Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Nov 21.
Published in final edited form as: Nature. 2001 Jul 19;412(6844):338–341. doi: 10.1038/35085583

An open form of syntaxin bypasses the requirement for UNC-13 in vesicle priming

Janet E Richmond 1,*, Robby M Weimer 1,*, Erik M Jorgensen 1
PMCID: PMC2585764  NIHMSID: NIHMS77233  PMID: 11460165

Abstract

The priming step of synaptic vesicle exocytosis is thought to require the formation of the SNARE complex, which comprises the proteins synaptobrevin, SNAP-25 and syntaxin1–3. In solution syntaxin adopts a default, closed configuration that is incompatible with formation of the SNARE complex4. Specifically, the amino terminus of syntaxin binds the SNARE motif and occludes interactions with the other SNARE proteins. The N terminus of syntaxin also binds the presynaptic protein UNC-13 (ref. 5). Studies in mouse, Drosophila and Caenorhabditis elegans suggest that UNC-13 functions at a post-docking step of exocytosis, most likely during synaptic vesicle priming6–8. Therefore, UNC-13 binding to the N terminus of syntaxin may promote the open configuration of syntaxin9. To test this model, we engineered mutations into C. elegans syntaxin that cause the protein to adopt the open configuration constitutively4. Here we demonstrate that the open form of syntaxin can bypass the requirement for UNC-13 in synaptic vesicle priming. Thus, it is likely that UNC-13 primes synaptic vesicles for fusion by promoting the open configuration of syntaxin.


Using NMR spectroscopy, it has been shown that syntaxin adopts a closed configuration in solution4. However, mutations in two highly conserved amino acids (L165A, E166A) cause syntaxin to adopt a constitutively open configuration in vitro4. We made the corresponding mutations in C. elegans syntaxin (L166A, E167A; open syntaxin). Similar to vertebrate open syntaxin, the mutated C. elegans protein can bind synaptobrevin but not UNC-18 in pull-down assays (data not shown).

Expression of open syntaxin can fully rescue null mutations of syntaxin. unc-64(js115) is a null allele of the gene encoding C. elegans syntaxin10. Homozygotes of unc-64(js115) are completely paralysed and arrest development after hatching (Fig. 1a). This developmental defect was fully rescued by expression of wild-type syntaxin or the open form of syntaxin in null mutants (Fig. 1a). Expression of either form of syntaxin rescued the behavioural phenotypes associated with unc-64(js115) (Fig. 1b). Furthermore, expression of open syntaxin did not affect neuronal development (data not shown).

Figure 1.

Figure 1

Expression of the constitutively open form of syntaxin rescued the syntaxin null unc-64(js115). a, Transformation with either wild-type syntaxin (+) or open syntaxin (open) restored viability to unc-64(js115). b, Behavioural phenotypes of unc-64(js115) animals overexpressing either wild-type syntaxin or open syntaxin are comparable to wild-type animals. Strains overexpressing either form of syntaxin are slightly sluggish on plates, as reflected in significantly lower thrashing rates (P < 0.002). This behavioural deficit is a consequence of syntaxin overexpression and not incomplete rescue, as animals that are wild type for unc-64 overexpressing either open syntaxin or wild-type syntaxin have the same phenotype (data not shown). aboc, anterior body contraction; pboc, posterior body contraction; emc, enteric muscle contraction. c, Endogenous release rates in 5 mM Ca2+ saline were restored to wild-type levels (P > 0.05) in both unc-64; syntaxin(+) and unc-64; syntaxin(open) animals. d, Depolarization of the ventral nerve cord elicited large evoked post-synaptic currents not significantly different from the wild type (P > 0.05) in both unc-64; syntaxin(+) and unc-64; syntaxin(open) animals. In all figures: left, recordings in 5 mM Ca2+ plotted as mean ± s.e.m.; right, sample traces.

To test if open syntaxin could restore synaptic vesicle fusion we quantified whole-cell voltage-clamp currents recorded from the neuromuscular junctions of dissected nematodes11. The frequency of endogenous synaptic events in transgenic animals overexpressing wild-type syntaxin or open syntaxin were comparable (P > 0.05) to those in wild-type animals (Fig. 1c). In addition, stimulation of the presynaptic nerve cord in animals expressing wild-type or open syntaxin resulted in evoked release amplitudes that were not significantly different (P > 0.05) from those of wild-type animals (Fig. 1d). These data demonstrate that open syntaxin can substitute for wild-type syntaxin in basal synaptic transmission.

It was possible that these mutations in syntaxin created a gain-of-function protein that executes vesicle fusion independent of normal synaptic mechanisms. To demonstrate that open syntaxin functioned by means of the normal mechanisms of exocytosis, we confirmed that open syntaxin mediates exocytosis through the SNARE complex and requires calcium influx. We made a double mutant with open syntaxin and the synaptobrevin null allele snb-1 (js124)12. The larval lethality of snb-1(js124) was not rescued by open syntaxin (n = 25). To determine if open syntaxin could bypass the requirement of the N-type calcium channel UNC-2, we generated double mutants with unc-2(e55)13. Similarly, open syntaxin did not suppress the behavioural and neurotransmission defects associated with unc-2 mutants (Fig. 2). These data demonstrate that open syntaxin functions through the normal synaptic machinery and validates it as a reagent to test the function of UNC-13.

Figure 2.

Figure 2

Open syntaxin failed to rescue mutants of the alpha subunit of the N-type voltage-gated calcium channel, UNC-2. a, The loss-of-function allele unc-2(e55) results in an uncoordinated locomotory phenotype. Expression of either syntaxin(+) or syntaxin(open) failed to restore locomotion to unc-2(e55) animals. b, Behavioural phenotypes associated with unc-2 are not suppressed by the overexpression of syntaxin(+) or syntaxin(open). c, Loss of the UNC-2 calcium channel results in a significant decrease in endogenous fusion events in 5 mM Ca2+compared with the wild type (P < 0.005). Overexpression of syntaxin(+) or syntaxin(open) failed to restore wild-type, calcium-dependent endogenous currents in unc-2 animals (P < 0.05). d, Loss of UNC-2 function results in a significant decrease in calcium-dependent evoked response compared with the wild type (P < 0.002). Overexpression of wild-type or open syntaxin failed to rescue the evoked response in unc-2 animals (P < 0.0001).

Electrophysiological studies in mouse, Drosophila and C. elegans indicate that UNC-13 is probably required to prime synaptic vesicles for exocytosis6–8. Because UNC-13 binds the N terminus of syntaxin5, it has been suggested that UNC-13 might promote the open state of syntaxin to enable vesicle priming9. If this model were correct then expression of open syntaxin should bypass the requirement of UNC-13 in synaptic vesicle exocytosis. To test this model we expressed the constitutively open form of syntaxin in unc-13(s69) animals. unc-13(s69) is a frameshift mutation before the highly conserved carboxy terminus of UNC-13 (ref. 14) and causes an almost complete paralysis in mutant nematodes (Fig. 3a).

Figure 3.

Figure 3

The open form of syntaxin rescues the unc-13(s69) mutant. a, Overexpression of open syntaxin, but not wild-type syntaxin, partially suppresses unc-13 paralysis. b, Expression of the open form of syntaxin significantly suppresses the body thrashing (P < 0.0005), pharyngeal pumping (p < 0.0001) and the defecation defects (P < 0.0001) associated with unc-13(s69). c, Synaptic vesicle fusion can occur in the absence of UNC-13. The average spontaneous event frequency in 0 mM Ca2+of unc-13(s69); syntaxin(open) animals was not significantly different (P > 0.8) from that of the wild type. d, Expression of open syntaxin partially restores endogenous vesicle fusion events in unc-13(s69) animals. The endogenous event frequency recorded in 5 mM Ca2+ was significantly greater in unc-13(s69); syntaxin(open) than in both unc-13(s69) (P < 0.005) or unc-13(s69); syntaxin animals (P < 0.0005), but significantly lower than wild-type levels (P < 0.0001). e, Open syntaxin rescues calcium-dependent evoked responses in 5 mM Ca2+ in the unc-13(s69) mutant. Ventral cord stimulation elicited robust currents at the neuromuscular junctions of unc-13(s69); syntaxin(open) animals similar to those in the wild type. The average amplitude of the evoked responses in unc-13(s69); syntaxin(open) animals was not statistically different (P > 0.05) from that of wild-type animals.

Overexpression of wild-type syntaxin failed to rescue any of the unc-13(s69) behavioural phenotypes including locomotory movements, pharyngeal pumping and defecation cycles (Fig. 3a, b). However, overexpression of open syntaxin in unc-13(s69) animals caused a significant (P < 0.0001) improvement in all three behaviours (Fig. 3a, b). The suppression of the unc-13 behavioural phenotypes suggested that open syntaxin was able to bypass the requirement for UNC-13 in synaptic transmission.

As almost no synaptic vesicle fusion is observed in unc-13(s69) animals, previous studies could not exclude UNC-13 from having a function in membrane fusion6–8. If UNC-13 mediates fusion of the vesicular and plasma membranes, then open syntaxin should not be able to bypass this requirement for UNC-13 in fusion. To directly assay whether synaptic vesicles can fuse with the plasma membrane in the absence of UNC-13, we recorded spontaneous, miniature postsynaptic currents in the absence of calcium. In unc-13(s69) animals there was essentially no synaptic vesicle fusion in 0 mM calcium (Fig. 3c). Overexpression of wild-type syntaxin did not rescue vesicle fusion in unc-13(s69) animals. However, overexpression of open syntaxin completely restored spontaneous fusion in unc-13(s69) animals to wild-type levels. These data demonstrate that UNC-13 is not required at the fusion step during exocytosis.

UNC-13 contains several C2 domains that are calcium-binding motifs14–16. The presence of these domains suggested that UNC-13 might be a calcium sensor for synaptic vesicle exocytosis. If UNC-13 were the sole calcium sensor, then in the absence of UNC-13 there should be no calcium-dependent release. Consistent with this hypothesis, unc-13(s69) mutants completely lack calcium-dependent evoked responses (Fig. 3e), and overexpression of wild-type syntaxin failed to rescue evoked release in the unc-13(s69) mutants. However, overexpression of open syntaxin completely restored evoked responses to wild-type levels (Fig. 3e). These normal responses to calcium in the absence of UNC-13 are consistent with the observation that overexpression of rat UNC-13 in chromaffin cells does not affect the calcium sensitivity of release17. Together, these data demonstrate that UNC-13 is not the calcium sensor that triggers fusion of synaptic vesicles. Previously we demonstrated that UNC-13 is essential for a post-docking step in synaptic vesicle exocytosis8. Similar results were obtained in null alleles of the Drosophila homologue, Dunc13 (ref. 7) and the mouse homologue, Munc13–1 (ref. 6). These studies concluded that UNC-13 probably has a role in priming of synaptic vesicles for fusion but they could not exclude a role for UNC-13 in either calcium sensing or in the fusion event itself. Our data demonstrate that UNC-13 is not required for calcium sensing or for fusion and strongly suggest a highly specific role for UNC-13 in the priming step of synaptic vesicle exocytosis.

Vesicles become fusion competent at the priming step of exocytosis. At the molecular level, priming is thought to be mediated by the formation of the SNARE complex1–3. Overexpression of Munc13–1 in bovine chromaffin cells accelerates the forward rate constant for the priming of morphologically docked, large dense-core vesicles without affecting the rate of fusion or the calcium sensitivity of release17. This stage of dense-core vesicle exocytosis coincides with the association of the SNARE proteins18. Although Munc13–1 levels are normally very low in chromaffin cells, these observations suggest that UNC-13 can function to promote dense-core vesicle priming, possibly by promoting formation of the SNARE complex. Our data confirm and extend these studies by demonstrating that UNC-13 promotes the priming of synaptic vesicles by acting through syntaxin. Specifically, the role of UNC-13 may be to bind the autoinhibitory domain of syntaxin to promote or maintain the open state and thus facilitate formation of the SNARE complex.

The rescue of the Unc-13 phenotype from no evoked responses to wild-type levels of evoked responses by open syntaxin is a dramatic result; however, these animals are not completely wild type. First, body thrashing and locomotory activity of the mutant is greatly reduced compared with the wild type (Fig. 3b). Second, measures of endogenous release of synaptic vesicles in the presence of calcium is also greatly reduced compared with the wild type (Fig. 3d). There are several possible explanations for these results. One potential explanation is that the L166A and E167A mutations do not completely mimic the conformation of syntaxin when it is bound to UNC-13. Alternatively, UNC-13 may have an additional role in vesicle exocytosis, possibly to tether synaptic vesicles near calcium channels. Nevertheless, these data suggest that UNC-13 stimulates priming by opening syntaxin either through the direct interaction previously demonstrated or by acting on another protein, such as UNC-18.

Methods

Genetics

We grew strains on nematode growth media (NGM)19. The wild-type strain is N2 Bristol. The unc-13(s69) allele is a putative null and contains a 5-base-pair deletion, which creates a frameshift at residue 1,029 (ref. 14). The syntaxin unc-64(js115) allele contains a nonsense mutation at codon 71 (ref. 10). In all cases the syntaxin(+) strain is EG1986 unc-64 (js115); oxIs33[unc-64(+); Punc-122::GFP] I. The syntaxin(open) strain is EG1985 unc-64 (js115) oxIs34[unc-64(L166A/E167A); Pmyo-2::GFP] III. We generated the syntaxin(+) strain by microinjecting pTX21, a subclone of the unc-64 locus10, into the germline of NM979 hermaphrodites (genotype: unc-64(js115)/bli-5(e518)) along with plasmid pPD97/98(Punc-122::GFP)20 as a dominant co-injection marker. Green fluorescent protein (GFP+) transgenic progeny were assayed for rescue of unc-64(js115) segregants. Three out of three lines carrying pTX21 were fully rescued. Stably transmitted rescuing arrays were integrated into the genome by X-ray irradiation. The syntaxin(open) strain was generated in a similar fashion by microinjecting pJR04, a variant of pTX21 containing the corresponding L166A/E167A mutations in the unc-64 coding region, along with plasmid pPD118.33 (Pmyo-2::GFP) (1997 Fire vector kit) as the dominant co-injection marker. Two out of two lines carrying pJR04 were fully rescued. The unc-13(s69); syntaxin(+) strain is EG1983 unc-13(s69) oxIs33; unc-64(js115). The unc-13(s69); syntaxin(open) strain is EG1984 unc-13(s69); unc-64(js115) oxIs34. The snb-1 null allele is js124 (ref. 12) and the unc-2 loss-of-function allele is e55 (ref. 19).

Molecular biology

Plasmid pJR04: unc-64(L166A/E167A) was generated from pTX21 using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) and oligonucleotides oJR005 and oJR006. The sequence of pJR04 was confirmed using an Applied Biosystems automated DNA sequencer at the Sequencing Core Facility (University of Utah). Sequence of oligonucleotides: oJR005, ggagatgaggatgcggccgaaatgattgagagcgg; oJR006, ccgctctcaatcattt cggccgcatcctcatctcc.

Behavioural assays

Body thrashing, pharyngeal pumping in the presence of food and the defecation cycle were assayed as described21,22. Overexpression of wild-type or open syntaxin in unc-64(js115) resulted in sluggish animals. This subtle phenotype was also observed in unc-64(+) strains overexpressing either wild-type or open syntaxin. Therefore, sluggish movement is due to syntaxin overexpression rather than incomplete rescue. Furthermore, several transgenic arrays and many integrants showed similar behaviours, thus the behavioural defects are not due to the specific composition of the array or the site of integration (data not shown).

Electrophysiology and worm dissection

We performed electrophysiological methods as described8,11. Briefly, animals were immobilized with a cyanoacrylic glue and a lateral incision was made to expose the ventral medial body wall muscles. Electrophysiological recordings from muscles were made in the whole-cell voltage-clamp configuration (holding potential −60 mV) at room temperature (21 °C) using an EPC-9 patch-clamp amplifier (HEKA) and digitized at 2.9 kHz through an ITC-16 interface (Instrutech). Data were acquired by Pulse software (HEKA) run on a Power Mac 6500/225. The bath solution contained 150 mM NaCl, 5 mM KCl, 5 mM CaCl2, 1 mM MgCl2, 10 mM glucose and 15 mM HEPES, pH 7.35, sucrose to ~330 mosmol. The pipette solution contained: 120 mM KCl, 20 mM KOH, 4 mM MgCl2, 5 mM N-tris (hydroxymethyl)methyl-2- aminoethane-sulphonic acid, 0.25 mM CaCl2, 4 mM NaATP, 36 mM sucrose, 5 mM EGTA, pH 7.2, sucrose to 315 mosmol. Subsequent analysis and graphing were performed using Pulsefit (HEKA), Mini Analysis (Jaejin Software) and Igor Pro (Wavemetrics). All statistically derived values are given as mean ± s.e.m.

Acknowledgments

We thank M. Nonet for providing unc-64(js115), RAB-3 antibodies and the plasmid pTX21; R. Hosono for providing UNC-18 antibodies; A. Rose for providing the unc-13(s69) allele; and P. Sengupta for the Punc-122::GFP plasmid. We also thank K. Broadie for critical review of this manuscript. This work was supported by NIH grants to J.E.R. and E.M.J.

References

  • 1.Sollner T, et al. SNAP receptors implicated in vesicle targeting and fusion. Nature. 1993;362:318–324. doi: 10.1038/362318a0. [DOI] [PubMed] [Google Scholar]
  • 2.Broadie K, et al. Syntaxin and synaptobrevin function downstream of vesicle docking in Drosophila. Neuron. 1995;1:5, 663–673. doi: 10.1016/0896-6273(95)90154-x. [DOI] [PubMed] [Google Scholar]
  • 3.Hanson PI, Roth R, Morisaki H, Jahn R, Heuser JE. Structure and conformational changes in NSF and its membrane receptor complexes visualized by quick-freeze/deep-etch electron microscopy. Cell. 1997;90:523–535. doi: 10.1016/s0092-8674(00)80512-7. [DOI] [PubMed] [Google Scholar]
  • 4.Dulubova I, et al. A conformational switch in syntaxin during exocytosis: role of munc18. EMBO J. 1999;18:4372–4382. doi: 10.1093/emboj/18.16.4372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Betz A, Okamoto M, Benseler F, Brose N. Direct interaction of the rat unc-13 homologue Munc13-1 with the N terminus of syntaxin. J Biol Chem. 1997;272:2520–2526. doi: 10.1074/jbc.272.4.2520. [DOI] [PubMed] [Google Scholar]
  • 6.Augustin I, Rosenmund C, Sudhof TC, Brose N. Munc 13 1 is essential for fusion competence of glutamatergic synaptic vesicles. Nature. 1999;400:457–461. doi: 10.1038/22768. [DOI] [PubMed] [Google Scholar]
  • 7.Aravamudan B, Fergestad T, Davis WS, Rodesch CK. Broadie, K. Drosophila Unc-13 is essential for synaptic transmission. Nature Neurosci. 1999;2:965–971. doi: 10.1038/14764. [DOI] [PubMed] [Google Scholar]
  • 8.Richmond JE, Davis WS, Jorgensen EM. UNC-13 is required for synaptic vesicle fusion in C elegans. Nature Neurosci. 1999;2:959–964. doi: 10.1038/14755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Brose N, Rosenmund C, Rettig J. Regulation of transmitter release by Unc-13 and its homologues. Curr Opin Neurobiol. 2000;10:303–311. doi: 10.1016/s0959-4388(00)00105-7. [DOI] [PubMed] [Google Scholar]
  • 10.Saifee O, Wei L, Nonet ML. The Caenorhabditis elegans unc-64 locus encodes a syntaxin that interacts genetically with synaptobrevin. Mol Biol Cell. 1998;9:1235–1252. doi: 10.1091/mbc.9.6.1235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Richmond JE, Jorgensen EM. One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nature Neurosci. 1999;2:791–797. doi: 10.1038/12160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Nonet ML, Saifee O, Zhao H, Rand JB, Wei L. Synaptic transmission deficits in Caenorhabditis elegans synaptobrevin mutants. J Neurosci. 1998;18:70–80. doi: 10.1523/JNEUROSCI.18-01-00070.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schafer WR, Kenyon CJ. A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans. Nature. 1995;37:5, 73–78. doi: 10.1038/375073a0. [DOI] [PubMed] [Google Scholar]
  • 14.Kohn RE, et al. Expression of multiple UNC-13 proteins in the C. elegans nervous system. Mol Biol Cell. 2000;11:3441–3452. doi: 10.1091/mbc.11.10.3441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Maruyama IN, Brenner S. A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans. Proc Natl Acad Sci USA. 1991;88:5729–5733. doi: 10.1073/pnas.88.13.5729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Brose N, Hofmann K, Hata Y, Sudhof TC. Mammalian homologues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins. J Biol Chem. 1995;270:25273–2580. doi: 10.1074/jbc.270.42.25273. [DOI] [PubMed] [Google Scholar]
  • 17.Ashery U, et al. Munc13-1 acts as a priming factor for large dense-core vesicles in bovine chromaffin cells. EMBO J. 2000;19:3586–3596. doi: 10.1093/emboj/19.14.3586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Xu T, et al. Inhibition of SNARE complex assembly differentially affects kinetic components of exocytosis. Cell. 1999;99:713–722. doi: 10.1016/s0092-8674(00)81669-4. [DOI] [PubMed] [Google Scholar]
  • 19.Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;7:7, 71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Miyabayashi T, Palfreyman MT, Sluder AE, Slack F, Sengupta P. Expression and function of members of a divergent nuclear receptor family in Caenorhabditis elegans. Dev Biol. 1999;21:5, 314–331. doi: 10.1006/dbio.1999.9470. [DOI] [PubMed] [Google Scholar]
  • 21.Miller KG, et al. A genetic selection for Caenorhabditis elegans synaptic transmission mutants. Proc Natl Acad Sci USA. 1996;93:12593–12598. doi: 10.1073/pnas.93.22.12593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Thomas JH. Genetic analysis of defecation in Caenorhabditis elegans. Genetics. 1990;12:4, 855–872. doi: 10.1093/genetics/124.4.855. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES