutant. Peaks with calculated percent differences greater than five times the average percent error were considered to have increased concentrations in the wild-type or acnA mutant strains. Peaks with less than a fivefold deviation were considered similar. The peaks assigned to the same metabolite were required to have the same relative change in intensity in order to be classified as a metabolite with an increase in concentration.
TABLE 3.
Increased intracellular concn in the wild-type strain 1457a | Increased intracellular concn in strain 1457-acnAa | Similar intracellular concns in wild-type and 1457-acnA strains |
---|---|---|
Lactic acid | Valine | Acetate |
Succinate | Leucine | Glucose |
Glutamate | Lysine | Glucosamine |
Glutamine | Citrate | Ethanol |
Asparagine | Serine | Glucose-6-phosphate |
Aspartate | Arginine | Inosine |
Fructose-6-phosphate | Adenosine | |
Glucono-1,5-lactone | Xanthosine | |
Acetaldehyde | N-Acetylglutamate | |
Isoleucine | NAD | |
Ornithine | Uridine | |
UDP-N-acetylglucosamine | Alanine |
The intracellular concentration was considered to be increased when the percent difference in the NMR peak intensities was fivefold greater than the percent error observed in the peak intensities between the triplicate NMR spectra.
TABLE 4.
Increased intracellular concn in the wild-type strain 1457a | Increased intracellular concn in strain 1457-acnAa | Similar intracellular concns in wild-type and 1457-acnA strains |
---|---|---|
Glutamine | Ethanol | Glucosamine-6-phosphate |
Glutamate | Alanine | Glucose |
Ornithine | Lactate | Ribose |
Succinate | Acetate | Glucose-6-phosphate |
Asparagine | Acetaldehyde | NAD |
Aspartate | Citrate | UDP-glucuronate |
γ-Aminobutanoate | UDP-N-acetylglucosamine | Ribose-5-phosphate |
Isocitrate | Uridine | Inosine |
Fructose-6- | Adenosine | |
phosphate | Xanthosine |
The intracellular concentration was considered to be increased when the percent difference in the NMR peak intensities was fivefold greater than the percent error observed in the peak intensities between the triplicate NMR spectra.
NMR peaks were assigned to specific metabolites using the Madison Metabolomics Consortium Database (14) using a tolerance of 0.05 ppm and 0.50 ppm for 1H and 13C dimensions, respectively. The presence of metabolites and metabolic pathways were verified with the KEGG (31) and Metacyc (32) databases. NMR reference data available from the Madison Metabolomics Consortium Database is incomplete, so it is currently not feasible to assign every NMR resonance observed in the 2D 1H-13C HSQC NMR spectra to a S. epidermidis metabolite. It is also important to note that the combination of 2D 1H-13C HSQC NMR spectra with isotopically enriched (e.g., [13C6]glucose) cellular extracts enables the measurement of accurate metabolite concentration changes relative to one-dimensional 1H NMR metabolomic methods alone. Generally, only compounds that are metabolic products of [13C6]glucose were detected.
Statistical analysis.
The statistical significance of changes between wild-type and mutant strains (e.g., ATP concentrations) was assessed with the Student's t test. To determine whether a correlation existed between two physiological parameters, a correlation coefficient (ρ) was calculated.
RESULTS
Construction and characterization of an S. epidermidis strain 1457 aconitase mutant.
Partial biochemical inhibition of TCA cycle activity in S. epidermidis increased the accumulation of PIA (78). Because fluorocitrate is very toxic, we were unable to completely block TCA cycle activity without killing the bacteria. To overcome this obstacle, we inactivated the TCA cycle in S. epidermidis strain 1457 by insertion of a tetM cassette into the gene encoding aconitase (acnA; also known as citB) and then assessed the effect on PIA synthesis. In S. epidermidis, aconitase is present as a sole copy on the chromosome; hence, inactivation of aconitase results in a nonfunctional TCA cycle. Inactivation of the aconitase gene in S. epidermidis strain 1457 by allelic replacement was genotypically verified by PCR and Southern blot analysis (data not shown) and phenotypically by aconitase enzymatic activity assays (Fig. 1A). In addition, overall TCA cycle function was assessed by measuring the accumulation and depletion of acetic acid from the culture medium of the wild-type, mutant, and complemented strains (Fig. 1D). (Acetic acid catabolism in staphylococci requires a fully functional TCA cycle [64, 65].) As expected, aconitase inactivation inhibited the postexponential oxidative catabolism of acetic acid (Fig. 1D). Of importance, when the concentration of acetic acid in the culture medium was plotted as a function of growth, the exponential growth phase rates of acetic acid accumulation in strains 1457 and 1457-acnA were equivalent (data not shown), suggesting that carbon utilization in both strains was proceeding through glycolysis and the acetate kinase/phosphotransacetylase pathway at a similar rate. The equivalent rate of acetic acid accumulation in strains 1457 and 1457-acnA was also supported by NMR metabolomic analysis (Table 3). If carbon flow through glycolysis were equivalent, then it is reasonable to predict that the growth rate of the wild-type and aconitase mutant strains would also be equivalent. Surprisingly, the growth rate of strain 1457-acnA was lower than the growth rate of the isogenic wild-type strain, and this was reflected in the temporal depletion of glucose (Fig. 1C). This result was surprising because TCA cycle activity is repressed during the exponential growth phase when nutrients are abundant; thus, inactivating a repressed metabolic pathway should have minimal consequences. Restoration of the growth rate and the ability to catabolize acetate was accomplished by complementation of the strain 1457-acnA mutation with a plasmid (pMRS2) containing the acnA gene under the control of a Pspac promoter (Fig. 1A to D). As a whole, these date demonstrate that acnA was inactivated, and this resulted in a metabolic block in the TCA cycle.
TCA cycle inactivation redirects carbon from growth into UDP-N-acetylglucosamine biosynthesis.
When grown in the presence of a rapidly catabolizable carbon source, gram-positive bacteria repress the TCA cycle; hence, there is an accumulation of acidic secondary metabolites (e.g., acetate) in the culture medium. Derepression of the TCA cycle occurs upon depletion of the readily catabolizable carbon source(s) and coincides with the depletion of acetate from the culture medium. The processing of glucose through glycolysis and the resulting accumulation of acetate during substrate-level phosphorylation were equivalent in S. epidermidis strains 1457 and 1457-acnA; hence, the lower growth rate of strain 1457-acnA relative to the wild-type strain was likely due to a redirection of carbon and energy from growth into other cellular processes or metabolic pathways. If carbon and/or energy were diverted from growth to another metabolic pathway or process, then the number of bacteria produced per unit of glucose consumed should be lower in the aconitase mutant strain than in the wild-type strain. Plotting the glucose concentrations in the culture medium as a function of optical density at 600 nm for three independent experiments (Fig. 2) confirmed that fewer bacteria are produced per unit of glucose consumed by strain 1457-acnA than by strain 1457. These data strongly suggest that carbon and/or energy were diverted from growth into other cellular processes. To determine the metabolic pathways into which carbon might be redirected, we utilized NMR metabolomics to assess the metabolic status of strains 1457 and 1457-acnA in the exponential growth phase (2 h) and the postexponential growth phase (6 h) (see Fig. S1 and S2 in the supplemental material) (Tables 3 and 4). As expected, TCA cycle inactivation decreased the intracellular concentration of amino acids derived from TCA cycle intermediates (Asn, Asp, Gln, and Glu) and increased accumulation of the PIA biosynthetic precursor UDP-N-acetylglucosamine. Interestingly, TCA cycle inactivation resulted in an exponential-growth-phase accumulation of branched-chain amino acids relative to the wild-type strain (see Fig. S1 in the supplemental material) (Table 3). In addition to increasing the carbon flow into branched-chain amino acid biosynthesis, the presence of a high concentration of glucono-1,5-lactone in strain 1457-acnA suggests that inactivation of the TCA cycle increased carbon flow into the pentose phosphate pathway.
NMR metabolomics indicated that TCA cycle inactivation redirected carbon into UDP-N-acetylglucosamine biosynthesis (Tables 3 and 4). If carbon were being redirected into UDP-N-acetylglucosamine biosynthesis, then it is likely that transcription of genes coding for the UDP-N-acetylglucosamine biosynthetic enzymes would be increased. To determine whether TCA cycle inactivation altered the transcription of UDP-N-acetylglucosamine biosynthetic genes, we probed total RNA for pgi (glucose-6-phosphate isomerase), glmS (glucosamine-6-phosphate synthase), glmM (phosphoglucosamine mutase), and glmU (UDP-N-acetylglucosamine pyrophosphorylase) (Fig. 3). Consistent with metabolomic data indicating an increased intracellular concentration of fructose-6-phosphate, transcription of pgi was slightly increased in S. epidermidis strain 1457-acnA relative to strain 1457 during the exponential growth phase. (Glucose-6-phosphate isomerase catalyzes the second step in glycolysis, specifically, the reversible isomerization of glucose-6-phosphate into fructose-6-phosphate.) Fructose-6-phosphate is the biosynthetic precursor of UDP-N-acetylglucosamine, whose biosynthesis is encoded within the genes glmS, glmM, and glmU. The exponential-growth-phase mRNA levels of glmS, glmM, and glmU were increased in strain 1457-acnA relative to strain 1457. Taken together, these data demonstrate that TCA cycle inactivation results in transcriptional changes that redirect carbon into N-acetylglucosamine biosynthesis.
In addition to providing biosynthetic intermediates, the TCA cycle generates ATP and reducing potential; therefore, a metabolic block in the TCA cycle will alter the energy status of the bacterium. As an indicator of the energy status, the intracellular concentrations of NAD+, NADH, and ATP were determined for S. epidermidis strains 1457 and 1457-acnA. The intracellular concentration of ATP was lower in the aconitase mutant strain relative to the wild-type strain during both the exponential and postexponential growth phases (Fig. 4C). This decreased ATP concentration was likely due to decreased oxidative phosphorylation, as the intracellular concentrations of NAD+ and NADH were significantly (P < 0.01) lower in the aconitase mutant strain than in the wild-type strain (Fig. 4A and B).
TCA cycle inactivation increases PIA accumulation.
To determine whether TCA cycle inactivation resulted in increased synthesis of PIA, we assessed the relative amounts of cell-associated PIA in the acnA mutant, the complemented acnA mutant, and the wild-type strains using a PIA immunoblot assay (Fig. 5A and B). In addition, to facilitate comparison of the effect of TCA cycle inactivation on PIA accumulation with the inactivation of well-established regulators (i.e., IcaR, σB, and SarA), we determined the relative amounts of cell-associated PIA for isogenic strains that had icaR, sarA, or sigB genetically inactivated. In agreement with previous studies (9, 10, 26, 35, 74), we observed that mutations in the genes of positive regulators sigB and sarA decreased PIA accumulation relative to the wild-type strain, while inactivation of icaR increased PIA accumulation (Fig. 5A and B). Surprisingly, aconitase inactivation had a much greater effect on PIA synthesis than did inactivation of the well-studied repressor IcaR (Fig. 5A and B). Complementation of the acnA mutation restores PIA accumulation to that seen in the parental strain (Fig. 5A and B).
In B. subtilis, aconitase inactivation results in the accumulation of citric acid, which is partially responsible for blocking sporulation and causing a slight decrease in the growth rate (12). NMR metabolomics revealed an accumulation of citric acid in the aconitase mutant strain relative to the wild-type strain (see Fig. S1 and S2 in the supplemental material) (Tables 3 and 4), raising the possibility that the increased accumulation of PIA and the decreased growth rate of S. epidermidis strain 1457-acnA relative to strain 1457 might be due to citric acid-induced stress. To address these possibilities, we inactivated both citrate synthase (citZ) and isocitrate dehydrogenase (citC) in S. epidermidis strain 1457 and assessed growth and assayed for PIA accumulation (data not shown). Similar to the aconitase mutant strain, the citCZ double mutant dramatically increased PIA accumulation. Additionally, the citCZ double mutant had a decreased growth rate relative to the wild-type strain, but the growth rate was increased relative to strain 1457-acnA (data not shown), suggesting that citric acid accumulation was partially responsible for the slower growth of the aconitase mutant. Taken together, these data demonstrate that TCA cycle activity represses S. epidermidis PIA accumulation and that this effect is independent of citric acid.
TCA cycle activity represses icaADBC transcription.
TCA cycle inactivation alters the metabolic status of S. epidermidis (Fig. 1A to D and 3 and Tables 3 and 4), raising the possibility that an icaADBC transcriptional regulator could respond to the altered metabolic environment to increase icaADBC transcription. To determine whether the increased accumulation of PIA by the acnA mutant strain was due to altered icaADBC transcription, we examined icaADBC mRNA levels in S. epidermidis strains 1457 and 1457-acnA. In addition, icaADBC mRNA levels were determined for strain 1457 with mutations in sigB, sarA, or icaR. Consistent with the PIA immunoblot data (Fig. 5A and B), aconitase inactivation resulted in a very large increase in icaADBC transcription, or mRNA stability, relative to the isogenic wild-type strain (Fig. 6A and B), demonstrating that TCA cycle activity represses icaADBC transcription. In agreement with previous results, we observed that sigB and sarA inactivation repressed icaADBC transcription and that icaR inactivation derepressed icaADBC transcription (9, 11, 26). Interestingly, the extent of derepression in the 1457-acnA mutant strain was dramatically higher than seen in an isogenic icaR mutant (Fig. 6A and B), suggesting TCA cycle activity has a greater role in regulating icaADBC transcription than does IcaR. These data demonstrate that, like regulation of the lac operon, icaADBC transcription is regulated by a catabolic process, specifically, the TCA cycle.
TCA cycle inactivation alters transcription of icaR, sarA, and sigB.
As stated, transcription of icaADBC requires at least two positive effectors, SarA and σB, and one negative regulator, IcaR. The dramatic increase in icaADBC mRNA levels in the aconitase mutant strain relative to the wild-type strain could be due to an increased number of positive effectors or a decreased number of negative effectors. To determine whether aconitase inactivation altered transcription of the known regulators of icaADBC transcription, we probed total RNA isolated throughout the growth cycle for changes in the transcription of sigB, sarA, and icaR (Fig. 7). Surprisingly, aconitase inactivation increased transcription or mRNA stability of both positive regulators sigB and sarA and the negative regulator icaR. These data suggest that TCA cycle inactivation can alter the mRNA levels of the known regulators of PIA synthesis; however, they fail to establish that these regulators are involved in TCA cycle-mediated regulation of PIA synthesis. To determine whether IcaR, SarA, or σB is regulating PIA synthesis in response to TCA cycle-associated metabolic changes, icaR, sarA, and sigB regulatory mutants of strain 1457 were incubated with 400 μM of the aconitase inhibitor fluorocitric acid, and PIA accumulation was assessed relative to the parental strain 1457 (Fig. 8.) The addition of fluorocitric acid to the culture medium of S. epidermidis strains 1457-sigB and 1457-icaR significantly (P < 0.01) increased the accumulation of PIA relative to the untreated control cultures. In strain 1457-sarA, the accumulation of PIA was similar irrespective of the presence of fluorocitric acid in the culture medium (P > 0.05). Overall, these data suggest that TCA cycle-mediated derepression of ica transcription and PIA synthesis occur independently of IcaR and σB. Furthermore, these data confirm that PIA synthesis requires SarA (10, 74) and at least one additional TCA cycle-responsive negative regulator.
DISCUSSION
Metabolic effect of TCA cycle activity on PIA biosynthesis.
Glycolysis is the catabolic pathway that converts glucose into pyruvate, with the catabolic fate of pyruvate being determined by the availability of oxygen. Interestingly, the rate of glucose utilization by the wild-type S. epidermidis strain 1457 appears greater than the rate by strain 1457-acnA (Fig. 1C); however, these data fail to account for the number of bacteria in the medium. When this is taken into account, glucose utilization was greater in strain 1457-acnA than in strain 1457 (Fig. 2), suggesting that carbon flow through glycolysis might be greater in a TCA cycle mutant. If the amount of carbon flowing through glycolysis were greater in a TCA cycle mutant than in the parental strain, then the amount of acetate in the culture medium at the time when glucose was depleted should be greater in the mutant. Glucose was depleted in the wild-type and complemented strains after 5 h of growth; however, in strain 1457-acnA, glucose was depleted after 7 h of growth (Fig. 1C). Upon depletion of glucose, the concentrations of acetate in the culture medium were similar (14 to 16 mM) for all strains (Fig. 1D), suggesting that carbon flow through glycolysis was similar in the aconitase mutant and the wild-type strain. Additionally, because the concentrations of acetate were below 24 mM (if all glucose is processed through the glycolytic pathway, then a 2:1 stoichiometry of acetate to glucose should be maintained), the data confirm that carbon are flowing into other pathways. Consistent with these data, NMR metabolomics indicated that the exponential-growth-phase concentrations of acetic acid in strains 1457 and 1457-acnA were similar (Table 3). In addition to glycolysis, another major pathway staphylococci use for glucose catabolism is the pentose phosphate pathway (8, 70). The presence of glucono-1,5-lactone in the NMR metabolomic data (Table 3) suggests that carbon flow through the pentose phosphate pathway is increased in the TCA cycle mutant strain relative to the wild-type strain. One function of the pentose phosphate pathway is to provide the five-carbon intermediate for purine biosynthesis; hence, the increased carbon flow through the pentose phosphate pathway is likely linked to the decreased intracellular concentration of ATP in strain 1457-acnA relative to strain 1457 (Fig. 3). (De novo biosynthesis of ATP requires 5-phosphoribosyl-1-pyrophosphate. An important function of the pentose phosphate pathway is to provide biosynthetic intermediates for purine biosynthesis, namely, ribose-5-phosphate that is converted into 5-phosphoribosyl-1-pyrophosphate.)
NMR metabolomic data revealed an increased intracellular concentration of fructose-6-phosphate in the TCA cycle mutant relative to the wild-type strain (Table 3). Fructose-6-phosphate can undergo a transamination reaction to generate glucosamine-6-phosphate, a reaction catalyzed by glucosamine-6-phosphate synthase (glmS; EC 2.6.1.16). Phosphoglucosamine mutase (glmM; EC 5.4.2.10) catalyzes the reversible isomerization glucosamine-6-phosphate to glucosamine-1-phosphate. Glucosamine-1-phophaste is the substrate for the bifunctional enzyme UDP-N-acetylglucosamine pyrophosphorylase (glmU; EC 2.7.7.23 and EC 2.3.1.157) that catalyzes the acetylation and UTP-dependent activation of glucosamine-1-phosphate to generate UDP-N-acetylglucosamine. NMR metabolomics confirmed that S. epidermidis strain 1457-acnA has a greater intracellular concentration of UDP-N-acetylglucosamine than strain 1457 does. In addition, transcription of glmS, glmM, and glmU is increased more during the exponential growth phase in the TCA cycle mutant than in the wild-type strain (Fig. 3). In total, these data demonstrate that TCA cycle inactivation increased the availability of the PIA monomer, UDP-activated N-acetylglucosamine and that this was partially due to transcriptional derepression of N-acetylglucosamine biosynthetic genes.
In addition to PIA synthesis, UDP-N-acetylglucosamine is critical for biosynthesis of the cell wall components teichoic acid and peptidoglycan. Inactivation of aconitase in S. epidermidis decreased the growth rate (Fig. 1B) and the number of bacteria produced per unit of glucose (Fig. 2), suggesting that UDP-N-acetylglucosamine was redirected from cell wall biosynthesis to PIA synthesis (Fig. 5A). Thus, the decreased growth rate of the aconitase mutant strain was likely due to a combination of increased competition for substrate (i.e., UDP-N-acetylglucosamine) by PIA biosynthetic enzymes and an accumulation of citric acid.
Regulatory effect of TCA cycle activity on PIA biosynthesis.
Two common mechanisms by which bacteria control carbon flow are feedback inhibition of enzyme activity and regulation of enzyme synthesis. Undoubtedly, some of the metabolic changes arising from TCA cycle inactivation are the result of feedback inhibition of enzyme activity; however, by definition, the derepression of icaADBC transcription (Fig. 6A and B) must be at the regulatory level. Although the prospect that TCA cycle enzymes directly regulate icaADBC transcription is a possibility, it is more likely that regulation is being mediated by regulatory proteins responding to changes in the metabolic status of the bacteria. Metabolic regulation was one of the first bacterial regulatory modalities identified, resulting in thousands of studies addressing all aspects of regulation. This long history of research into metabolic regulation has identified a large number of regulatory proteins capable of responding to changes in the intracellular concentrations of molecules associated with TCA cycle activity, such as NADH (e.g., Rex [4], NmrA [39], and CcpA [21]), citric acid (CcpC [30, 33]), glutamate (GadX and GadW [75]), branched-chain amino acids (CodY [61]), and ATP (KinA [69]). These observations lead us to hypothesize that a regulatory protein or proteins respond to TCA cycle-associated metabolites and regulate icaADBC transcription and PIA synthesis.
TCA cycle inactivation increased the transcription or mRNA stability of the known regulators of icaADBC transcription, specifically, sigB, sarA, and icaR (Fig. 7). These data raise the possibility that TCA cycle-induced alterations in the metabolic status of the bacterium might be “sensed” by σB, SarA, or IcaR. Incubation of S. epidermidis strain 1457-sigB with a low concentration of the TCA cycle inhibitor fluorocitric acid restored PIA synthesis to wild-type levels (Fig. 8). This fluorocitrate-induced derepression of PIA synthesis in the sigB mutant strain is similar to that observed in an S. epidermidis rsbU mutant strain (RsbU is an activator of σB) treated with a PIA synthesis-stimulating concentration of ethanol (34). In that study, the authors found that ethanol could restore cell-associated PIA accumulation in an rsbU mutant strain to a level equivalent to that of the nonstimulated wild-type strain. Because ethanol is an inhibitor of TCA cycle activity (6, 37), we hypothesize that the PIA synthesis-stimulating properties of ethanol may be due to its TCA cycle inhibitory properties.
Inactivation of sarA in S. epidermidis dramatically decreases icaADBC transcription (74) and PIA accumulation (26, 74) and results in a biofilm-negative phenotype (10). Because SarA is thought to be essential for PIA synthesis (74), the more likely outcome of incubating S. epidermidis strain 1457-sarA with fluorocitric acid would be equivalent PIA accumulation between the wild-type and sarA mutant strains. As expected, the amount of PIA produced by strain 1457-sarA was similar irrespective of the presence of fluorocitric acid (Fig. 8). These data are consistent with SarA being essential for PIA synthesis and/or being required for responding to TCA cycle-associated signals.
TCA cycle inactivation increased transcription or mRNA stability of icaR relative to the wild-type strain (Fig. 7). IcaR is a transcriptional repressor of icaADBC that was originally hypothesized to be involved in environmental regulation of PIA synthesis (9). For these reasons, IcaR appeared to be a possible candidate for responding to TCA cycle-induced metabolic changes. If IcaR were responding to TCA cycle-associated metabolic changes, then in an icaR mutant background, the synthesis of PIA should be unaffected by the presence of fluorocitric acid. Growth of strain 1457-icaR in the presence of a low concentration of fluorocitric acid significantly increased the accumulation of PIA (Fig. 8), demonstrating that a second repressor is involved in regulating PIA synthesis. It is likely that this second repressor is responding to TCA cycle-associated metabolic signals.
NMR metabolomics (Table 3) indicated that the intracellular concentrations of branched-chain amino acids were greater in the aconitase mutant strain than in the wild-type strain. In gram-positive bacteria, the intracellular concentrations of branched-chain amino acids control the expression of numerous genes, a mechanism requiring the CodY regulatory protein (25, 61, 66, 72). The affinity of CodY for its operator site is enhanced in response to high intracellular concentrations of GTP and branched-chain amino acids (54, 61). The more likely explanations for our data are that CodY is an activator of icaADBC transcription, CodY-mediated repression is not functioning in S. epidermidis during the exponential growth phase, or a positive effector, potentially SarA, can overcome CodY-mediated repression. We recently demonstrated that CodY is a repressor of PIA synthesis in the closely related species S. aureus (45); thus, it seems unlikely that CodY is an activator of icaADBC transcription in S. epidermidis. Investigations are under way to determine the function of CodY in regulating S. epidermidis PIA synthesis.
In gram-positive bacteria, carbon catabolite repression is primarily mediated by CcpA (28). Recently, CcpA was shown to activate transcription of icaADBC and increase the accumulation of PIA in S. aureus (60). In B. subtilis, CcpA regulatory activity is controlled by interactions with phosphorylated HPr or Crh and fructose-1,6,-bisphosphate or glucose-6-phosphate (67). NMR analysis indicated that TCA cycle inactivation increased the intracellular concentration of fructose-6-phosphate (Table 3). Fructose-6-phosphate is the biosynthetic precursor of UDP-N-acetylglucosamine. In addition to its importance in PIA biosynthesis, fructose-6-phosphate can be reversibly isomerized to glucose-6-phosphate by glucose-6-phosphate isomerase, resulting in CcpA activation. Taken together, these data lead us to hypothesize that TCA cycle inactivation increases CcpA-mediated activation of icaADBC.
Conclusion.
TCA cycle activity is repressed during the exponential growth phase; however, a basal level of activity is present. As evidenced by the data in this study, disruption of this basal activity can have pronounced metabolic consequences. TCA cycle activity is regulated by the availability of nutrients, oxygen, and iron (8, 62, 65, 71, 76) and by certain stress-inducing stimuli, such as heat, ethanol, and antibiotics (6, 36, 73); thus, numerous external conditions can interfere with the basal TCA cycle activity and produce metabolic changes. The linkage of TCA cycle activity and exopolysaccharide synthesis and the susceptibility of the TCA cycle to environmental inactivation lead us to speculate that one mechanism by which staphylococci perceive external environmental change is through alterations in TCA cycle activity. Thus, we hypothesize that the TCA cycle acts as a novel signal transduction pathway to translate external stimuli/conditions into intracellular signals that can stimulate or repress the activity of regulatory proteins like CodY and CcpA.
Supplementary Material
Acknowledgments
This article is a contribution of the University of Nebraska Agricultural Research Division, supported in part by funds provided through the Hatch Act, the National Institute of General Medical Sciences (GM076585), and the American Heart Association (0760005Z) to G.A.S. and the American Heart Association (0860033Z) to R.P.
Footnotes
Published ahead of print on 26 September 2008.
Supplemental material for this article may be found at http://jb.asm.org/.
REFERENCES
- 1.Baughn, A. D., and M. H. Malamy. 2002. A mitochondrial-like aconitase in the bacterium Bacteroides fragilis: implications for the evolution of the mitochondrial Krebs cycle. Proc. Natl. Acad. Sci. USA 994662-4667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Begun, J., J. M. Gaiani, H. Rohde, D. Mack, S. B. Calderwood, F. M. Ausubel, and C. D. Sifri. 2007. Staphylococcal biofilm exopolysaccharide protects against Caenorhabditis elegans immune defenses. PLoS Pathog. 3e57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bischoff, M., P. Dunman, J. Kormanec, D. Macapagal, E. Murphy, W. Mounts, B. Berger-Bächi, and S. Projan. 2004. Microarray-based analysis of the Staphylococcus aureus σB regulon. J. Bacteriol. 1864085-4099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Brekasis, D., and M. S. Paget. 2003. A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3(2). EMBO J. 224856-4865. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Brückner, R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol. Lett. 1511-8. [DOI] [PubMed] [Google Scholar]
- 6.Chatterjee, I., G. A. Somerville, C. Heilmann, H. G. Sahl, H. H. Maurer, and M. Herrmann. 2006. Very low ethanol concentrations affect the viability and growth recovery in post-stationary-phase Staphylococcus aureus populations. Appl. Environ. Microbiol. 722627-2636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cho, S. H., K. Naber, J. Hacker, and W. Ziebuhr. 2002. Detection of the icaADBC gene cluster and biofilm formation in Staphylococcus epidermidis isolates from catheter-related urinary tract infections. Int. J. Antimicrob. Agents 19570-575. [DOI] [PubMed] [Google Scholar]
- 8.Collins, F. M., and J. Lascelles. 1962. The effect of growth conditions on oxidative and dehydrogenase activity in Staphylococcus aureus. J. Gen. Microbiol. 29531-535. [DOI] [PubMed] [Google Scholar]
- 9.Conlon, K. M., H. Humphreys, and J. P. O'Gara. 2002. icaR encodes a transcriptional repressor involved in environmental regulation of ica operon expression and biofilm formation in Staphylococcus epidermidis. J. Bacteriol. 1844400-4408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Conlon, K. M., H. Humphreys, and J. P. O'Gara. 2004. Inactivations of rsbU and sarA by IS256 represent novel mechanisms of biofilm phenotypic variation in Staphylococcus epidermidis. J. Bacteriol. 1866208-6219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Conlon, K. M., H. Humphreys, and J. P. O'Gara. 2002. Regulation of icaR gene expression in Staphylococcus epidermidis. FEMS Microbiol. Lett. 216171-177. [DOI] [PubMed] [Google Scholar]
- 12.Craig, J. E., M. J. Ford, D. C. Blaydon, and A. L. Sonenshein. 1997. A null mutation in the Bacillus subtilis aconitase gene causes a block in Spo0A-phosphate-dependent gene expression. J. Bacteriol. 1797351-7359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Cramton, S. E., M. Ulrich, F. Götz, and G. Döring. 2001. Anaerobic conditions induce expression of polysaccharide intercellular adhesin in Staphylococcus aureus and Staphylococcus epidermidis. Infect. Immun. 694079-4085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Cui, Q., I. A. Lewis, A. D. Hegeman, M. E. Anderson, J. Li, C. F. Schulte, W. M. Westler, H. R. Eghbalnia, M. R. Sussman, and J. L. Markley. 2008. Metabolite identification via the Madison Metabolomics Consortium Database. Nat. Biotechnol. 26162-164. [DOI] [PubMed] [Google Scholar]
- 15.Dean, B. A., R. E. Williams, F. Hall, and J. Corse. 1973. Phage typing of coagulase-negative staphylococci and micrococci. J. Hyg. (London) 71261-270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Deighton, M., and R. Borland. 1993. Regulation of slime production in Staphylococcus epidermidis by iron limitation. Infect. Immun. 614473-4479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Delaglio, F., S. Grzesiek, G. W. Vuister, G. Zhu, J. Pfeifer, and A. Bax. 1995. NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR 6277-293. [DOI] [PubMed] [Google Scholar]
- 18.Dobinsky, S., K. Kiel, H. Rohde, K. Bartscht, J. K. Knobloch, M. A. Horstkotte, and D. Mack. 2003. Glucose-related dissociation between icaADBC transcription and biofilm expression by Staphylococcus epidermidis: evidence for an additional factor required for polysaccharide intercellular adhesin synthesis. J. Bacteriol. 1852879-2886. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Foster, T. J. 1998. Molecular genetic analysis of staphylococcal virulence. Methods Microbiol. 27433-454. [Google Scholar]
- 20.Garrett, D. S., R. Powers, A. M. Gronenborn, and G. M. Clore. 1991. A common sense approach to peak picking in two-, three-, and four-dimensional spectra using automatic computer analysis of contour diagrams. J. Magn. Reson. 95214-220. [DOI] [PubMed] [Google Scholar]
- 21.Gaudu, P., G. Lamberet, S. Poncet, and A. Gruss. 2003. CcpA regulation of aerobic and respiration growth in Lactococcus lactis. Mol. Microbiol. 50183-192. [DOI] [PubMed] [Google Scholar]
- 22.Götz, F. 2002. Staphylococcus and biofilms. Mol. Microbiol. 431367-1378. [DOI] [PubMed] [Google Scholar]
- 23.Gracia, E., A. Fernández, P. Conchello, J. L. Alabart, M. Pérez, and B. Amorena. 1999. In vitro development of Staphylococcus aureus biofilms using slime-producing variants and ATP-bioluminescence for automated bacterial quantification. Luminescence 1423-31. [DOI] [PubMed] [Google Scholar]
- 24.Greene, C., D. McDevitt, P. Francois, P. E. Vaudaux, D. P. Lew, and T. J. Foster. 1995. Adhesion properties of mutants of Staphylococcus aureus defective in fibronectin-binding proteins and studies on the expression of fnb genes. Mol. Microbiol. 171143-1152. [DOI] [PubMed] [Google Scholar]
- 25.Guédon, E., P. Serror, S. D. Ehrlich, P. Renault, and C. Delorme. 2001. Pleiotropic transcriptional repressor CodY senses the intracellular pool of branched-chain amino acids in Lactococcus lactis. Mol. Microbiol. 401227-1239. [DOI] [PubMed] [Google Scholar]
- 26.Handke, L. D., S. R. Slater, K. M. Conlon, S. T. O'Donnell, M. E. Olson, K. A. Bryant, M. E. Rupp, J. P. O'Gara, and P. D. Fey. 2007. SigmaB and SarA independently regulate polysaccharide intercellular adhesin production in Staphylococcus epidermidis. Can. J. Microbiol. 5382-91. [DOI] [PubMed] [Google Scholar]
- 27.Heilmann, C., O. Schweitzer, C. Gerke, N. Vanittanakom, D. Mack, and F. Götz. 1996. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 201083-1091. [DOI] [PubMed] [Google Scholar]
- 28.Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacI and galR repressors. Mol. Microbiol. 5575-584. [DOI] [PubMed] [Google Scholar]
- 29.Jeng, W. Y., T. P. Ko, C. I. Liu, R. T. Guo, C. L. Liu, H. L. Shr, and A. H. Wang. 2008. Crystal structure of IcaR, a repressor of the TetR family implicated in biofilm formation in Staphylococcus epidermidis. Nucleic Acids Res. 361567-1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Jourlin-Castelli, C., N. Mani, M. M. Nakano, and A. L. Sonenshein. 2000. CcpC, a novel regulator of the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J. Mol. Biol. 295865-878. [DOI] [PubMed] [Google Scholar]
- 31.Kanehisa, M., M. Araki, S. Goto, M. Hattori, M. Hirakawa, M. Itoh, T. Katayama, S. Kawashima, S. Okuda, T. Tokimatsu, and Y. Yamanishi. 2008. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 36D480-484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Karp, P. D., C. A. Ouzounis, C. Moore-Kochlacs, L. Goldovsky, P. Kaipa, D. Ahren, S. Tsoka, N. Darzentas, V. Kunin, and N. Lopez-Bigas. 2005. Expansion of the BioCyc collection of pathway/genome databases to 160 genomes. Nucleic Acids Res. 336083-6089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kim, H. J., A. Roux, and A. L. Sonenshein. 2002. Direct and indirect roles of CcpA in regulation of Bacillus subtilis Krebs cycle genes. Mol. Microbiol. 45179-190. [DOI] [PubMed] [Google Scholar]
- 34.Knobloch, J. K., K. Bartscht, A. Sabottke, H. Rohde, H. H. Feucht, and D. Mack. 2001. Biofilm formation by Staphylococcus epidermidis depends on functional RsbU, an activator of the sigB operon: differential activation mechanisms due to ethanol and salt stress. J. Bacteriol. 1832624-2633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Knobloch, J. K., S. Jager, M. A. Horstkotte, H. Rohde, and D. Mack. 2004. RsbU-dependent regulation of Staphylococcus epidermidis biofilm formation is mediated via the alternative sigma factor σB by repression of the negative regulator gene icaR. Infect. Immun. 723838-3848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kohanski, M. A., D. J. Dwyer, B. Hayete, C. A. Lawrence, and J. J. Collins. 2007. A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130797-810. [DOI] [PubMed] [Google Scholar]
- 37.Kornmann, H., P. Duboc, P. Niederberger, I. Marison, and U. von Stockar. 2003. Influence of residual ethanol concentration on the growth of Gluconacetobacter xylinus I 2281. Appl. Microbiol. Biotechnol. 62168-173. [DOI] [PubMed] [Google Scholar]
- 38.Kozitskaya, S., S. H. Cho, K. Dietrich, R. Marre, K. Naber, and W. Ziebuhr. 2004. The bacterial insertion sequence element IS256 occurs preferentially in nosocomial Staphylococcus epidermidis isolates: association with biofilm formation and resistance to aminoglycosides. Infect. Immun. 721210-1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lamb, H. K., K. Leslie, A. L. Dodds, M. Nutley, A. Cooper, C. Johnson, P. Thompson, D. K. Stammers, and A. R. Hawkins. 2003. The negative transcriptional regulator NmrA discriminates between oxidized and reduced dinucleotides. J. Biol. Chem. 27832107-32114. [DOI] [PubMed] [Google Scholar]
- 40.Lauble, H., M. C. Kennedy, M. H. Emptage, H. Beinert, and C. D. Stout. 1996. The reaction of fluorocitrate with aconitase and the crystal structure of the enzyme-inhibitor complex. Proc. Natl. Acad. Sci. USA 9313699-13703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lowry, O. H., N. J. Rosebrough, L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193267-275. [PubMed] [Google Scholar]
- 42.Mack, D., W. Fischer, A. Krokotsch, K. Leopold, R. Hartmann, H. Egge, and R. Laufs. 1996. The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis is a linear beta-1,6-linked glucosaminoglycan: purification and structural analysis. J. Bacteriol. 178175-183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Mack, D., N. Siemssen, and R. Laufs. 1992. Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis: evidence for functional relation to intercellular adhesion. Infect. Immun. 602048-2057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Maira-Litrán, T., A. Kropec, C. Abeygunawardana, J. Joyce, G. Mark III, D. A. Goldmann, and G. B. Pier. 2002. Immunochemical properties of the staphylococcal poly-N-acetylglucosamine surface polysaccharide. Infect. Immun. 704433-4440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Majerczyk, C. D., M. R. Sadykov, T. T. Luong, C. Lee, G. A. Somerville, and A. L. Sonenshein. 2008. Staphylococcus aureus CodY negatively regulates virulence gene expression. J. Bacteriol. 1902257-2265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.McCombie, H., and B. C. Saunders. 1946. Fluoroacetates and allied compounds. Nature 158382-385. [Google Scholar]
- 47.Mekalanos, J. J. 1992. Environmental signals controlling expression of virulence determinants in bacteria. J. Bacteriol. 1741-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.National Nosocomial Infections Surveillance. 2004. National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. Am. J. Infect. Control 32470-485. [DOI] [PubMed] [Google Scholar]
- 49.Novick, R. P. 1991. Genetic systems in staphylococci. Methods Enzymol. 204587-636. [DOI] [PubMed] [Google Scholar]
- 50.Olson, M. E., K. L. Garvin, P. D. Fey, and M. E. Rupp. 2006. Adherence of Staphylococcus epidermidis to biomaterials is augmented by PIA. Clin. Orthop. Relat. Res. 45121-24. [DOI] [PubMed] [Google Scholar]
- 51.Projan, S. J., and G. L. Archer. 1989. Mobilization of the relaxable Staphylococcus aureus plasmid pC221 by the conjugative plasmid pGO1 involves three pC221 loci. J. Bacteriol. 1711841-1845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Rachid, S., K. Ohlsen, U. Wallner, J. Hacker, M. Hecker, and W. Ziebuhr. 2000. Alternative transcription factor σB is involved in regulation of biofilm expression in a Staphylococcus aureus mucosal isolate. J. Bacteriol. 1826824-6826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Rachid, S., K. Ohlsen, W. Witte, J. Hacker, and W. Ziebuhr. 2000. Effect of subinhibitory antibiotic concentrations on polysaccharide intercellular adhesin expression in biofilm-forming Staphylococcus epidermidis. Antimicrob. Agents Chemother. 443357-3363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Ratnayake-Lecamwasam, M., P. Serror, K. W. Wong, and A. L. Sonenshein. 2001. Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes Dev. 151093-1103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Rupp, M. E. 1997. Infections of intravascular catheters and vascular devices, p. 379-399. In K. B. Crossley and G. L. Archer (ed.), The staphylococci in human disease. Churchill-Livingstone, New York, NY.
- 56.Rupp, M. E., J. S. Ulphani, P. D. Fey, K. Bartscht, and D. Mack. 1999. Characterization of the importance of polysaccharide intercellular adhesin/hemagglutinin of Staphylococcus epidermidis in the pathogenesis of biomaterial-based infection in a mouse foreign body infection model. Infect. Immun. 672627-2632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Rupp, M. E., J. S. Ulphani, P. D. Fey, and D. Mack. 1999. Characterization of Staphylococcus epidermidis polysaccharide intercellular adhesin/hemagglutinin in the pathogenesis of intravascular catheter-associated infection in a rat model. Infect. Immun. 672656-2659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 59.Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 73133-138. [DOI] [PubMed] [Google Scholar]
- 60.Seidl, K., C. Goerke, C. Wolz, D. Mack, B. Berger-Bächi, and M. Bischoff. 2008. Staphylococcus aureus CcpA affects biofilm formation. Infect. Immun. 762044-2050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Shivers, R. P., and A. L. Sonenshein. 2004. Activation of the Bacillus subtilis global regulator CodY by direct interaction with branched-chain amino acids. Mol. Microbiol. 53599-611. [DOI] [PubMed] [Google Scholar]
- 62.Somerville, G., C. A. Mikoryak, and L. Reitzer. 1999. Physiological characterization of Pseudomonas aeruginosa during exotoxin A synthesis: glutamate, iron limitation, and aconitase activity. J. Bacteriol. 1811072-1078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Somerville, G. A., S. B. Beres, J. R. Fitzgerald, F. R. DeLeo, R. L. Cole, J. S. Hoff, and J. M. Musser. 2002. In vitro serial passage of Staphylococcus aureus: changes in physiology, virulence factor production, and agr nucleotide sequence. J. Bacteriol. 1841430-1437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Somerville, G. A., M. S. Chaussee, C. I. Morgan, J. R. Fitzgerald, D. W. Dorward, L. J. Reitzer, and J. M. Musser. 2002. Staphylococcus aureus aconitase inactivation unexpectedly inhibits post-exponential-phase growth and enhances stationary-phase survival. Infect. Immun. 706373-6382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Somerville, G. A., B. Saïd-Salim, J. M. Wickman, S. J. Raffel, B. N. Kreiswirth, and J. M. Musser. 2003. Correlation of acetate catabolism and growth yield in Staphylococcus aureus: implications for host-pathogen interactions. Infect. Immun. 714724-4732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Sonenshein, A. L. 2005. CodY, a global regulator of stationary phase and virulence in Gram-positive bacteria. Curr. Opin. Microbiol. 8203-207. [DOI] [PubMed] [Google Scholar]
- 67.Sonenshein, A. L. 2007. Control of key metabolic intersections in Bacillus subtilis. Nat. Rev. Microbiol. 5917-927. [DOI] [PubMed] [Google Scholar]
- 68.Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98503-517. [DOI] [PubMed] [Google Scholar]
- 69.Stephenson, K., and J. A. Hoch. 2001. PAS-A domain of phosphorelay sensor kinase A: a catalytic ATP-binding domain involved in the initiation of development in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 9815251-15256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Strasters, K. C., and K. C. Winkler. 1963. Carbohydrate metabolism of Staphylococcus aureus. J. Gen. Microbiol. 33213-229. [DOI] [PubMed] [Google Scholar]
- 71.Throup, J. P., F. Zappacosta, R. D. Lunsford, R. S. Annan, S. A. Carr, J. T. Lonsdale, A. P. Bryant, D. McDevitt, M. Rosenberg, and M. K. Burnham. 2001. The srhSR gene pair from Staphylococcus aureus: genomic and proteomic approaches to the identification and characterization of gene function. Biochemistry 4010392-10401. [DOI] [PubMed] [Google Scholar]
- 72.Tojo, S., T. Satomura, K. Morisaki, J. Deutscher, K. Hirooka, and Y. Fujita. 2005. Elaborate transcription regulation of the Bacillus subtilis ilv-leu operon involved in the biosynthesis of branched-chain amino acids through global regulators of CcpA, CodY and TnrA. Mol. Microbiol. 561560-1573. [DOI] [PubMed] [Google Scholar]
- 73.Tomlins, R. I., M. D. Pierson, and Z. J. Ordal. 1971. Effect of thermal injury on the TCA cycle enzymes of Staphylococcus aureus MF 31 and Salmonella typhimurium 7136. Can. J. Microbiol. 17759-765. [DOI] [PubMed] [Google Scholar]
- 74.Tormo, M. A., M. Martí, J. Valle, A. C. Manna, A. L. Cheung, I. Lasa, and J. R. Penadés. 2005. SarA is an essential positive regulator of Staphylococcus epidermidis biofilm development. J. Bacteriol. 1872348-2356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Tramonti, A., M. De Canio, I. Delany, V. Scarlato, and D. De Biase. 2006. Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli. J. Bacteriol. 1888118-8127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Varghese, S., Y. Tang, and J. A. Imlay. 2003. Contrasting sensitivities of Escherichia coli aconitases A and B to oxidation and iron depletion. J. Bacteriol. 185221-230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.von Eiff, C., G. Peters, and C. Heilmann. 2002. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect. Dis. 2677-685. [DOI] [PubMed] [Google Scholar]
- 78.Vuong, C., J. B. Kidder, E. R. Jacobson, M. Otto, R. A. Proctor, and G. A. Somerville. 2005. Staphylococcus epidermidis polysaccharide intercellular adhesin production significantly increases during tricarboxylic acid cycle stress. J. Bacteriol. 1872967-2973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Vuong, C., S. Kocianova, J. M. Voyich, Y. Yao, E. R. Fischer, F. R. Deleo, and M. Otto. 2004. A crucial role for exopolysaccharide modification in bacterial biofilm formation, immune evasion, and virulence. J. Biol. Chem. 2454881-54886. [DOI] [PubMed] [Google Scholar]
- 80.Vuong, C., J. M. Voyich, E. R. Fischer, K. R. Braughton, A. R. Whitney, F. R. DeLeo, and M. Otto. 2004. Polysaccharide intercellular adhesin (PIA) protects Staphylococcus epidermidis against major components of the human innate immune system. Cell. Microbiol. 6269-275. [DOI] [PubMed] [Google Scholar]
- 81.Wu, S., H. de Lencastre, and A. Tomasz. 1996. Sigma-B, a putative operon encoding alternate sigma factor of Staphylococcus aureus RNA polymerase: molecular cloning and DNA sequencing. J. Bacteriol. 1786036-6042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Xu, L., H. Li, C. Vuong, V. Vadyvaloo, J. Wang, Y. Yao, M. Otto, and Q. Gao. 2006. Role of the luxS quorum-sensing system in biofilm formation and virulence of Staphylococcus epidermidis. Infect. Immun. 74488-496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33103-119. [DOI] [PubMed] [Google Scholar]
- 84.Ziebuhr, W., C. Heilmann, F. Götz, P. Meyer, K. Wilms, E. Straube, and J. Hacker. 1997. Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect. Immun. 65890-896. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.