Skip to main content
Neoplasia (New York, N.Y.) logoLink to Neoplasia (New York, N.Y.)
. 2008 Dec;10(12):1350–1361. doi: 10.1593/neo.08746

Senescence-Induced Alterations of Laminin Chain Expression Modulate Tumorigenicity of Prostate Cancer Cells1

Cynthia C T Sprenger *,†, Rolf H Drivdahl †,2, Lillie B Woodke †,‡, Daniel Eyman †, May J Reed †, William G Carter §, Stephen R Plymate †,‡
PMCID: PMC2586686  PMID: 19048114

Abstract

Prostate cancer is an age-associated epithelial cancer, and as such, it contributes significantly to the mortality of the elderly. Senescence is one possible mechanism by which the body defends itself against various epithelial cancers. Senescent cells alter the microenvironment, in part, through changes to the extracellular matrix. Laminins (LMs) are extracellular proteins important to both the structure and function of the microenvironment. Overexpression of the senescence-associated gene mac25 in human prostate cancer cells resulted in increased mRNA levels of the LM α4 and β2 chains compared to empty vector control cells. The purpose of this study was to examine the effects of these senescence-induced LM chains on tumorigenicity of prostate cancer cells. We created stable M12 human prostate cancer lines overexpressing either the LM α4 or β2 chain or both chains. Increased expression of either the LM α4 or β2 chain resulted in increased in vitro migration and in vivo tumorigenicity of those cells, whereas high expression of both chains led to decreased in vitro proliferation and in vivo tumorigenicity compared to M12 control cells. This study demonstrates that senescent prostate epithelial cells can alter the microenvironment and that these changes modulate progression of prostate cancer.

Introduction

Prostate cancer is the most common cancer and the second leading cause of illness and death for men older than 50 years in western countries [1,2]. Possible mechanisms for defense against epithelial cancers, such as prostate, include promotion of apoptosis in which the damaged cell dies or senescence in which the cell ceases to divide but remains metabolically active. An accumulation of mutations, which is believed to occur during the life span of an organism, is not sufficient to cause cancer [3]; instead, these initiated premalignant cells require a permissive microenvironment in which to progress [4,5]. The accrual of senescent cells as an organism ages may provide such an environment owing to secreted factors that compromise tissue structure and function. Studies examining the effects of senescent fibroblasts on the growth of premalignant epithelial cells demonstrated increased growth and tumorigenicity of those epithelial cells [6,7]. Senescence then acts to inhibit cancer formation in a younger organism, but over time, the accumulation of senescent cells alters the microenvironment to one that can promote the growth of epithelial cancers [5–8].

Although senescence of fibroblasts has been studied heavily, a paucity of studies on the senescence of epithelial cells has been completed [9–14]. After 30 doublings, cultured primary prostatic epithelial cells stain positive for senescence-associated (SA)-β-galactosidase [9] and exhibit increased protein levels of p16 and mac25 (IGFBP-7/IGFBP-rP1) [10–12]. Staining for SA-β-gal in various prostate tissues demonstrated the presence of senescent epithelial cells primarily in regions of benign prostatic hyperplasia and prostatic intraepithelial neoplasia but rarely in cancer [9,15]. However, reports of chemotherapeutic agents inducing a senescence-like state in cancer cells, including prostate cancer cells, imply that cancer cells are capable of undergoing senescence as well [16–18]. We have demonstrated that transfection of the senescence-associated gene mac25 into the M12 and LNCaP human prostate cancer cell lines resulted in increased senescence, decreased proliferation, a delay in G1, and decreased in vitro and in vivo tumorigenicity [19–21].

Senescent fibroblasts modify the microenvironment [7], but the occurrence of such alterations by senescent cancer cells has not been examined previously. Using cDNA microarrays, we found that senescent M12 and LNCaP prostate cancer cells have increased transcript levels of the laminin (LM) α4 and β2 chains, among other genes (unpublished data). Laminins are a major constituent of the extracellular matrix that link the ECM to cells through various cell surface receptors [22]. They are large, heterotrimeric, cruciform matrix glycoproteins composed of highly homologous α, β, and γ chains; specific LM isoform expression and posttranslational processing can directly influence cellular response to growth factors, intracellular signaling, cell proliferation, susceptibility to apoptosis, and migratory capacity [23]. In various cancers, including breast cancer, increased expression of the LM α4 and β1 chains is associated with increased tumorigenicity and angiogenesis [22,24,25]. In prostate cancer, changes in LM composition within the prostate tumor microenvironment have been associated with the progression of cancer [26]. Studies specifically examining alterations in LM expression during senescence have not been undertaken.

The purpose of this study was to examine the effects of senescenceinduced LM chains on the tumorigenicity of prostate cancer cells. We created stable M12 prostate cancer cell lines overexpressing either the LM α4 or β2 chains or both the LM α4 and β2 chains. We demonstrate that overexpression of either the LM α4 or β2 chains increased tumorigenicity of prostate cancer cells, whereas overexpression of both chains decreased tumorigenicity. Our investigation of the effects of senescence on behavior of cancer cells will provide insight into how current prostate cancer therapies influence cancer progression.

Methods

Reagents

Tissue culture media, additives, and antibiotics were purchased from GIBCO (Grand Island, NY). SYBR GREEN PCR Master Mix was from Applied Biosystems (Foster City, CA). The BCA protein assay kit was from Pierce Biological (Rockford, IL). Nitrocellulose and polyacrylamide gel electrophoresis (PAGE) reagents were purchased from BioRad Laboratories (Richmond, CA). Laminin antibodies used in Western immunoblot analyses were obtained from Santa Cruz Biologicals (Santa Cruz, CA), whereas LM and fibronectin antibodies used for immunofluorescent staining were produced at Fred Hutchinson Cancer Research Center (Seattle, WA). Fluorescent-conjugated secondary antibodies were purchased from Invitrogen (Hercules, CA). Horseradish peroxidase-linked anti-rabbit secondary antibody and enhanced chemiluminescence reagents were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). Restriction enzymes were obtained from Promega (Madison, WI). The pcDNA3.1 expression vector was purchased from Invitrogen.

Cell Culture

Primary prostate epithelial cells (PECs) were obtained from Dr. Beatrice Knudsen (Fred Hutchinson Cancer Research Center, Seattle, WA) and grown with keratinocyte growth medium supplemented with epidermal growth factor and bovine pituitary extract. The derivation of the M12 cell line has been previously described [27]. M12 and M12-LM cells were cultured in RPMI 1640 supplemented with 10 ng/ml epidermal growth factor, 0.1 mM dexamethasone, 5 µg/ml insulin, 5 µg/ml transferrin, 5 ng/ml selenium, fungizone, 50 µg/ml gentamicin, and 5% fetal calf serum at 37°C under 5% CO2. All of the cells used in these experiments were mycoplasma-free, as determined by the PCRMycoplasm TestKit (MD Biosciences, Zurich, Switzerland).

Vector Preparation

The mammalian expression vector pcDNA3.1 (Invitrogen) was used to prepare the LMα4 and β2 chain constructs, which expressed the LM cDNA from the constitutively active cytomegalovirus promoter. The 6.5-kb full-length LMα4 chain (LAMA4) cDNA was obtained from OriGene (Rockville, MD) in their nonselectable vector (pCMV6-XL4). We subcloned the LAMA4 cDNA as an EcoRI/HindIII fragment into pcDNA3.1Neo. The LMβ2 chain (LAMB2) cDNA was generated by polymerase chain reaction (PCR) with Pfu DNA polymerase (Promega) using the following primers:

  • LAMB2

    • forward: AGACCGTTCACCTCCCCTTATC

    • reverse: TTCAGTGCATAGGCAGACATGC

A 5.6-kb cDNA fragment containing the full-length coding sequence was ligated into the pcDNA3.1Hygro EcoRV site. Orientation of cDNA was determined by restriction digestion.

Transfection

Cell lines overexpressing the LMα4, β2, or both the α4 and β2 chains were produced by liposome-mediated transfection of the M12 human prostate cancer cell line using pFx-5 (Invitrogen) according to the manufacturer's instructions. Transfecting the M12 cells with pcDNA3.1 alone produced control cells. M12α4β2 cells were created sequentially, first by transfection and selection for LMα4 (800 µg/ml G418), then by transfection with the LAMB2 cDNA and selection for LMα4 (800 µg/ml G418) and LMβ2 (100 µg/ml hygromicin). Surviving transfected cells were maintained with either 400 µg/ml G418 (M12α4 cells), 400 µg/ml G418 plus 50 µg/ml hygromicin (M12α4β2 cells), or 50 µg/ml hygromicin (M12β2 cells). Total cell lysates and RNA were isolated and analyzed for expression of various LM chains, including the LMα4 and β2 chains (see the Western Immunoblot Analysis, Immunofluorescent Staining, and Real-time PCR subsections).

Real-time PCR

Total RNA was obtained from monolayer cell cultures using Qiagen RNeasy Plus (Valencia, CA); the optional on-column DNase digestion was used. RNA was converted to cDNA using SuperScript First-Strand Synthesis System according to the manufacturer's protocol with random primers (Invitrogen). Relative real-time PCR was then performed using an ABI 7900HT sequence detection system using SYBR GREEN PCR master mix (Applied Biosystems) as follows: stage 1: 50°C for 2 minutes; 95°C for 10 minutes; stage 2 (40–45 cycles): 95°C for 15 seconds; 60°C for 1 minute; 72°C at 20 seconds; stage 3 (dissociation curve): 95°C for 15 seconds; 60°C for 15 seconds; 95°C for 15 seconds. Polymerase chain reaction data were analyzed using Primer Express Software v2.0 (Applied Biosystems). Target mRNA levels were normalized against glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels. The following primer pairs were used:

  • LAMA3

    • forward: GACACCAATCTCACAACTCTCCG

    • reverse: ATGGGGACAGCAACCTTACTGG

  • LAMA4

    • forward: GCCGCTTGGTTTACATGTTT

    • reverse: AATGGGACCCTTGATTTTCC

  • LAMB1

    • forward: AAGGATTCCAACCAGCAGCC

    • reverse: TCATCGGTGTTTTCACAACGC

  • LAMB2

    • forward: CCCTGAGCCTGACAGACATAAATG

    • reverse: TGCTGAGGATGCTACCACCTTC

  • LAMB3

    • forward: TCAGAGGAAGAGGGAGCAGTTTG

    • reverse: GGTCAGGCAACGAAGACATCTC

  • LAMC1

    • forward: GAATCATCTAATCCTCGGGGTTG

    • reverse: TCAAGCACAAGGTCTTCGGCAG

  • LAMC2

    • forward: CAGGAGATTGTTATTCAGGGG

    • reverse: TGGGGTCCACATTGTTGTTGC

  • GAPDH

    • forward: GAAGGTGAAGGTCGGAGTC

    • reverse: GAAGATGGTGATGGGATTTC

Western Immunoblot Analysis

Total cell lysates were prepared by addition of cold lysis buffer (30 mM HEPES, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% Triton X-100) containing protease and phosphatase inhibitors (Protease and Phosphatase Inhibitor Cocktail II; Sigma, St. Louis, MO) to monolayer cultures. Conditioned medium was concentrated using Centricon YM-10 columns (Millipore, Billerica, MA). For both lysates and media, total protein concentration was determined with the BCA protein assay kit (Pierce Biological). Reducing sample buffer (Pierce Biological) was added to 25 µg of each sample. Samples were boiled for 5 minutes before running on 5% SDS-PAGE gels. Proteins were then transferred to nitrocellulose in buffer containing 15 mM Tris base, 120 mM glycine, and 5% methanol. Membranes were blocked with Tris-buffered saline (TBS is 20 mM Tris-HCl, pH 7.5, containing 0.15 M NaCl) plus 5% nonfat milk. Blots were incubated overnight at 4°C with appropriate antibodies in TBS/0.1% Tween 20/5% nonfat milk. Tris-buffered saline/0.3% Tween 20 was used for all washes. Blots were incubated for 1 hour at room temperature in horseradish peroxidase-linked secondary antibodies, diluted in TBS/0.1% Tween 20/ 5% nonfatmilk. Bands were detected using enhanced chemiluminescence reagents (ECL system) according to the manufacturer's protocol.

Immunoprecipitation

Serum-free medium was collected from cells after 24 hours. Five hundred microliters of medium was precleared with 1 µg of appropriate control IgG plus 20 µl of Protein A/G agarose beads (Pierce Biological) for 30 minutes at 4°C. The supernatant was transferred to a new tube and brought up to 1 ml with RPMI T&S. We added 2 µg of either LMα3 or LMγ2 chain antibody to each sample and incubated on a rotating carousel overnight at 4°C. After incubation, we washed the beads three times with 1x PBS and resuspended them in Laemmli sample buffer with β-mercaptoethanol. Samples were boiled for 5 minutes and then loaded onto 5% SDS-PAGE gels (see Western Immunoblot Analysis subsection).

Immunofluorescent Staining

Cells were plated onto sterile round microscope slides in 24-well plates and grown to 70% confluence. After washing with PBS, cells were fixed with a cold methanol/acetone mixture (1:1) for 1 minute, followed by two washes with PBS. Cells were blocked with heatdenatured BSA (0.2%) for 1 hour at room temperature. Primary antibodies [LMα4 (H-194), LMβ2 (H-300), LMα3 (D2-1 or C2-5), LMβ3 (A2′-2), LMγ2 (B46), LMβ1γ1 (R5922), and fibronectin (R790)] were diluted in heat-denatured BSA and incubated at room temperature for up to 3 hours. After PBS washes, fluorescentconjugated secondary antibodies (anti-rat 488, anti-mouse 488, and anti-rabbit 568) were added for 30 minutes at room temperature. After PBS washes, cellswere fixed again with2%formaldehyde for 10 minutes at room temperature. Cells were viewed and images acquired using a Zeiss fluorescence microscope with a Photometric SenSys cooled CCD digital camera (Roper Industries, Trenton, NJ). Images were analyzed with MetaMorph (Universal Imaging, Downington, PA) and ImageJ (rsbweb.nih.gov/ij/) software.

Cell Proliferation Assays

The rate of cellular proliferation in culture was measured by a colorimetric MTS assay, using the Cell Titer 96 AQueous kit from Promega. M12pc, M12α4, M12β2, M12α4β2, and M12mac25 cells were seeded in 96-well plates at 5000 cells per well in complete RPMI medium. Twenty-four hours later, medium was switched to RPMI minus growth factors and serum. After adding the tetrazolium salt/dye solution for the MTS assays, plates were incubated at 37°C for 2 hours. One 96-well plate was read per day for 5 days. Quantitation was accomplished by reading absorbance at 490 nm; day 1 measurements were used as a baseline. To validate MTS results by direct measurement of cell number, cells were plated in 24-well plates (104 cells per well) and grown for 96 hours as in the MTS assay; cell counts were performed every 24 hours using a hemocytometer, again with day 1 used as a baseline (data not shown). Both assays were repeated six times; results shown are the average of the six experiments.

Wounding Assays

Wounding assays were used to assess migration of the cells. M12pc, M12α4, M12β2, M12α4β2, and M12mac25 cells were plated in six-well plates with complete RPMI medium and grown to confluence. After rinsing the cells twice with PBS, the cell layer was scratched with a 10-µl pipette tip, and RPMI T&S medium was added. Wound width was measured at 0, 1, 3, 6, 9, 12, and 24 hours after wounding. Nine hours after wounding yielded the most significant differences in wound closure among the cell lines. Wounding assays were repeated three separate times; results shown are the average of the three experiments.

Tumor Formation In Vivo

Groups of 10 nude athymic male mice were injected subcutaneously with M12pc, M12α4, M12β2, M12α4β2, or M12mac25 cells (106 cells per mouse). Mice were maintained on a laboratory diet ad libitum and were monitored weekly for tumor formation and weight gain/loss for a duration of 6 weeks. If tumors were present, tumor volume was calculated using the formula: (l x w2)/2, where l is length and w is width of tumor. For comparing final tumor volumes at 6 weeks, statistical analyses using analysis of variance followed by Fisher's protected least significant difference (Fisher's PLSD) were performed. After 6 weeks, the mice were euthanized, and their tumors were removed and measured.

Tumor Analyses

Tumors were divided into thirds and treated as follows: (1) fixed in formalin, 1 hour, (2) frozen in optimal cutting temperature (OCT), or (3) digested with 0.1% collagenase (type I) and 50 µg/ml DNase (Worthington Biochemical Corp., Lakewood, NJ). Digested tumor cells were plated in RPMI complete medium plus selective antibiotics at 5% CO2, 37°C. Cell lysates, media, and RNA were prepared and analyzed by Western blot analysis or real-time PCR to confirm retention of LM expression. Fixed and frozen tumor sections were sliced (5 µm thick for formalin-fixed and 10 µm thick for frozen) on a cryostat and mounted on slides for immunohistochemistry. The presence of tumor vasculature was assessed on frozen tissue using a rat anti-mouse endothelial cell antigen (MECA; Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA). We used Masson's Trichrome staining on paraffin-embedded tumors to assess the amount of ECM, specifically collagen, present.

Results

Altered Expression of LM Chains in Senescent Prostate Cancer Cells

As mentioned earlier, senescent M12 and LNCaP prostate cancer cells had increased LMα4 and β2 chain transcripts on cDNA microarrays. To confirm increased expression in the senescent M12mac25 prostate cancer cell line, we used real-time PCR andWestern immunoblot analysis. mRNA and protein levels of the LMα4 and β2 chains were increased in the M12mac25 cells compared to the M12 empty vector (M12pc) cells (Figure 1, A and B). Because LM332 (α3β3γ2, formerly LM-5) is the predominant LM in prostate, we evaluated the levels of the component chains of LM332 in the M12 prostate cancer lines and compared them to levels found in PECs. We found that mRNA and protein levels of all three chains (α3, β3, and γ2) were decreased in both the nonsenescent M12pc and senescent M12mac25 cells compared to the PECs (Figure 1, A and B), mirroring the decrease in LM332 that has been reported to occur in vivo during prostate cancer progression [28].

Figure 1.

Figure 1

mRNA and protein levels for the various LM chains in prostate cells. (A) Real-time PCR for LM chains. RNA from PEC, M12 prostate cancer cells, and M12mac25 cells was converted to cDNA then amplified using primers for the various LM chains. No significant differences among cell lines were detected for the LMβ1 or γ1 chains. *P < .005, **P < .001, ***P < .0001 compared to M12 levels. (B) Western immunoblots against various LM chains. Whole cell lysates, which include cytoplasmic and ECM-deposited LM chains, were run on reducing SDS-PAGE gels, transferred to nitrocellulose, and blotted with antibodies against various LM chains. No differences in protein expression were seen for the LMβ1 and γ1 chains.

Construction of M12 LM α4, β2, and α4β2 Chain-Overexpressing Cells

To examine the role of senescence-induced LM chain expression in prostate cancer tumorigenesis, we created M12 prostate cancer cell lines stably overexpressing the LM α4 or β2 chains or both the α4 and β2 chains. Transfections were repeated three to four times with each construct to ensure consistency of characteristics. All of the transfected cells stably overexpressed both mRNA (Figure 2A) and protein (Figure 2B) of the selected LM chains. Like M12pc cells, high-expressing M12α4 populations were cuboidal (Figure 3), whereas the high-expressing M12β2 and M12α4β2 populations were a mix of cuboidal and elongated cells (Figure 3). The appearance of cell populations with an elongated morphology was intriguing because we have previously shown that M12 cells overexpressing the senescence-associated gene mac25 or the chondrogenesis-associated transcription factor SOX9 (which is up-regulated on arrays of senescent epithelial cells) [21,29] also displayed an elongated morphology and overexpressed both the LMα4 and β2 chain mRNA and protein [19,20,30].

Figure 2.

Figure 2

Relative mRNA and protein levels of LM chains in the various M12 LM cells compared to levels in the M12 control cells. (A) Laminin chain cycle numbers were normalized against GAPDH cycle numbers (ΔCt). M12 normalized cycle numbers were subtracted from the M12 LM cells (M12α4, M12α4β2, and M12β2) and M12mac25 cell numbers to yield ΔΔCt values. The following formula was used to derive relative quantitation values: RQ = 2 -ΔΔCt. Primary prostate epithelial cell levels are included to showrelative physiological levels of the LM α4 and β2 chains in primary prostate cells compared to the transfected levels in the various M12 LM cells. mRNA levels of the introduced laminin chains were significantly higher for the M12 LM cells compared to the control M12 cell (P < .0001). As with the M12 control cells, LM332 levels in the M12 LM cells remained significantly lower than in the PECs (P<.001; data not shown). (B) Western immunoblots for various LM chains. Either whole cell lysates or concentrated conditioned media were run on reducing SDS-PAGE gels. Heart, which expresses very high levels of the LMα4 chain, was used as a positive control. Murine heart was homogenized and lysed with the same lysis buffer as the M12 LM cells.

Figure 3.

Figure 3

Morphology of transfected cells. M12α4 cells were similar in appearance to the M12 control cells. The M12β2 and M12α4β2 cells were a mix of cuboidal and elongated cells.

Immunofluorescent Staining

Whereas immunofluorescent staining for various LMchains demonstrated patterns similar to those found in the Westerns, it also provided the opportunity to determine whether the cells deposited the various LM chains into the ECM. Sigle et al. [31] demonstrated that cell lines do not necessarily deposit the LMs they secrete; thus, it was important to determine which LM chains were being incorporated into the ECM. LM332 is classically laid down in a monolayer, which in vitro is described as exhibiting a rose petal pattern. Staining for the three LM chains found in LM332 showed some deposition of LM332 in a monolayer for the M12pc and M12 LM cells but not for the M12mac25 cells (Figure 4B). In addition, the M12α4β2 cells, and to a lesser degree the M12β2 cells, displayed a three-dimensional fibrillar staining pattern for the three chains comprising LM322 (Figure 4B). Staining for the LMβ2 chain demonstrated primarily cytoplasmic staining in the LMβ2-overexpressing cells (M12β2, M12α4β2, and M12mac25 cells), with occasional fibrillar staining (Figure 4, A and B). When the cells were removed before staining, faint staining for the LMβ2 chain could be detected in the ECM from LMβ2-overexpressing cells but not in ECM from M12pc or M12α4 cells (Figure 4B). We were not able to successfully use the commercial LMα4 chain antibody for staining of cells; however, when we removed the cells before staining the matrix, we detected faint staining of the LMα4 chain in the M12α4β2 and M12mac25 matrices (data not shown). The LMβ1 and γ1 chains stained similarly for all the M12 LM cell lines; these chains were located in both the cytoplasm and, to a lesser extent, the ECM (Figure 4, A and B). The punctate staining pattern seen for the LMα4 and β2 chains in the matrix of the M12mac25 cells was even more pronounced for the LMβ1 and γ1 matrix staining (Figure 4B), indicating that these LM chains are deposited in a different manner than LM332 in these prostate cancer cells.

Figure 4.

Figure 4

Immunofluorescent staining of various LM chains and fibronectin in the M12 LM cells. (A) Cells were fixed and stained for various LM chains or fibronectin. All three LM332 chains stained similarly; LMγ2 chain staining is shown. (B) Staining of matrix after cells were removed with 0.5% Triton X and 20 mM ammonium acetate. Removal of cells leaves a monolayer matrix and occasionally a three-dimensional matrix, as was the case for the M12α4β2 cells. Removal of cells provided a clearer picture as to what LM chains were being deposited in the ECM. Note the punctate staining pattern of fibronectin is similar to the pattern for the LMβ1γ1 and β2 matrix staining.

Altered expression of one ECM protein is often associated with changes in other ECM proteins. Expression of fibronectin (FN), a fibrillar ECM protein, has been shown to alter during senescence, aging, and cancer progression [29,32–34]. We found that the cell populations overexpressing the LMβ2 chain and displaying an elongated morphology had increased amounts of fibrillar staining for FN compared to the M12pc and M12α4 cells (Figure 4A). Staining of FN after removal of the cells yielded a pronounced punctate staining pattern for all the cells (Figure 4B).

Positive cytoplasmic staining of the various LMs occurred equally well in both cuboidal and elongated cells; however, the amount of three-dimensional matrix staining present correlated with the predominance of an elongated morphology. The cell populations containing the largest number of elongated cells were also the ones overexpressing the LMβ2 chain, suggesting that the higher protein levels of the LMβ2 chain seen in the M12β2 and the M12α4β2 cells may lead to altered three-dimensional deposition of matrix proteins, including LMs and fibronectin.

Association of the LMβ2 Chain with LM332

Dual staining with the LMβ2 chain antibody and LM332 antibodies demonstrated colocalization of these LM chains in the three-dimensional fibrillar matrix as well as in the monolayer matrix (Figure 5A). Likewise, immunoprecipitation of conditioned culture medium showed association of the LMα3 chain with the β3 and β2 chains in cells overexpressing the LMβ2 chain; M12mac25 cells were the exception because they produce very little of the LMα3 chain but do express the LMβ2 chain (Figure 5B). Immunoprecipitation with the LMγ2 chain also demonstrated an association with the LMβ2 chain (Figure 5C).

Figure 5.

Figure 5

Colocalization ofLMβ2 chain with LM332 chains. (A) Dual staining of matrix revealed colocalization of theLMβ2 chain with chains found in LM332 in both the three-dimensional matrix and the matrix monolayer. (B and C) Immunoprecipitations (IPs) using the LMα3 and LMγ2 antibodies followed by blotting with the LM β2 chain antibody demonstrated the presence of this chain in both LMα3 and LMγ2 IPs.

In Vitro Cellular Proliferation and Migration

To determine whether alterations in LMs affected proliferation, we performed MTS assays. Five days after plating, M12β2 cells had the highest proliferation rates followed by M12α4, M12α4β2, and M12mac25 cells (Figure 6A). Next, we used wounding assays to assess if altered LM production influenced cell migration. After wounding, cells redeposit matrix on which they migrate. All of the cells, except M12mac25, deposit similar amounts of LM332 but differ in their production of the LMα4 and β2 chains. Cells were wounded and then exposed to RPMI medium minus growth factors and serum. Wound closure was measured at early time points, such as 9 hours, which were representative of migration rather than proliferation. The M12α4 and M12β2 cells demonstrated a trend toward increased migration compared to the M12pc cells; further, these cells had significantly increased migration compared to the M12α4β2 and M12mac25 cells (P < .05; Figure 6B). After 24 hours, all the M12 LM cells had piled up along the original wound, whereas the M12pc cells had simply closed the gap, and the M12mac25 cells had failed to migrate into the wound (Figure 6C). Because both the M12α4β2 and M12mac25 cells proliferate poorly, these results suggest that the wound closure and the piling up of cells in the M12α4β2 cultures were caused by the increased migration of these cells.

Figure 6.

Figure 6

In vitro cellular proliferation and migration of the M12 LM cells compared to the M12 control cells. (A) Cellular proliferation was measured with the MTS assay, which correlated to cell number. *P < .01, **P < .001 compared to M12β2 cells. (B) To determine whether alterations to LM chain expression modulated the ability of the cells to migrate, we performed in vitro wounding assays as described in the Methods section. The greatest differences in migration were seen at 9 hours after wounding. (C) Twenty-four hours after wounding, all the cells except for the M12mac25 line had closed the wound. M12 LM cells piled up along the wound site, whereas the site of the original wound could not be detected in the M12 control cells.

In Vivo Tumorigenicity

To examine in vivo tumorigenicity of the LM-overexpressing cells, we injected 106 cells subcutaneously from each cell line into groups of 10 male athymic nude mice and monitored tumor growth during a period of 6 weeks. By 6 weeks, 100% of the M12β2, 90% of the M12α4, and 70% of the M12α4β2 mice had tumors. In comparison, 100% of the mice injected with M12pc control cells had tumors and none of the mice injected with M12mac25 had tumors. After 6 weeks, the average tumor volume was significantly higher (P < .05) for the M12β2 group compared to the M12α4β2 group (Figure 7). Whereas the tumor volumes of the other groups were not significantly different, the trend in tumor volume mirrored the trends seen for in vitro proliferation and migration.

Figure 7.

Figure 7

In vivo tumorigenicity of the various M12 LM cells compared to M12 control cells. Groups of 10 male athymic nude mice were subcutaneously injected with 1 x 106 cells and followed for 6 weeks. Tumor volume was calculated using the following formula: (l x w2)/2. Mice injected with M12β2 cells displayed the greatest tumor growth, whereas mice injected with M12α4β2 displayed the slowest tumor growth. *P < .01 compared to M12β2 tumors. M12mac25 cells did not form tumors in vivo.

To determine whether LMoverexpression was maintained in the tumors, we digested a portion of each tumor with collagenase. Antibiotic-resistant cells were regrown in tissue culture, and total RNA, whole cell lysates, and conditioned media were all collected and analyzed for LM expression. mRNA levels for the LMα4 and β2 chains decreased significantly (P < .05) in the tumors compared to preinjection levels; however, the mRNA levels remained significantly higher than the LMα4 and β2 chain levels seen in theM12pc cells (P < .0001) andM12pc tumors (P < .0001; Figure 8A). Western immunoblots demonstrated maintenance of increased protein levels of the introduced LM chains (Figure 8B).

Figure 8.

Figure 8

Relative LMα4 and β2 expression in in vivo tumors. A portion of each tumor was digested with collagenase, then the antibiotic-resistant cells were regrown in vitro and total RNA and whole cell lysates were collected. (A) RNA was converted to cDNA, and real-time PCR was run using primers against the LMα4 and β2 chains. Whereas the levels of introduced LM chain mRNA decreased compared to preinjected levels, the tumor levels remained significantly higher than the LMα4 and β2 chain levels seen in the M12 control cells (P < .0001) and M12 tumors (P < .0001). (B) Western immunoblots against the LMβ2 and α4 chains. Lysates were run on reducing SDS-PAGE gels. As shown here, the introduced LM chains were still highly expressed by the tumor cells.

In various cancers, alterations in LMs have been associated with changes in expression of other matrix proteins and angiogenesis [22]. We examined the tumors for overall matrix composition; histologic comparison of tumors demonstrated significantly more collagen deposition in the matrix for the M12 LM-overexpressing lines compared to the M12pc tumors (P < .05; Figure 9). Because alterations in both collagen and LM expression, especially an increase in LM411 (α4β1γ1), occur during tumor angiogenesis, we stained tumors against MECA. Because M12 LM cells are human, the MECA staining detects the host-derived tumor blood vessels. M12α4 tumors had the highest staining intensity for MECA followed by the M12β2, M12α4β2, and M12pc tumors (Figure 10B).

Figure 9.

Figure 9

Collagen staining of in vivo tumors. Masson's Trichrome staining, which stains primarily the collagen component of the ECM, was performed on fixed tumor sections. Staining intensity was scored for each tumor, and the average intensity was calculated per group. The amount of collagen present was significantly higher for the M12α4 tumors (P <.05) compared to the M12 tumors.

Figure 10.

Figure 10

Differences in tumor angiogenesis. (A) On a macroscopic level, M12α4 tumors had an enhanced blood supply compared to M12β2, M12α4β2, and M12pc tumors. (B) To assess the presence of host-derived vessels microscopically in the tumors, staining against MECA was performed on frozen tumor sections. M12α4 tumors had more vessels than M12pc, M12β2, or M12α4β2 tumors.

Discussion

Laminins are expressed in both normal and malignant prostate tissue, but different isoforms predominate in each case. In nonmalignant prostate ECM, LM332 is predominant [26,28,35]; the high mRNA and protein levels of the LM α3, β3, and γ2 chains observed in the PECs are consistent with previous data. LM332 has been shown to be necessary for epithelial cell polarization during development of a normal basal epithelial cell layer [36,37]. Without LM332, the basal cell layer fails to develop, and the epithelial cell loses the cell-cell contact protein E-cadherin, as well as other structurally significant molecules, and is prone to phenotypic deregulation and transformation [26]. LM332 is lost in progression to prostate cancer, and further alterations, including cleavage of the α3 and β3 chains, occur as the cancer becomes invasive or metastatic; these alterations and the loss of normal LM332 may contribute to formation of a structurally weaker ECM more conducive to metastases [26,28,38]. The mechanisms responsible for loss of LM332 are not well understood, although aberrant methylation of promoter regions could lead to silencing of LM332 genes [39]. Various prostate cancer cell lines, including the LNCaP line, have already been shown to mirror the in vivo loss of LM332 [40]; we demonstrate here that another prostate cancer cell line, M12, has significantly decreased its production of LM332.

We found that nonsenescent PECs expressed abundant levels of the LMβ2 chain but did not express the LMα4 chain. Our senescent M12mac25 cells showed partially restored LMβ2 chain mRNA and protein levels compared to PECs and demonstrated increased levels of LMα4 chain mRNA and protein compared to both PECs and M12 cells. Other laboratories have reported an increase in the LMα4 chain transcript in senescent primary prostate fibroblasts [6] and senescent prostate epithelial cells [6,41]. Our results suggest that prostate cancer cells induced to undergo senescence alter their LM production as well.

Several studies have shown that LM expression is altered during tumor progression [22,26]. In glial tumors, abnormalities in matrix production develop in glial cells, adjacent stroma, and endothelial cells. As in prostate cancer, there is loss of LM332 to a degree depending on the depth within the tumor and the grade of tumor [25,42,43]. Gliomas also exhibit elevated levels of the LMα4 chain, and during glioblastoma progression, endothelial cells cease synthesis of LM421 (α4β2γ1) in favor of LM411 [25,42]. This conversion can be induced by coculture of glioblastoma cells and endothelial cells, and the malignant phenotype can be reversed by reexpression of LM421 [43]. A similar effect may occur in the prostate where senescent stromal cells have been postulated to influence the cancer phenotype of prostate epithelium. Prostate cancer cells can sometimes integrate with tumor vessels and coexpress vascular antigens, a phenomenon termed vasculogenic mimicry, which facilitates tumor progression [44,45]. These observations suggest that selective expression of LM411 and 421 influences the proliferative or differentiated phenotype and that aberrant expression of LM411 by senescent or tumor cells can influence the angiogenic potential of adjacent endothelial cells, which in turn facilitates tumor growth and metastasis.

Because LMs are known ligands for various cell surface receptors, they are important biologically as mediators of cellular behaviors such as proliferation, migration, and tumorigenicity. However, there is a paucity of studies examining the direct role of LMs in prostate cancer or senescence. Most studies on alterations in LM composition during cancer progression focus on immunohistochemical changes in prostate tissue samples [26,28,35]. The few functional studies on LMs have concentrated on LM511 (α5β1γ1) and its cleavage products and on their role in increased migration of prostate cancer cells [46,47]. One study has been reported in which the LMβ3 chain was transfected into the LNCaP prostate cancer cell line. Although punctate deposition of the LMβ3 chain occurred along cell surfaces, the authors were unable to detect either secretion or the classic monolayer deposition of the LM332 trimer into the matrix. However, the reexpression of the LMβ3 chain still resulted in increased tumor formation in vivo and altered expression of genes involved in various growth signaling pathways on cDNA arrays [40], which suggests that individual LM chains may have unexplored biological functions.

Our LM transfected cells, however, secreted and deposited the introduced LM chains. Furthermore, we found that introduction of the LMβ2 chain was associated with an alteration in deposition of the endogenous LM332. Compared to the M12pc empty vector cells and the M12α4 cells, staining against the LM332 chains in the M12β2 and M12α4β2 cells showed both a classic monolayer deposition and a fibrillar three-dimensional staining pattern. Whereas primary epithelial cells normally deposit LM332 in a monolayer in vitro, three-dimensional deposition of LM332 can occur in vitro when these cells are cocultured with fibroblasts that secrete large amounts of fibronectin. The epithelial cells deposit LM332 along the fibronectin fibers, separating themselves from the fibroblasts in discrete “nests” [31]. Immunohistochemical studies on various cancers, including prostate, demonstrate that primary tumors often form their own basement membrane, separating themselves from the surrounding stroma [4,22,26,48].

Our observation that the introduction of the LMα4 and β2 chains altered the deposition of matrix proteins prompted our exploration of the effects of altered LM expression on cell behavior. We found that in vitro proliferation and migration were, in general, enhanced by increased expression of either the LMα4 or β2 chains but decreased if both chains were highly expressed. In vivo tumor formation followed the same trend. Mouse endothelial cell antigen staining of these tumors demonstrated increased tumor vasculature in the M12α4 tumors compared to the M12β2 and M12α4β2 tumors. These results agree with immunohistochemical studies on breast cancer and glioblastoma samples, which demonstrated that high levels of LMα4 protein expression were associated with tumor vasculature and increased tumorigenicity, whereas expression of both the LMα4 and β2 chains was associated with decreased tumorigenicity and normal vasculature [24,25,49].

Only a few studies examining the LMβ2 chain in cancer have been reported. Immunohistochemical studies on LMs suggest increased staining for the LMβ2 chain in prostate cancer tissue samples compared to normal prostate [48] and increased LMβ2 staining in ovarian tumor basement membranes, especially in lower-grade cancers [50,51]. In addition, there is one report in the literature regarding hypovascular, mega-adenomas in pituitary cancers. Using an in vitro model of hypoxia in pituitary tumors, Bao et al. [52] demonstrated a correlation between increased LMβ2 chain protein (but not the other LM chains) and decreased oxygen concentration. Further, immunohistochemical analysis of pituitary adenoma sections showed a significant correlation between staining intensity for the LMβ2 chain and increased size of the tumor. It would be of interest to see what role hypoxia plays in the relatively hypovascular M12β2 tumors.

The previously mentioned studies, however, did not determine the identity of the mature β2-containing LM trimer involved in these ECM-rich cancers. We have presented data suggesting that the LMβ2 chain is associated with the LMα3 chain in the M12 prostate cells overexpressing the LMβ2 chain. Whether this is a direct association resulting in a LM321 trimer or simply a β2-containing LM complexing with LM332 is not known because immunoprecipitations with both the LMα3 and γ2 chains pulled down the LMβ2 chain, and immunofluorescent staining demonstrated costaining of the LMβ2 and LMβ3 chains as well. Champliaud et al. [53] suggest that the LMβ2 chain can directly bind the LMα3 chain to form a LM321 trimer. Further, they argue that LM332, LM321, and LM311 form a complex in normal epithelial basement membranes. Therefore, a complex of LM332, 311, and 321 is a possibility in the LMβ2-overexpressing cells, although the formation of such a complex has not been examined in cancer cells.

Expression of the LMβ2 chain alone has a tumor promoting function as opposed to the tumor suppressive role seen with high protein levels of the LMα4 and β2 chains together. The mechanisms behind this dichotomy in function for the LM β2 chain remain to be elucidated, but this observation supports the idea that both tumor-promoting and tumor-inhibiting factors secreted by senescent cells combine or interact to influence cellular behavior. Identification of the factors secreted by senescent cancer cells and their effects on the regression or progression of the remaining tumor will have important implications for future cancer modalities.

Acknowledgments

The authors thank Pete Nelson and Ilsa Coleman for performing the cDNA microarrays, Nathan Karres for his assistance with the animal work and tumor staining, and Kate Andrews and the University of Washington Histopathology Laboratory for the Masson's Trichrome staining.

Abbreviations

LM

laminin

LM332

laminin α3β3γ2

LM411

laminin α4β1γ1

LM421

laminin α4β2γ1

LM511

laminin α5β1γ1

LNCaP

human prostate cancer cell line derived from a lymph-node metastasis

mac25

senescence-associated gene also known as IGFBP-7/IGFBP-rP1/TAF

M12

human prostate cancer cell line derived from SV-40T-immortalized benign prostate epithelial cells

MECA

mouse endothelial cell antigen

PEC

primary prostate epithelial cells

Footnotes

1

This research was supported by grants from the Prostate Cancer Research Program of the Department of Defense (predoctoral fellowship W81XWH-07-1-0036 to C.C.T.S.) and the National Cancer Institute (U54CA126540-01 to S.R.P. and W.G.C.).

References

  • 1.Hsing A, Tsao L, Devesa S. International trends and patterns of prostate cancer incidence and mortality. Int J Cancer. 2000;85:60–67. doi: 10.1002/(sici)1097-0215(20000101)85:1<60::aid-ijc11>3.0.co;2-b. [DOI] [PubMed] [Google Scholar]
  • 2.Nelson W, De Marzo A, Isaacs W. Mechanisms of disease: prostate cancer. N Engl J Med. 2003;349:366–381. doi: 10.1056/NEJMra021562. [DOI] [PubMed] [Google Scholar]
  • 3.Soto A, Sonnenschein C. The somatic mutation theory of cancer: growing problems with the paradigm? BioEssays. 2004;26:1097–1107. doi: 10.1002/bies.20087. [DOI] [PubMed] [Google Scholar]
  • 4.Bissell M, Radisky D. Putting tumours in context. Nat Rev Cancer. 2001;1:46–54. doi: 10.1038/35094059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Campisi J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 2005;120:513–522. doi: 10.1016/j.cell.2005.02.003. [DOI] [PubMed] [Google Scholar]
  • 6.Bavik C, Coleman I, Dean J, Knudsen B, Plymate S, Nelson P. The gene expression program of prostate fibroblast senescence modulates neoplastic epithelial cell proliferation through paracrine mechanisms. Cancer Res. 2006;66:794–802. doi: 10.1158/0008-5472.CAN-05-1716. [DOI] [PubMed] [Google Scholar]
  • 7.Krtolica A, Campisi J. Cancer and aging: a model for the cancer promoting effects of the aging stroma. Int J Biochem Cell Biol. 2002;34:1401–1414. doi: 10.1016/s1357-2725(02)00053-5. [DOI] [PubMed] [Google Scholar]
  • 8.Dimri G. What has senescence got to do with cancer? Cancer Cell. 2005;7:505–512. doi: 10.1016/j.ccr.2005.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Choi J, Shendrik I, Peacocke M, Peehl D, Buttyan R, Ikeguchi E, Katz A, Benson M. Expression of senescence-associated beta-galactosidase in enlarged prostates from men with benign prostatic hyperplasia. Urology. 2000;56:160–166. doi: 10.1016/s0090-4295(00)00538-0. [DOI] [PubMed] [Google Scholar]
  • 10.Jarrard D, Sarkar S, Shi Y, Yeager T, Magrane G, Kinoshita H, Nassif N, Meisner L, Newton M, Waldman F, et al. p16/pRb pathway alterations are required for bypassing senescence in human prostate epithelial cells. Cancer Res. 1999;59:2957–2964. [PubMed] [Google Scholar]
  • 11.Lopez Bermejo A, Buckway C, Devi G, Hwa V, Plymate S, Oh Y, Rosenfeld R. Characterization of insulin-like growth factor-binding protein-related proteins (IGFBP-rP1s) 1, 2, and 3 in human prostate epithelial cells: potential roles for IGFBP-rP1 and 2 in senescence of the prostatic epithelium. Endocrinology. 2000;141:4072–4080. doi: 10.1210/endo.141.11.7783. [DOI] [PubMed] [Google Scholar]
  • 12.Schwarze S, Shi Y, Fu V, Watson P, Jarrard D. Role of cyclin-dependent kinase inhibitors in the growth arrest at senescence in human prostate epithelial and uroepithelial cells. Oncogene. 2001;20:8184–8192. doi: 10.1038/sj.onc.1205049. [DOI] [PubMed] [Google Scholar]
  • 13.Untergasser G, Koch H, Menssen A, Hermeking H. Characterization of epithelial senescence by serial analysis of gene expression: identification of genes potentially involved in prostate cancer. Cancer Res. 2002;62:6255–6262. [PubMed] [Google Scholar]
  • 14.Castro P, Xia C, Gomez L, Lamb D, Ittmann M. Interleukin-8 expression is increased in senescent prostatic epithelial cells and promotes the development of benign prostatic hyperplasia. Prostate. 2004;60:153–159. doi: 10.1002/pros.20051. [DOI] [PubMed] [Google Scholar]
  • 15.Castro P, Giri D, Lamb D, Ittmann M. Cellular senescence in the pathogenesis of benign prostatic hyperplasia. Prostate. 2003;55:30–38. doi: 10.1002/pros.10204. [DOI] [PubMed] [Google Scholar]
  • 16.Chang B-D, Broude E, Dokmanovic M, Zhu H, Ruth A, Xuan Y, Kandel E, Lausch E, Christov K, Roninson I. A senescence-like phenotype distinguishes tumor cells that undergo terminal proliferation arrest after exposure to anticancer agents. Cancer Res. 1999;59:3761–3767. [PubMed] [Google Scholar]
  • 17.Hwang E. Replicative senescence and senescence-like state induced in cancer-derived cells. Mech Ageing Dev. 2002;123:1681–1694. doi: 10.1016/s0047-6374(02)00102-1. [DOI] [PubMed] [Google Scholar]
  • 18.Schwarze S, Fu V, Desotelle J, Kenowski M, Jarrard D. The identification of senescence-specific genes during the induction of senescence in prostate cancer cells. Neoplasia. 2005;7:816–823. doi: 10.1593/neo.05250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sprenger C, Damon S, Hwa V, Rosenfeld R, Plymate S. Insulin-like growth factor binding protein-related protein 1 (IGFBP-rP1) is a potential tumor suppressor protein for prostate cancer. Cancer Res. 1999;59:2370–2375. [PubMed] [Google Scholar]
  • 20.Sprenger C, Vail M, Evans K, Simurdak J, Plymate S. Over-expression of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/mac25) in the M12 prostate cancer cell line alters tumor growth by a delay in G1 and cyclin A associated apoptosis. Oncogene. 2002;21:140–147. doi: 10.1038/sj.onc.1205021. [DOI] [PubMed] [Google Scholar]
  • 21.Plymate S, Haugk K, Sprenger C, Nelson P, Tennant M, Zhang Y, Oberley L, Zhong W, Drivdahl R, Oberley T. Increased manganese superoxide dismutase (SOD-2) is part of the mechanism for prostate tumor suppression by mac25/insulin-like growth factor binding-protein-related protein-1. Oncogene. 2003;22:1024–1034. doi: 10.1038/sj.onc.1206210. [DOI] [PubMed] [Google Scholar]
  • 22.Patarroyo M, Tryggvason K, Virtanen I. Laminin isoforms in tumor invasion, angiogenesis and metastasis. Semin Cancer Biol. 2002;12:197–207. doi: 10.1016/S1044-579X(02)00023-8. [DOI] [PubMed] [Google Scholar]
  • 23.Givant-Horwitz V, Davidson B, Reich R. Laminin-induced signaling in tumor cells. Cancer Lett. 2005;223:1–10. doi: 10.1016/j.canlet.2004.08.030. [DOI] [PubMed] [Google Scholar]
  • 24.Fujita M, Khazenzon N, Bose S, Sekiguchi K, Sasaki T, Carter W, Ljubimov A, Black K, Ljubimova J. Overexpression of β1-chain-containing laminins in capillary basement membranes of human breast cancer and its metastases. Breast Cancer Res. 2005;7:R411–R421. doi: 10.1186/bcr1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ljubimova J, Fugita M, Khazenzon N, Das A, Pikul B, Newman D, Sorokin L, Sasaki T, Black K. Association between laminin-8 and glial tumor grade, recurrence, and patient survival. Cancer. 2004;101:604–612. doi: 10.1002/cncr.20397. [DOI] [PubMed] [Google Scholar]
  • 26.Nagle R. Role of the extracellular matrix in prostate carcinogenesis. J Cell Biochem. 2004;91:36–40. doi: 10.1002/jcb.10692. [DOI] [PubMed] [Google Scholar]
  • 27.Bae V, Jackson-Cook C, Maygarden S, Plymate S, Chen J, Ware J. Metastatic sublines of an SV40 large T antigen immortalized human prostate epithelial cell line. Prostate. 1998;34:275–282. doi: 10.1002/(sici)1097-0045(19980301)34:4<275::aid-pros5>3.0.co;2-g. [DOI] [PubMed] [Google Scholar]
  • 28.Hao J, Yang Y, McDaniel K, Dalkin B, Cress A, Nagle R. Differential expression of laminin 5 (α3β3γ2) by human malignant and normal prostate. Am J Pathol. 1996;149:1341–1349. [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhang H, Pan K-H, Cohen S. Senescence-specific gene expression fingerprints reveal cell-type-dependent physical clustering of up-regulated chromosomal loci. Proc Natl Acad Sci USA. 2003;100:3251–3256. doi: 10.1073/pnas.2627983100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Drivdahl R, Haugk K, Sprenger C, Nelson P, Tennant M, Plymate S. Suppression of growth and tumorigenicity in the prostate tumor cell line M12 by overexpression of the transcription factor SOX9. Oncogene. 2004;23:4584–4593. doi: 10.1038/sj.onc.1207603. [DOI] [PubMed] [Google Scholar]
  • 31.Sigle R, Gil S, Bhattacharya M, Ryan M, Yang T-M, Brown T, Boutaud A, Miyashita Y, Olerud J, Carter W. Globular domains 4/5 of the laminin α3 chain mediate deposition of precursor laminin 5. J Cell Sci. 2004;177:4481–4494. doi: 10.1242/jcs.01310. [DOI] [PubMed] [Google Scholar]
  • 32.Labat-Robert J. Fibronectin in malignancy—effect of aging. Semin Cancer Biol. 2002;12:187–195. doi: 10.1016/S1044-579X(02)00022-6. [DOI] [PubMed] [Google Scholar]
  • 33.Kumazaki T, Wadhwa R, Kual S, Mitsui Y. Expression of endothelin, fibronectin, and mortalin as aging and mortality markers. Exp Gerentol. 1997;32:95–103. doi: 10.1016/s0531-5565(96)00080-0. [DOI] [PubMed] [Google Scholar]
  • 34.Kaspar M, Zardi L, Neri D. Fibronectin as target for tumor therapy. Int J Cancer. 2006;118:1331–1339. doi: 10.1002/ijc.21677. [DOI] [PubMed] [Google Scholar]
  • 35.Brar P, Dalkin B, Weyer C, Sallam K, Virtanen I, Nagle R. Laminin alpha-1, alpha-3, and alpha-5 chain expression in human prepubertal benign prostate glands and adult benign and malignant prostate glands. Prostate. 2003;55:65–70. doi: 10.1002/pros.10206. [DOI] [PubMed] [Google Scholar]
  • 36.Frank D, Carter W. Laminin 5 deposition regulates keratinocyte polarization and persistent migration. J Cell Sci. 2004;117:1351–1363. doi: 10.1242/jcs.01003. [DOI] [PubMed] [Google Scholar]
  • 37.Ryan M, Lee K, Miyashita Y, Carter W. Targeted disruption of the LAMA3 gene in mice reveals abnormalities in survival and late stage differentiation of epithelial cells. J Cell Biol. 1999;145:1309–1323. doi: 10.1083/jcb.145.6.1309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cress A, Rabinovitz I, Zhu W, Nagle R. The α6β1 and α6β4 integrins in human prostate cancer progression. Cancer Metastasis Rev. 1995;14:219–228. doi: 10.1007/BF00690293. [DOI] [PubMed] [Google Scholar]
  • 39.Sathyanarayana U, Padar A, Suzuki M, Maruyama R, Shigematsu H, Hsieh J-T, Frenkel E, Gazdar A. Aberrant promoter methylation of laminin-5-encoding genes in prostate cancers and its relationship to clinicopathological features. Clin Cancer Res. 2003;9:6395–6400. [PubMed] [Google Scholar]
  • 40.Calaluce R, Bearss D, Barrera J, Zhao Y, Han H, Beck S, McDaniel K, Nagle R. Laminin-5 beta3A expression in LNCaP human prostate carcinoma cells increases cell migration and tumorigenicity. Neoplasia. 2004;6:468–479. doi: 10.1593/neo.03499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Luo J, Dunn T, Ewing C, Sauvageot J, Chen Y, Trent J, Isaacs W. Gene expression signature of benign prostatic hyperplasia revealed by cDNA microarray analysis. Prostate. 2002;51:189–200. doi: 10.1002/pros.10087. [DOI] [PubMed] [Google Scholar]
  • 42.Ljubimova J, Lakhter A, Loksh A, Yong W, Riedinger M, Miner J, Sorokin L, Ljubimov A, Black K. Overexpression of α4 chain-containing laminins in human glial tumors identified by gene microarray analysis. Cancer Res. 2001;61:5601–5610. [PubMed] [Google Scholar]
  • 43.Khazenzon N, Ljubimov A, Lakhter A, Fujita M, Fujiwara H, Sekiguchi K, Sorokin L, Petajaniemi N, Virtanen I, Black K, et al. Antisense inhibition of laminin-8 expression reduces invasion of human gliomas in vitro. Mol Cancer Ther. 2003;2:986–994. [PubMed] [Google Scholar]
  • 44.Chung L, Baseman A, Assikis V, Zhau H. Molecular insights into prostate cancer progression: the missing link of tumor microenvironment. J Urol. 2005;173:10–20. doi: 10.1097/01.ju.0000141582.15218.10. [DOI] [PubMed] [Google Scholar]
  • 45.Bissell M. Tumor plasticity allows vasculogenic mimicry, a novel form of angiogenic switch. Am J Pathol. 1999;155:675–679. doi: 10.1016/S0002-9440(10)65164-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Udayakumar T, Chen M, Bair E, von Bredow D, Cress A, Nagle R, Bowden G. Membrane type-1-matrix metalloproteinase expressed by prostate carcinoma cells cleaves human laminin-5 β3 chain and induces cell migration. Cancer Res. 2003;63:2292–2299. [PubMed] [Google Scholar]
  • 47.Yu H-M, Frank D, Zhang J, You X, Carter W, Knudsen B. Basal prostate epithelial cells stimulate the migration of prostate cancer cells. Mol Carcinog. 2004;41:85–97. doi: 10.1002/mc.20041. [DOI] [PubMed] [Google Scholar]
  • 48.Pfohler C, Fixemer T, Jung V, Dooley S, Remberger K, Bonkhoff H. In situ hybridization analysis of genes coding collagen IV α1 chain, laminin β1 chain, and S-laminin in prostate tissue and prostate cancer: increased basement membrane gene expression in high-grade and metastatic lesions. Prostate. 1998;36:143–150. doi: 10.1002/(sici)1097-0045(19980801)36:3<143::aid-pros1>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
  • 49.Fujita M, Khazenzon N, Ljubimov A, Lee B-S, Virtanen I, Holler E, Black K, Ljubimova J. Inhibition of laminin-8 in vivo using a novel poly(malic acid)-based carrier reduces glioma angiogenesis. Angiogenesis. 2006;9:183–191. doi: 10.1007/s10456-006-9046-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wewer U, Gerecke D, Durkin M, Kurtz K, Mattei M-G, Champliaud M, Burgeson R, Albrechtsen R. Human β2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas. Genomics. 1994;24:243–252. doi: 10.1006/geno.1994.1612. [DOI] [PubMed] [Google Scholar]
  • 51.Ricciardelli C, Rodgers R. Extracellular matrix of ovarian tumors. Semin Reprod Med. 2006;24:270–282. doi: 10.1055/s-2006-948556. [DOI] [PubMed] [Google Scholar]
  • 52.Bao Y, Yoshida D, Morimoto D, Teramoto A. Expression of laminin beta2: a novel marker of hypoxia in pituitary adenomas. Endocr Pathol. 2006;17:251–261. doi: 10.1385/ep:17:3:251. [DOI] [PubMed] [Google Scholar]
  • 53.Champliaud M, Lunstrum G, Rousselle P, Nishiyama T, Keene D, Burgeson R. Human amnion contains a novel laminin variant, laminin 7, which like laminin 6, covalently associates with laminin 5 to promote stable epithelial-stromal attachment. J Cell Biol. 1996;132:1189–1198. doi: 10.1083/jcb.132.6.1189. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press

RESOURCES