SUMMARY
The ability of animals to carry out their normal behavioral repertoires requires exquisitely precise matching between specific motoneuron subtypes and the muscles they innervate. However, the molecular mechanisms that regulate motoneuron subtype specification remain unclear. Here we use individually-identified zebrafish primary motoneurons to describe a novel role for Nkx6 and Islet1 proteins in specification of vertebrate motoneuron subtypes. We show that zebrafish primary motoneurons express two related Nkx6 transcription factors. In the absence of both Nkx6 proteins, the CaP motoneuron subtype develops normally whereas the MiP motoneuron subtype develops a more interneuron-like morphology. In the absence of Nkx6 function MiPs have normal early expression of islet1, which is required for motoneuron formation, however they fail to maintain islet1 expression. Misexpression of islet1 RNA can compensate for loss of Nkx6 function, providing evidence that Islet1 acts downstream of Nkx6. We suggest that Nkx6 proteins regulate MiP development at least in part by maintaining islet1 expression which is required both to promote the MiP subtype and to suppress interneuron development.
INTRODUCTION
Motoneurons of the vertebrate central nervous system have precise subtype identities characterized by soma location, axon trajectory, target muscle innervation and combinatorial transcription factor expression (Lewis and Eisen, 2003; Shirasaki and Pfaff, 2002). Specification of motoneuron subtypes has been well-studied in mouse and chick embryos (Jurata et al., 2000; Pfaff and Kintner, 1998; Tsalik et al., 2003), however, nothing is currently known about the molecular mechanisms that establish very fine-grained motoneuron patterning, such as the segmentally-reiterated, individually-identified primary motoneurons (PMNs) of the zebrafish spinal cord.
We focus our attention on two PMN subtypes, CaP and MiP that are present in a segmentally-repeated, alternating pattern (Lewis and Eisen, 2003). CaPs project axons that innervate ventral muscle and express the LIM homeobox gene islet2, whereas MiPs project axons that innervate dorsal muscle and express the LIM homeobox gene islet1 (Lewis and Eisen, 2003). islet gene expression is dynamic in these cells (Figure 1A); both CaP and MiP express islet1 around the time they exit the cell cycle (Appel et al., 1995; Inoue et al., 1994; Korzh et al., 1993; Tokumoto et al., 1995). MiPs then transiently down-regulate islet1 expression and reinitiate it prior to axogenesis (Appel et al., 1995). Thus, MiPs express islet1 in two distinct phases, an early phase and a late phase. In contrast to MiPs, CaPs initiate expression of islet2 while they still express islet1, and then down-regulate expression of islet1 (Appel et al., 1995; Inoue et al., 1994; Korzh et al., 1993; Tokumoto et al., 1995). Thus, CaPs have an early phase of islet1 expression and a later phase of islet2 expression. The end result of these dynamic changes in islet gene expression is that by the time of axon extension, MiPs express exclusively islet1 and CaPs express exclusively islet2.
Transplantation of single CaPs and MiPs revealed that their subtypes are initially labile and responsive to environmental signals, but become committed shortly before axogenesis (Eisen, 1991), around the time the alternating pattern of islet2 and islet1 is established (Appel et al., 1995). Thus, it was surprising to learn that either Islet1 or Islet2 protein is sufficient to specify both CaP and MiP subtypes, suggesting that the differences between these PMNs might be regulated by factors upstream of the islet genes (Hutchinson and Eisen, 2006). Homeodomain transcription factors expressed in the motoneuron progenitor (pMN) domain, such as Nkx6.1 (Cheesman et al., 2004), are good candidates for performing this function.
The Nkx6 transcription factor family is important in formation of mouse spinal motoneurons. One family member, Nkx6.1, is expressed in the spinal cord pMN domain and required for formation of a proportion of all spinal motoneuron subtypes (Sander et al., 2000). Another family member, Nkx6.2 is expressed dorsal to the pMN domain and negatively-regulated by Nkx6.1. In the absence of Nkx6.1 function, Nkx6.2 expression spreads ventrally into the pMN domain and partially substitutes for Nkx6.1 during motoneuron formation (Vallstedt et al., 2001). Mice deficient for both Nkx6.1 and Nkx6.2 lose nearly all spinal motoneurons (Vallstedt et al., 2001). As in mouse, zebrafish Nkx6.1 is expressed in the pMN domain and is also important for formation of some zebrafish motoneurons (Cheesman et al., 2004). Nkx6.1-deficient zebrafish lack secondary motoneurons (SMNs), a type of spinal motoneuron that develops later than PMNs (Myers, 1985), but have normal PMNs, raising the possibility that additional Nkx6 proteins might regulate zebrafish PMN formation.
Here we provide evidence for a novel role of Nkx6 proteins in motoneuron subtype specification. We show that zebrafish have at least three nkx6 genes, two of which are expressed in the pMN domain and transiently in postmitotic PMNs. Nkx6 proteins are not required for PMN formation because early islet1 expression is normal in embryos lacking Nkx6 proteins. In Nkx6-deficient embryos, CaPs have normal islet2 expression and project normal ventral axons out of the spinal cord, however, MiPs fail to initiate the second phase of islet1 expression and do not form their subtype-specific, dorsal, peripheral axons, instead adopting a more interneuron-like morphology by projecting an axon within the spinal cord. We suggest that Nkx6 proteins control MiP subtype specification at least in part by regulating the second phase of islet1 expression and that this late expression of islet1 is required to promote the MiP subtype and to suppress interneuron development.
METHODS
Animals
Wild-type (AB) and Tg(islet:GFP) (Higashijima et al., 2000) embryos were reared and staged by hours post-fertilization at 28.5°C (hpf) and gross morphology (Kimmel et al., 1995).
Cloning
A search of the zebrafish genome revealed an nkx6.2 gene highly similar to zebrafish nkx6.1 (Cheesman et al., 2004). A forward primer to an nkx6.2 specific region (5’ CGG CTT CAA GGC TCA TTC 3’) and a reverse homeobox primer (5’ CCA TTT AGT TCT TCT GTT CTG 3’) isolated a full-length cDNA clone from a 14−19 hpf library (Appel and Eisen, 1998). These primers did not amplify control nkx6.1 cDNA. The isolated clone contains an open reading frame and UTR sequences. The DNA sequence predicts a 279 amino acid protein containing both a homeodomain and an NK decapeptide, which defines the nkx gene family. The Genbank accession number for the complete zebrafish nkx6.2 mRNA is DQ416765. We isolated a fragment of nkx6.3 from first strand cDNA (forward primer 5' AGTCCAACATCTCAGGATCC 3', reverse primer 5' TCCACTCATACCCTCCATC 3') and based on this clone (Genbank accession DQ415639) and genomic clones, compiled a putative full length sequence.
In situ RNA hybridization
Zebrafish RNA in situ hybridization was performed as described previously in Appel and Eisen (1998). nkx6.1, islet1 and islet2 mRNA probes were described previously (Appel et al., 1995; Cheesman et al., 2004), as were pax2a (Thaeron et al., 2000), evx1 (Thaeron et al., 2000), eng1b (Higashijima et al., 2000) and chx10 (Kimura et al., 2006). The nkx6.2 mRNA probe was made from full length nkx6.2 DNA. nkx6.3 expression was determined using a probe against a portion of the nkx6.3 gene that excluded the homeodomain. In the nkx6.3 anti-GFP double label experiment, the RNA in situ hybridization was performed first, followed by antibody detection.
Immunohistochemistry
The following primary antibodies (Abs) were used: polyclonal rabbit anti-Nkx6.1 (1:1200; gift of O. Madsen), monoclonal mouse anti-Islet (1:200; antibody recognizes both Islet1 and Islet2 proteins (Korzh et al., 1993); 39.4D5 Developmental Studies Hybridoma Bank), monoclonal mouse zn1 (Trevarrow et al., 1990), monoclonal mouse znp1 (Trevarrow et al., 1990), monoclonal anti-GFP (1:200; Clonetech, JL-8,), and polyclonal rabbit anti-GABA (1:1000, Sigma). Secondary antibodies from Molecular Probes were used: goat anti-mouse Alexa-488 (1:1000) and goat anti-rabbit Alexa-568 (1:1000). One secondary antibody from Jackson Labs was also used: goat anti-rabbit Cy5 (1:200). Embryos were fixed for 3.5−4 hrs in 4% paraformaldehyde (PFA) and 1 × Fix Buffer (Westerfield, 2000) at 4°C, blocked in 1 × PBS/5%NGS/4 mg/ml BSA/0.5% Triton x-100 for 1 hour at room temperature, incubated in primary antibody diluted in block overnight at 4°C, washed at room temperature for 1.5 hours in PBS/0.1% Tween-20, incubated in secondary antibody diluted in block for 4 hrs at room temperature, and then washed for 1.5 hrs at room temperature in PBS/0.1% Tween-20.
Morpholino injections
The Nkx6.2 conceptual amino acid translation revealed two potential start methionines; we do not know if one or both of them are functional start sites. As they are close together, GeneTools (Corvallis, Oregon) designed a translation-blocking MO just upstream of the first methionine (5’-GGTGCGCCGGAGCCACAGGACAAAC-3’) on the assumption it would interfere with initiation of translation at either start site. We also utilized a splice blocking MO (5’-CGCGCAAAACTCACCCGCACAGGGA-3’) that began at position 386 of the nkx6.2 open reading frame and ended in the first intron, blocking the splice donor site of exon 1. Both nkx6.2 MOs produced similar phenotypes. Several nanoliters of 5mg/ml nkx6.2 MO diluted in 0.2M KCl and phenol red was injected into the yolk cell of 2 cell-stage embryos; for double MO injections we added 2.5mg/ml nkx6.1 MO (described in Cheesman et al., 2004). All our MO injections worked efficiently since 84.3% (27/32) of nkx6.1 MO-injected, 90.9% (30/33) of nkx6.2 MO-injected embryos, and 76.1% (35/46) of nkx6 double MO-injected embryos had a MiP axon phenotype.
Microscopy
Images of zebrafish embryos were captured on a Zeiss Axioplan equipped with a digital camera, a Bio-Rad Radiance, or a Zeiss Pascal confocal microscope. In a few cases an Olympus IX81 microscope with an FV300 confocal was used to capture images. The brightness and contrast of images was adjusted in Adobe Photoshop.
Motoneuron observation and quantification
All observations of CaP and MiP motoneurons were made in the spinal cord adjacent to somites 8−12. To quantify MiP axons, we counted the number of MiP axons in 28 hpf control, nkx6 single and double MO-injected embryos, as well as nkx6 MOs and islet1 RNA co-injected embryos labeled with zn1 and znp1 Abs. Axons were scored as MiPs if they projected posterior and dorsal to the zn1-labeled CaP soma. The percentage of MiP axons remaining in experimental embryos was calculated relative to controls. The percentage of segments with cells labeled with islet1 RNA in the MiP position was calculated from cells counted in segments 8−12 of 18 hpf control, nkx6.1, nkx6.2, and nkx6 double MO-injected embryos. For experiments in which individual MiPs were dye-labeled, we recognized these cells by their position and used protocols described in Eisen et al. (1989). GABA-positive interneurons were counted as described in Hutchinson and Eisen (2006). The number of cells labeled with chx10 or eng1b riboprobes was counted in segments 1−11 on each side of 24 hpf control and nkx6 double MO-injected embryos. The average number of positive cells per segment in experimental embryos was compared to control embryos.
3D analysis of confocal images
Velocity software was used to generate 3D images of individually labeled MiPs. A velocity classifier based on intensity was used to generate a threshold for red and green images of Nkx6 and Islet Abs which was then followed by Velocity image arithmetic to identify co-labeled cells. The co-labeled cells were then pseudo-colored blue.
RESULTS AND DISCUSSION
Two nkx6 genes are dynamically expressed in zebrafish primary motoneurons
Studies implicating two Nkx6 homologues in mouse motoneuron formation (Vallstedt et al., 2001) and showing that zebrafish Nkx6.1 is unnecessary for PMN formation (Cheesman et al., 2004) raised the possibility of additional nkx6 genes in zebrafish. We isolated zebrafish nkx6.2 and nkx6.3 based on publicly-available genomic DNA sequences. Phylogenetic analysis indicated zebrafish nkx6 genes are most closely related to other vertebrate nkx6 genes, distinct from nkx2 family members (Figure S1A). Alignment of the three zebrafish Nkx6 predicted proteins revealed that Nkx6.1 and Nkx6.2 are more similar to each other than to Nkx6.3 (Figure S1B). Similar to mouse Nkx6.3 (Alanentalo et al., 2006), zebrafish nkx6.3 expression is restricted to a group of cells in the hindbrain and is not found in the spinal cord (Figure S1C), thus it cannot be involved in PMN development.
nkx6.1 and nkx6.2 are dynamically expressed in the zebrafish pMN domain. We previously showed that nkx6.1 is expressed in the ventral spinal cord both in the floor plate and in several longitudinal rows of cells dorsal to the floor plate (Cheesman et al., 2004). The number of nkx6.1-expressing cell rows dorsal to the floor plate is approximately the same as the number of olig2-expressing cell rows dorsal to the floor plate (see Park et al., 2002), showing that like olig2, nkx6.1 is expressed in the pMN domain (Cheesman et al., 2004). At 10 hpf, just before PMN progenitors begin leaving the cell cycle, nkx6.1 is expressed in more pMN domain cells than nkx6.2 (Figure 1B,C). At 14 hpf, nkx6.1 and nkx6.2 expression are almost indistinguishable and cross-sections reveal that both genes are confined to neurectoderm (data not shown). At 18 hpf, nkx6.1 and nkx6.2 expression is no longer apparent in many ventrally-located cells (Figure 1D,E). We previously showed that the ventral cells lacking nkx6.1 at this stage are PMNs (Cheesman et al., 2004), suggesting that expression of both nkx6 genes is extinguished from PMNs by 17−19 hpf, the time they undergo axogenesis. Both nkx6.1 and nkx6.2 continue to be expressed in the ventral spinal cord through at least 24 hpf (Figure S2).
Nkx6 proteins are differentially expressed in CaPs and MiPs, as shown by our double-label experiments with an Islet monoclonal antibody that recognizes both Islet1 and Islet2 proteins (Korzh et al., 1993) and an Nkx6 polyclonal antibody that recognizes both Nkx6.1 (Cheesman et al., 2004) and Nkx6.2 (Figure S2). At 14 hpf, both CaPs and MiPs express Islet and Nkx6 (Figure 1F). By 16 hpf, CaPs have extinguished expression of Nkx6 and express only Islet (Figure 1G-I). In contrast, MiPs have downregulated expression of Islet1 protein, similar to their downregulation of islet1 mRNA (Appel et al., 1995) but continue to express Nkx6 (Figure 1G). By 17 hpf, MiPs have initiated a second phase of Islet1 protein expression and continue to express Nkx6 (Figure 1H). MiPs express Nkx6 until 18 hpf, after which time they downregulate it (Figure 1I). Nkx6 proteins are expressed in PMN progenitors (Cheesman et al., 2004), thus these proteins are present at the right time to be involved in PMN formation. The differential expression of Nkx6 proteins in postmitotic MiPs and CaPs suggests that Nkx6 may also participate in specification of MiP and CaP subtypes.
Nkx6 proteins are not required for primary motoneuron formation
We previously showed that Nkx6.1 is unnecessary for PMN formation (Cheesman et al., 2004). To learn whether PMNs form in the absence of Nkx6.2 or in the absence of both Nkx6 proteins, we injected embryos with morpholino antisense oligonucleotides (MOs). Early expression of islet1 was normal in the absence of Nkx6.1, Nkx6.2, or both Nkx6 proteins (Figure 2A-D) suggesting PMNs formed normally. Thus, although Nkx6 proteins are expressed in the pMN domain, they appear unnecessary for PMN formation.
The requirement for Nkx6 proteins distinguishes CaP and MiP subtypes
CaPs and MiPs continue to express Nkx6 proteins after subtype commitment, thus we asked whether Nkx6 proteins have a role in subtype specification. In the absence of Nkx6.1, Nkx6.2 or both Nkx6 proteins, CaPs expressed islet2 normally (Figure 2E-H) and developed normal ventrally-projecting axons (Figure 3A-D). Thus, Nkx6 proteins appear unnecessary for CaP subtype specification or axon pathfinding.
In contrast to CaPs, MiPs were severely affected by lack of Nkx6 proteins. In the absence of either Nkx6.1 or Nkx6.2, some MiPs failed to initiate the late phase of islet1 expression (Figure 2I-K). In the absence of both Nkx6 proteins, very few MiPs expressed islet1 at 18 hpf (Figure 2I,L). In single nkx6 MO-injected embryos many MiPs had dorsal axons that were truncated or excessively-branched and some MiPs failed to form dorsal axons (Figure 3A-C). MiP axons were present in only 61% of segments in nkx6.1 MO-injected embryos as compared to 87% of segments in nkx6.2 MO-injected embryos and 98% of segments in control embryos (n=83 segments in 9 nkx6.1 MO-injected embryos; n=168 segments in 17 nkx6.2 MO-injected embryos; n=100 segments in 10 control embryos). MiP axons were most severely affected in embryos injected with both nkx6.1 and nkx6.2 MOs as indicated by the presence of MiP dorsal axons in only 40% of segments (n=240 segments in 24 nkx6 MO-injected embryos). The MiP axons that remained in nkx6 MO-injected embryos were severely truncated (Figure 3D). Thus, Nkx6 proteins are required for proper MiP subtype specification and axon pathfinding.
The loss of MiP axons in embryos lacking both Nkx6 proteins correlated with the failure of MiPs to initiate the late phase of islet1 expression, therefore we reasoned that MiPs did not form normal axons because this process requires Islet1 protein. To test this hypothesis, we co-injected nkx6.1 and nkx6.2 MOs with islet1 RNA (Figure 3E,F). MiP axons were present in 98% of segments in control embryos (n=100 segments in 10 embryos), 40% of segments in nkx6 double MO-injected embryos (n=240 segments in 24 embryos), and 74% of segments in embryos co-injected with islet1 RNA and nkx6 MOs (n=270 segments in 27 embryos). These data provide evidence that Islet1 is sufficient for projection of normal MiP axons even in the absence of Nkx6 proteins, and suggest that Nkx6 proteins regulate MiP specification, at least in part, by regulating expression of islet1.
In the absence of Nkx6 proteins MiPs become more interneuron-like
The failure to maintain islet1 expression and absence of dorsal axons in MiPs lacking Nkx6 proteins led us to consider whether MiPs developed as interneurons in the absence of late islet1 expression, as they do in the absence of early islet1 expression (Hutchinson and Eisen, 2006). To test this hypothesis, we labeled individual cells in the MiP position in nkx6 double MO-injected embryos by intracellular dye iontophoresis (Eisen et al., 1989). As a negative control, we labeled VeLD interneurons, which are located adjacent to MiPs (Eisen, 1991), and found that VeLDs are normal in nkx6 double MO-injected embryos (12 VeLDs in 11 embryos; data not shown). Dye-labeling of MiPs in nkx6 double MO-injected embryos revealed that these cells had a range of phenotypes (Figure 4B-F). MiPs normally extend a short ventral axon out of the spinal cord before they form their subtype-specific dorsal axon; the ventral axon is later retracted (Eisen et al., 1989). In the absence of Nkx6 proteins, many MiPs projected a normal ventral axon (Figure 4C,D), but often failed to retract it. Some MiPs had a dorsal axon, but it was frequently excessively-branched (Figure 4B) or truncated (Figure 4C). Surprisingly, many MiPs initiated motoneuron development by projecting a normal ventral axon, but then projected an interneuron-like axon within the spinal cord instead of a dorsal motor axon (Figure 4D). Finally, some MiPs did not project either ventral or dorsal motor axons, but only extended an interneuron-like axon within the spinal cord (Figure 4F). However, this interneuron-like axon was excessively-branched compared with axons of any of the previously-described types of ventral spinal interneurons (Lewis and Eisen, 2003). As an additional control, we antibody-stained embryos in which we had individually dye-labeled MiPs to verify that dye-labeled MiPs lacking dorsal axons correlated with segments lacking dorsal MiP axons as revealed by zn1 and znp1 Ab labeling (Figure 4G). Our results show that in the absence of Nkx6 proteins, MiPs form but they fail to extend their normal dorsal axon and instead they adopt a more interneuron-like morphology, often developing a “hybrid” phenotype in which they display morphological characteristics of both motoneurons and interneurons.
To learn whether the absence of late Islet1 expression causes MiPs to take on the molecular characteristics of one or more specific types of interneurons, we characterized the expression of several different interneuron markers in nkx6 double MO-injected embryos and assayed whether individual MiPs labeled with fluorescent dye expressed any of these markers. The GABA Ab labels several types of ventral interneurons that are derived from the pMN domain (see Hutchinson and Eisen, 2006), but the number of GABA-positive cells did not increase in nkx6 double MO-injected embryos (Figure 5A,B,G) and labeled MiPs were not GABA positive (Figure 4G). Thus, we next examined the expression of several transcription factors that are expressed by interneurons in specific dorsoventral spinal cord positions. pax2a and evx1 (Thaeron et al., 2000) are both expressed in interneurons in the dorsal and midregion of the spinal cord; the evx1 expression domain is just ventral to the pax2a expression domain. Expression of both pax2a and evx1 were normal in nkx6 double MO-injected embryos (data not shown). In contrast, chx10 and eng1b, which are both expressed more ventrally than pax2a and evx1, had altered expression patterns in nkx6 double MO-injected embryos. Expression of chx10 , which is probably in CiD interneurons (Kimura et al., 2006), is downregulated in embryos lacking Nkx6 (Figure 5C,D,G), whereas expression of eng1b, which is specifically in CiA interneurons (Higashijima et al., 2004), is expanded in nkx6 double MO-injected embryos (Figure 5E-G). These results are similar to the expansion of En1 (an eng1b ortholog) and reduction of Chx10 in mice lacking Nkx6.1 and Nkx6.2 (Vallstedt et al., 2001). Despite the changes in eng1b and chx10 expression, dye-labeled MiPs in nkx6 double MO-injected embryos did not express either one of these genes at 28 hpf (data not shown). Therefore, until additional markers of specific types of interneurons become available, we will remain unable to ascribe a specific type of interneuron identity to MiPs that develop in the absence of Nkx6 proteins.
CONCLUSIONS
Our studies reveal dynamic differences in Nkx6 expression and function in zebrafish PMN subtypes and provide three key findings. First, we show that although two zebrafish Nkx6 proteins are expressed in PMN progenitors, they are unnecessary for PMN formation. This contrasts to mouse, in which Nkx6 proteins are required for formation of nearly all spinal motoneurons (Vallstedt et al., 2001). It is possible that in zebrafish there are additional nkx6.1 or nkx6.2 orthologs that we have not discovered. This seems unlikely as the Nkx6.1 antibody we have used (Cheesman et al., 2004) recognizes both Nkx6.1 and Nkx6.2 proteins (Figure S2), however, we cannot eliminate the possibility of additional nkx6 orthologs until the zebrafish genome sequence is completed. The few spinal motoneurons that form in Nkx6 double mutant mice appear to develop early, similar to zebrafish PMNs. Thus, it would be interesting to learn whether early-born motoneurons in mouse have other features that resemble zebrafish PMNs and distinguish them from later-developing motoneurons.
Second, we show that the MiP subtype requires Nkx6 proteins whereas they appear dispensable for the CaP subtype. In mouse, Nkx6 proteins are required for formation of most motoneurons (Vallstedt et al., 2001; but see above), but differential function of these proteins in distinct spinal motoneuron subtypes has not been reported. It will be important in future studies to identify the factors that regulate CaP subtype specification, as well as to learn whether Nkx6 proteins have any role in specification of mammalian motoneuron subtypes.
Finally, we show that Nkx6 proteins prevent MiPs from developing an interneuron-like axon by regulating late islet1 expression. We have previously shown that the early phase of Islet1 promotes PMN formation and inhibits interneuron development (Hutchinson and Eisen, 2006). Here we suggest that the second phase of Islet1 expression promotes MiP subtype and also inhibits interneuron axon development. However, in the absence of only the late phase of Islet1 expression, MiPs often adopt a hybrid motoneuron/interneuron identity, rather than developing as interneurons, as they do in the absence of both phases of Islet1 expression.
The ability of zebrafish Nkx6 proteins to prevent MiPs from developing an interneuron-like axon is reminiscent of the ability of mouse Nkx6 proteins to inhibit pMN domain cells from expressing interneuron-specific transcription factors (Vallstedt et al., 2001). Interestingly, Vallestedt and colleague reported that in the absence of Nkx6 proteins, motoneurons transiently expressed Evx1, although whether these cells developed interneuron-like axons was not reported. We did not observe ectopic evx1 expression, however, it is possible that evx1 might be expressed early and transiently in MiPs in the absence of Nkx6 proteins. Mouse Nkx6 proteins apparently act within motoneuron progenitors, in contrast, our data raises the possibility that in MiPs, Nkx6 proteins function later, perhaps after the cell has become postmitotic. It will be important to address the timing of Nkx6 function further in future studies.
It is interesting that in the absence of Nkx6 proteins MiPs become more interneuron-like, rather than becoming more like CaP. MiPs can develop as CaPs when they are transplanted to the CaP spinal cord position several hours before axogenesis (Appel et al., 1995; Eisen, 1991). However, when MiPs are in their normal spinal cord position, they are unlikely to transform into another PMN subtype because specification of MiP and CaP subtypes requires positional signals derived from the overlying somites (Lewis and Eisen, 2004). Our data support a model in which interneuron formation is continuously suppressed during motoneuron development. It will be important to determine whether interneuron specification similarly requires continuous suppression of motoneuron development.
Supplementary Material
Figure S1. Zebrafish have three Nkx6 proteins
(A) Nkx phylogeny demonstrating the three zebrafish Nkx6 proteins uniquely cluster within one node which is distinct from the Nkx2.2 and Nkx1 class of proteins. The PHYLIP software package was employed to create a neighbor joining tree using the Clustal W algorithm. Sequences included in the tree were gathered from GenBank and bootstrap values are indicated. Expression of nkx6.3 mRNA begins at 20 hpf, persists until at least 72 hpf and is limited to a small population of cells posterior to rhombomere 5 in the hindbrain. (B) Alignment of zebrafish Nkx6.1, Nkx6.2 and Nkx6.3 translated amino acid sequences. Dashed (red) line indicates the NK domain and solid (blue) line indicates the homeodomain. (C) Whole mount in situ RNA hybridization reveals nkx6.3 is expressed in a subset of hindbrain cells at 25 hpf. (D) At 36 hpf nkx6.3-expressing cells (purple) are Islet:GFP negative and are located ventral to cells labeled with Islet:GFP (brown, GFP antibody staining). Lateral views, anterior to the left, dorsal to the top. Abbreviations: ov, otic vesicle; sb, somite boundary. Scale bar, 40μM,
Figure S2. Anti-Nkx6 detects both Nkx6.1 and Nkx6.2 proteins
(A-J) 24 hpf embryos, anterior to the left. (A-D; H-J) lateral views, (E-G) dorsal views. The confocal images in E-G were all taken at the same settings to ensure comparability; similarly, the confocal images in H-J were also all taken at the same settings to ensure comparability. The confocal images in H-J show only one side of the spinal cord, thus, there are fewer labeled cells than in the images in A-B, which show whole mount embryos. nkx6.1 (A) and nkx6.2 (B) mRNA are expressed in the ventral spinal cord in similar patterns. Both nkx6.1 and nkx6.2 (C, D) mRNA are expressed in the ventral brain, although the expression patterns are different. Injection of nkx6.1 MO decreased Nkx6.1 antibody labeling in brain (F) and spinal cord (I) compared to controls (E, H). However, some Nkx6.1-positive cells remained present, suggesting that the antibody recognizes both Nkx6.1 and Nkx6.2 proteins. We tested this hypothesis by co-injecting nkx6.1 and nkx6.2 MOs, which extinguished nearly all Nkx6 antibody labeling in the spinal cord (J) and brain (G). Thus, we infer that the antibody recognizes both Nkx6.1 and Nkx6.2 proteins. Scale bars, 50μm.
ACKNOWLEDGMENTS
We thank Bret Pearson, Chris Doe and Monte Westerfield for comments on earlier versions of the manuscript, Eisen lab members for their support, Richard Dorsky for help with spinal interneuron markers, Ole Madsen for the Nkx6 antibody, the University of Oregon Zebrafish Facility staff for animal husbandry, and Chris Rodesch and the Core Imaging Facility at the University of Utah for help with confocal microscopy. The Islet monoclonal antibody developed by Thomas Jessell and colleagues was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. Supported by NIH grants NS23915, HD22486, and GM007413 and NSF grant DGE9972830.
REFERENCES
- Alanentalo T, Chatonnet F, Karlen M, Sulniute R, Ericson J, Andersson E, Ahlgren U. Cloning and analysis of Nkx6.3 during CNS and gastrointestinal development. Gene Expr Patterns. 2006;6:162–70. doi: 10.1016/j.modgep.2005.06.012. [DOI] [PubMed] [Google Scholar]
- Appel B, Eisen JS. Regulation of neuronal specification in the zebrafish spinal cord by Delta function. Development. 1998;125:371–80. doi: 10.1242/dev.125.3.371. [DOI] [PubMed] [Google Scholar]
- Appel B, Korzh V, Glasgow E, Thor S, Edlund T, Dawid IB, Eisen JS. Motoneuron fate specification revealed by patterned LIM homeobox gene expression in embryonic zebrafish. Development. 1995;121:4117–25. doi: 10.1242/dev.121.12.4117. [DOI] [PubMed] [Google Scholar]
- Cheesman SE, Layden MJ, Von Ohlen T, Doe CQ, Eisen JS. Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and regulate motoneuron formation. Development. 2004;131:5221–32. doi: 10.1242/dev.01397. [DOI] [PubMed] [Google Scholar]
- Eisen JS. Determination of primary motoneuron identity in developing zebrafish embryos. Science. 1991;252:569–72. doi: 10.1126/science.1708527. [DOI] [PubMed] [Google Scholar]
- Eisen JS, Pike SH, Debu B. The growth cones of identified motoneurons in embryonic zebrafish select appropriate pathways in the absence of specific cellular interactions. Neuron. 1989;2:1097–104. doi: 10.1016/0896-6273(89)90234-1. [DOI] [PubMed] [Google Scholar]
- Higashijima S, Hotta Y, Okamoto H. Visualization of cranial motor neurons in live transgenic zebrafish expressing green fluorescent protein under the control of the islet-1 promoter/enhancer. J Neurosci. 2000;20:206–18. doi: 10.1523/JNEUROSCI.20-01-00206.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hutchinson SA, Eisen JS. Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity. Development. 2006 doi: 10.1242/dev.02355. [DOI] [PubMed] [Google Scholar]
- Inoue A, Takahashi M, Hatta K, Hotta Y, Okamoto H. Developmental regulation of islet-1 mRNA expression during neuronal differentiation in embryonic zebrafish. Dev Dyn. 1994;199:1–11. doi: 10.1002/aja.1001990102. [DOI] [PubMed] [Google Scholar]
- Jurata LW, Thomas JB, Pfaff SL. Transcriptional mechanisms in the development of motor control. Curr Opin Neurobiol. 2000;10:72–9. doi: 10.1016/s0959-4388(99)00053-7. [DOI] [PubMed] [Google Scholar]
- Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995;203:253–310. doi: 10.1002/aja.1002030302. [DOI] [PubMed] [Google Scholar]
- Kimura Y, Okamura Y, Higashijima S. alx, a zebrafish homolog of Chx10, marks ipsilateral descending excitatory interneurons that participate in the regulation of spinal locomotor circuits. J Neurosci. 2006;26:5684–97. doi: 10.1523/JNEUROSCI.4993-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Korzh V, Edlund T, Thor S. Zebrafish primary neurons initiate expression of the LIM homeodomain protein Isl-1 at the end of gastrulation. Development. 1993;118:417–25. doi: 10.1242/dev.118.2.417. [DOI] [PubMed] [Google Scholar]
- Lewis KE, Eisen JS. From cells to circuits: development of the zebrafish spinal cord. Prog Neurobiol. 2003;69:419–49. doi: 10.1016/s0301-0082(03)00052-2. [DOI] [PubMed] [Google Scholar]
- Lewis KE, Eisen JS. Paraxial mesoderm specifies zebrafish primary motoneuron subtype identity. Development. 2004;131:891–902. doi: 10.1242/dev.00981. [DOI] [PubMed] [Google Scholar]
- Myers PZ. Spinal motoneurons of the larval zebrafish. J Comp Neurol. 1985;236:555–61. doi: 10.1002/cne.902360411. [DOI] [PubMed] [Google Scholar]
- Park HC, Mehta A, Richardson JS, Appel B. olig2 is required for zebrafish primary motor neuron and oligodendrocyte development. Dev Biol. 2002;248:356–68. doi: 10.1006/dbio.2002.0738. [DOI] [PubMed] [Google Scholar]
- Pfaff S, Kintner C. Neuronal diversification: development of motor neuron subtypes. Curr Opin Neurobiol. 1998;8:27–36. doi: 10.1016/s0959-4388(98)80005-6. [DOI] [PubMed] [Google Scholar]
- Sander M, Paydar S, Ericson J, Briscoe J, Berber E, German M, Jessell TM, Rubenstein JL. Ventral neural patterning by Nkx homeobox genes: Nkx6.1 controls somatic motor neuron and ventral interneuron fates. Genes Dev. 2000;14:2134–9. doi: 10.1101/gad.820400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shirasaki R, Pfaff SL. Transcriptional codes and the control of neuronal identity. Annu Rev Neurosci. 2002;25:251–81. doi: 10.1146/annurev.neuro.25.112701.142916. [DOI] [PubMed] [Google Scholar]
- Thaeron C, Avaron F, Casane D, Borday V, Thisse B, Thisse C, Boulekbache H, Laurenti P. Zebrafish evx1 is dynamically expressed during embryogenesis in subsets of interneurones, posterior gut and urogenital system. Mech Dev. 2000;99:167–72. doi: 10.1016/s0925-4773(00)00473-1. [DOI] [PubMed] [Google Scholar]
- Tokumoto M, Gong Z, Tsubokawa T, Hew CL, Uyemura K, Hotta Y, Okamoto H. Molecular heterogeneity among primary motoneurons and within myotomes revealed by the differential mRNA expression of novel islet-1 homologs in embryonic zebrafish. Dev Biol. 1995;171:578–89. doi: 10.1006/dbio.1995.1306. [DOI] [PubMed] [Google Scholar]
- Trevarrow B, Marks DL, Kimmel CB. Organization of hindbrain segments in the zebrafish embryo. Neuron. 1990;4:669–79. doi: 10.1016/0896-6273(90)90194-k. [DOI] [PubMed] [Google Scholar]
- Tsalik EL, Niacaris T, Wenick AS, Pau K, Avery L, Hobert O. LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system. Dev Biol. 2003;263:81–102. doi: 10.1016/s0012-1606(03)00447-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vallstedt A, Muhr J, Pattyn A, Pierani A, Mendelsohn M, Sander M, Jessell TM, Ericson J. Different levels of repressor activity assign redundant and specific roles to Nkx6 genes in motor neuron and interneuron specification. Neuron. 2001;31:743–55. doi: 10.1016/s0896-6273(01)00412-3. [DOI] [PubMed] [Google Scholar]
- Westerfield M. The Zebrafish Book. University of Oregon Press; Eugene, OR: 2000. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1. Zebrafish have three Nkx6 proteins
(A) Nkx phylogeny demonstrating the three zebrafish Nkx6 proteins uniquely cluster within one node which is distinct from the Nkx2.2 and Nkx1 class of proteins. The PHYLIP software package was employed to create a neighbor joining tree using the Clustal W algorithm. Sequences included in the tree were gathered from GenBank and bootstrap values are indicated. Expression of nkx6.3 mRNA begins at 20 hpf, persists until at least 72 hpf and is limited to a small population of cells posterior to rhombomere 5 in the hindbrain. (B) Alignment of zebrafish Nkx6.1, Nkx6.2 and Nkx6.3 translated amino acid sequences. Dashed (red) line indicates the NK domain and solid (blue) line indicates the homeodomain. (C) Whole mount in situ RNA hybridization reveals nkx6.3 is expressed in a subset of hindbrain cells at 25 hpf. (D) At 36 hpf nkx6.3-expressing cells (purple) are Islet:GFP negative and are located ventral to cells labeled with Islet:GFP (brown, GFP antibody staining). Lateral views, anterior to the left, dorsal to the top. Abbreviations: ov, otic vesicle; sb, somite boundary. Scale bar, 40μM,
Figure S2. Anti-Nkx6 detects both Nkx6.1 and Nkx6.2 proteins
(A-J) 24 hpf embryos, anterior to the left. (A-D; H-J) lateral views, (E-G) dorsal views. The confocal images in E-G were all taken at the same settings to ensure comparability; similarly, the confocal images in H-J were also all taken at the same settings to ensure comparability. The confocal images in H-J show only one side of the spinal cord, thus, there are fewer labeled cells than in the images in A-B, which show whole mount embryos. nkx6.1 (A) and nkx6.2 (B) mRNA are expressed in the ventral spinal cord in similar patterns. Both nkx6.1 and nkx6.2 (C, D) mRNA are expressed in the ventral brain, although the expression patterns are different. Injection of nkx6.1 MO decreased Nkx6.1 antibody labeling in brain (F) and spinal cord (I) compared to controls (E, H). However, some Nkx6.1-positive cells remained present, suggesting that the antibody recognizes both Nkx6.1 and Nkx6.2 proteins. We tested this hypothesis by co-injecting nkx6.1 and nkx6.2 MOs, which extinguished nearly all Nkx6 antibody labeling in the spinal cord (J) and brain (G). Thus, we infer that the antibody recognizes both Nkx6.1 and Nkx6.2 proteins. Scale bars, 50μm.