Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Oct 1.
Published in final edited form as: J Immunol. 2008 Oct 1;181(7):5015–5023. doi: 10.4049/jimmunol.181.7.5015

Calcium/calmodulin-dependent protein kinase (CaMK) IV mediates nucleocytoplasmic shuttling and release of HMGB1 during LPS stimulation of macrophages

Xianghong Zhang *,†, David Wheeler *,†, Ying Tang *, Lanping Guo *, Richard A Shapiro *, Thomas J Ribar ‡, Anthony R Means ‡, Timothy R Billiar *, Derek C Angus §, Matthew R Rosengart *,§
PMCID: PMC2587501  NIHMSID: NIHMS66724  PMID: 18802105

Abstract

The chromatin-binding factor HMGB1 functions as a proinflammatory cytokine and late mediator of mortality in murine endotoxemia. Although serine phosphorylation of HMGB1 is necessary for nucleocytoplasmic shuttling prior to its cellular release, the protein kinases involved have not been identified. To investigate if CaMKIV serine phosphorylates and mediates the release of HMGB1 from macrophages (Mϕ) stimulated with LPS, RAW 264.7 cells or murine primary peritoneal Mϕ were incubated with either STO609 (a CaMKIV kinase inhibitor), KN93 (a CaMKIV inhibitor), or we utilized cells from which CaMKIV was depleted by RNAi prior to stimulation with LPS. We also compared the LPS response of primary Mϕ isolated from CaMKIV +/+ and CaMKIV -/- mice. In both cell types LPS induced activation and nuclear translocation of CaMKIV, which preceded HMGB1 nucleocytoplasmic shuttling. However, Mϕ treated with KN93, STO609 or CaMKIV RNAi prior to LPS showed reduced nucleocytoplasmic shuttling of HMGB1 and release of HMGB1 into the supernatant. In addition, LPS induced serine phosphorylation of HMGB1, which correlated with an interaction between CaMKIV and HMGB1 and with CaMKIV phosphorylation of HMGB1 in vitro. In cells, both HMGB1 phosphorylation and interaction with CaMKIV were inhibited by STO609 or CaMKIV RNAi. Similarly, whereas CaMKIV +/+ Mϕ showed serine phosphorylation of HMGB1 in response to LPS, this phosphorylation was attenuated in CaMKIV -/- Mϕ. Collectively, our results demonstrate that CaMKIV promotes the nucleocytoplasmic shuttling of HMGB1 and suggest that the process may be mediated through CaMKIV-dependent serine phosphorylation of HMGB1.

Keywords: monocytes/macrophages, lipopolysaccharide, inflammation, signal transduction

HMGB1 was initially identified as an architectural chromatin-binding factor that bends DNA and directs protein assembly on specific DNA targets. Recently it has been demonstrated to function as a proinflammatory cytokine and late mediator of mortality in murine endotoxemia and sepsis.(1-3) HMGB1 appeared 8 h post-stimulation and plateaued at 16 to 32 h, a time-course very distinct from the acute rise and fall of early mediators of severe sepsis and septic shock (TNFα, IL-1β).(3) Recombinant HMGB1 mimicked the lethality of high-dose LPS and induced the release of TNFα by macrophages (Mϕ).(3) Anti-HMGB1 antibodies conferred a dose-dependent protection in animal models of endotoxemia, even when the first dose of anti-HMGB1 antibodies was delayed for at least 2 h.(2, 3) Human studies have revealed that systemic HMGB1 levels are markedly elevated in patients that die of sepsis and during hemorrhagic shock.(4, 5)

In the context of sepsis, current data indicate that HMGB1 is released by activated monocytes and Mϕ via an active process that involves shuttling the protein from nucleus to cytoplasm.(3, 6, 7) Acetylation of HMGB1 and of the histones to which it binds appears to be essential for its release.(8) HMGB1 contains two nuclear localization signals (NLS) and two putative nuclear export signals, suggesting that HMGB1 shuttles between the nucleus and cytoplasm through a tightly controlled mechanism.(6) Recently, serine phosphorylation has been demonstrated to be a requisite step for this process, although neither the kinase nor the mechanisms controlling nucleocytoplasmic shuttling have been identified.(9) Considering the data suggesting the HMGB1 may serve as a target to reduce mortality from sepsis, identifying the mechanisms responsible for inducing and controlling its release is important.

We have recently demonstrated the integral role for members of the family of multifunctional calcium/calmodulin-dependent protein kinases (CaMKI, II, IV) in the release of HMGB1 by hepatocytes subjected to oxidant stress and hepatocellular injury in an in vivo model of hepatic ischemia/reperfusion (I/R) although have yet to identify the specific members involved.(10) The multifunctional CaMKs are serine/threonine kinases sensitive to changes in intracellular [Ca2+] that coordinate a variety of cellular functions, including gene expression, cell cycle progression, apoptosis, differentiation, and ischemic tolerance.(11, 12) Whereas isoforms of CaMKI and CaMKII are expressed in all mammalian cells, CaMKIV is present in only selective tissues, which include the bone marrow.(13) CaMKIV is activated and translocates into the nucleus upon its phosphorylation by an upstream CaMKK in the cytoplasm.(14, 15) The nuclear, autonomously active form of CaMKIV phosphorylates a number of proteins involved in the regulation of transcription.(16) In addition, it has recently been shown that CaMKIV is a component of a signaling cascade initiated by LPS activation of TLR4 that facilitates survival of dendritic cells by phosphorylating CREB and regulating expression of the Bcl-2 gene.(17) These observations suggested to us that CaMKIV would be an attractive candidate kinase to phosphorylate HMGB1 in macrophages and facilitate its translocation from nucleus to cytoplasm in response to LPS.

MATERIALS AND METHODS

Reagents

Escherichia coli 0111:B4 LPS was obtained from Sigma (St. Louis, MO). KN93, obtained from Calbiochem (San Diego, CA), was dissolved in sterile dimethyl sulfoxide (DMSO) at a concentration of 10 mM. STO690 was obtained from Calbiochem (San Diego, CA). STO609 is selective for CaMKK: it has an in vitro IC50 of 0.13-0.38 uM for CaMKK and 32 uM for CaMK II with little or no inhibition of CaMKI, CaMKIV, PKA, PKC, ERK, or myosin light chain kinase.(18) Monoclonal antibody against autonomously active, threonine196-phosphorylated CaMKIV (anti-p-Thr196-CaMKIV) was the generous gift of Dr. Naohito Nozaki (Kanagawa, Japan). Antibodies against total CaMKIV and HMGB1 were obtained from Abcam (Cambridge, MA). Antibody against phosphoserine was obtained from Promega (Madison, WI). Antibody against FLAG epitope was obtained from Sigma Aldrich (St. Louis, MO). DAPI was obtained from Molecular Probes (Carlsbad, CA).

Cell isolation and treatment

Murine monocyte/macrophage-like cells (RAW 264.7, American Type Culture Collection, Rockville, MD) were grown in DMEM (BioWhitaker, Walkersville, MD) supplemented with 10% fetal calf serum (Sigma, San Diego, CA), 50 U/ml penicillin, and 50 μg/ml streptomycin (Cellgro Mediatech Inc., Kansas City, MO). Primary murine peritoneal Mϕ were isolated by lavaging the peritoneal cavity with 5-3 ml aliquots of sterile PBS. After centrifugation at 300 g for 10 min the Mϕ were resuspended in RPMI with 10% FCS, 50 U/ml penicillin, and 50 μg/ml streptomycin. Selected cells were pretreated with varying concentrations of KN93 (5, 10, 20 uM) or STO609 (1, 2, 5, 10, 20 uM) for 1 h or subjected to RNAi using non-target or CaMKIV siRNA (see below). Selected cells were then treated with increasing doses of LPS (1, 10, 100 ng/ml).

Transfection of fluorescein-labeled cyclophilin, non-target, and CaMK IV siRNA

RAW 264.7 cells (2 × 104) or murine peritoneal Mϕ (1 × 105) were plated in 0.5 ml of growth medium (without antibiotics) in each well of a 24-well plate, resulting in 30% or 80% confluence, respectively. Fluorescein-labeled cyclophylin control siRNA, non-target siRNA, and CaMKIV siRNA obtained from Dharmacon (Lafayette, Colorado) was added to 50 μl serum-free DMEM in a final concentration of 25 nM. We utilized the Smartpool siRNA from Dharmacon that incorporates 4 separate siRNA sequences for CaMKIV: 5′GAGAUCCUCUGGGCGAUUUUU3′, 5′UCAAGGAAAUAUUCGAAACUU3′, 5′GGUGCUACAUCCAUUGUGUUU3′, 5′GGGAUGAAGUGUCUUUAAAUU3′. In a separate tube, 3 μl Hiperfect were diluted in 50 μl serum-free DMEM and incubated at room temperature (RT) for 5 min. These two solutions were combined, and the final transfection mixture was incubated for 20 min at room temperature. This transfection mixture was applied to each well and incubated for 6 h, after which it was replaced by 500 μl of cell medium and incubated for 72 h. Transfection efficiency was determined at 24 h by fluorescence microscopy. For each experiment at least three microscopic visual fields (200X magnification) were counted to facilitate calculation of the ratio of fluorescent cyclophilin-expressing cells to non-fluorescent cells. Inhibition of each targeted protein was determined by immuno-blot or RT-PCR. All experiments and cell number determinations were performed in triplicate.

Plasmid construction and transfection

Plasmids encoding a constitutively active CaMKIV (CaMKIV-dCT) or a kinase-inactive CaMKIV-dCTK75E mutant were the generous gifts of Dr. Douglas Black.(19) CaMKIV-dCT contains a C-terminally truncated version of the human CaMKIV-encoding gene, truncated to Leu-317, and a N-terminal FLAG epitope.(19, 20) CaMKIV-dCTK75E was constructed by changing lysine 75 to glutamate in CaMKIV-dCT, which negatively affects ATP-binding at the catalytic site.(19, 20) For transient transfection, RAW 264.7 cells were seeded in a 24-well plate at 3 × 105 cells/well. After 2 h of adhesion, Mϕ were transfected with 1 ug of plasmid CaMKIV-dCT or CaMKIV-dCTK75E using the Lipofectamine 2000 reagent according to the instructions specified by the manufacturer (Life Technologies, Carlsbad, CA). Following transfection, cells were handled as detailed in the figure legends.

Cellular protein extraction

Total cellular protein was extracted at 4° C in 500 μl of lysis buffer (20 mM Tris, 137 mM NaCl, 2 mM EDTA, 10% glycerol, 1% Triton X-100, 1 μM sodium orthovanadate, 100 μM dithiothreitol [DTT], 200 μM phenylmethylsulfonyl fluoride [PMSF], 10 μg/ml leupeptin, 0.15 U/ml aprotinin, 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 2.5 μg/ml pepstatin A, 1 mM benzamidine, and 40 mM [alpha]-glycerophosphate). Protein concentration was determined using a bicinchoninic acid protein assay (Pierce, Rockford, IL).

Nuclear and cytoplasmic protein isolation

Cells were harvested and washed with PBS, followed by centrifugation at 300 g for 10 min. The cell pellet was lysed with NE-PER nuclear and cytoplasmic extraction reagent according to the instructions specified by the manufacturer (Thermo Scientific, Rockford, IL).

Immunoprecipitation

Equal amounts of cellular protein obtained from each experimental condition were used for immunoprecipitation. Five ul of antibody was added to 500 ug of isolated cellular protein within lysis buffer and incubated at 4° C overnight on a rotator. Fifty ul of 50% slurry of pre-washed protein G-agarose beads (Abcam, San Diego, CA) were then added to each sample, followed by incubation for an additional 2 h at 4° C. The samples were spun briefly in a microcentrifuge at 14,000 rpm and washed 4 times in lysis buffer. Samples were then resuspended in 30 μl of lysis buffer for future analysis.

Immuno-blots

Total cellular protein was electrophoresed in a 10% SDS-PAGE gel and transferred to a Hybond-enhanced chemiluminescence nitrocellulose membrane (Amersham Pharmacia Biotech, Piscataway, NJ). The membrane was blocked for 1 h at room temperature with 5% milk and was then incubated with primary antibody for 12 h at 4° C. Blots were then incubated in a horseradish peroxidase-conjugated secondary antibody against the primary antibody at room temperature for 1 h. The blot was developed using the SuperSignal chemiluminescent substrate (Pierce, Rockford, IL) and exposed on KAR-5 film (Eastman Kodak, Rochester, NY). In addition to utilizing the primary anti-threonine phosphorylated (Thr196) CaMKIV antibody, the active threonine phosphorylated form of CaMKIV was determined using CaMK-immunoprecipitated protein. Densitometry was performed by the NIH image program (National Institutes of Health, Bethesda, MD) to quantify optical density.

Immunocytochemistry and confocal microscopy

Cells were cultured on glass coverslips until 80% confluent. The coverslips were washed in PBS and fixed for 20 min in 4% paraformaldehyde in PBS at 4° C. Cells were permeabilized with 5% BSA, 0.1% Triton-X100 for 1 h at 4° C and then stained with the appropriate antibody (1 ug/ml) overnight at 4° C. Cells were further treated with anti-rabbit IgG conjugated with FITC (1:1000), anti-mouse IgG conjugated with TRITC (1:1000), and DAPI (5 mg/mL) in 5% non-fat milk for an additional 2 h at room temperature. The cells were then washed 4 times with PBS, mounted with gel-mount (Biomeda, Foster City CA) and examined by confocal microscopy.

In vitro kinase assay

Recombinant HMGB1 (1 ug) was incubated in the presence or absence of activated p-Thr196-CaMKIV (25 ng) for 10 min at 30° C with the following additions: 10 mM MgCl2, 0.2 mM ATP, 1 mM CaCl2, and 1 uM CaM. Reactions were terminated by boiling in SDS-β-mercaptoethanol dissociation solution, subjected to 10% SDS-PAGE, and probed with anti-phosphoserine, anti-CaMKIV or anti-HMGB1 antibody.

Cell viability and morphologic features

Representative cell populations from each condition were examined under light microscopy. Cell viability was also confirmed by MTT assay. Cells were incubated in 96-well plates (Costar). After a 24-h incubation in 100 ul RPMI medium containing the stimulus, 50 ul of a 5 mg/ml MTT (Sigma) solution in PBS were added, and cells were incubated at 37° C for 2 h. The cells were then lysed by addition of 100 ul per well extraction buffer (20% (w/v) SDS, 50% (v/v) N, N-dimethyl formamide, 2% (v/v) acetic acid, pH 4.7). After overnight incubation with extraction buffer, the optical density (OD) at 562 nm was measured.

Statistic analysis

Values are expressed as mean ± sem. Groups are compared by Mann-Whitney. A p<0.05 was considered statistically significant.

RESULTS

LPS activates CaMKIV

The phosphorylation of CaMKIV on Thr196 generates an autonomously active p-CaMK IV.(11) We first established the time course for CaMKIV activation in RAW 264.7 cells following LPS stimulation. LPS activated CaMKIV with Thr196 phosphorylation occurring at 15 min and returning toward baseline by 60 min after stimulation (Figure 1, panel A). Upstream inhibition of CaMKIV kinase with STO609 prevented CaMKIV phosphorylation (Figure 1, panel A). We did observe two bands in our assessment of CaMKIV phosphorylation, and two CaMKIV isoforms have been described.(21) This time course of CaMKIV phosphorylation was consistent across all independent experiments, yielding a mean CaMKIV activation time course that peaked 15 to 30 min after LPS (Figure 1, panel B). We repeated these experiments with primary peritoneal Mϕ. LPS induced Thr196-phosphorylation of CaMKIV within 15 to 30 min (Figure 1, panel C). However, even at 60 min after LPS exposure CaMKIV remained phosphorylated. Again, CaMKIV activation was dependent upon CaMKIV kinase, as inhibition with STO609 markedly reduced the LPS-induced increase in p-Thr196-CaMKIV (data not shown).

Figure 1. LPS activates CaMKIV.

Figure 1

Open in a new tab

A, RAW 264.7 cells were treated with LPS (10 ng/ml) for the durations of 15, 30, 60 and 120 min at which time total cell lysate was harvested, subjected to immuno-blot analysis, and probed for p-Thr196-CaMKIV. Parallel populations were treated with STO609 (5 uM) for 1 h prior to LPS stimulation and subjected to similar immuno-blot analysis. Each blot was stripped and re-probed with anti-CaMKIV antibody to confirm equal loading. Representative blot of 3 individual experiments. B, Densitometry represents mean ± sem optical density of individual p-Thr196-CaMKIV immuno-blots (n=3); *p<0.05 vs. control, unstimulated cells. C, Murine peritoneal Mϕ were exposed to similar experimental conditions and p-Thr196-CaMKIV and total CaMKIV were assessed by SDS-PAGE as previously described. Representative blot of 3 individual experiments. Densitometry represents mean ± sem optical density of individual p-Thr196-CaMKIV immuno-blots (n=3); *p<0.05 vs. control, unstimulated cells.

The CaM kinase cascade mediates LPS-induced HMGB1 release

Consistent with previous studies we found that LPS induced the release of HMGB1 by RAW 264.7 cells, with detectable concentrations of supernatant HMGB1 occurring as early as 8 h (data not shown) and peaking at 16 h after LPS stimulation as shown (Figure 2, panel A, lanes 1 and 2). Incubation with STO609 markedly reduced supernatant HMGB1 concentration (Figure 2, panel A, lane 3). As shown in Figure 2 (panel B) the HMGB1 release was not due to differential cell death since similar cell viability was observed for treated cell populations.

Figure 2. CaMK kinase cascade mediates LPS-induced HMGB1 release.

Figure 2

Open in a new tab

A, RAW 264.7 cells were treated with LPS (100 ng/ml) for 16 h at which time cellular supernatant was harvested, subjected to immuno-blot analysis, and probed for HMGB1. Parallel populations were pretreated with STO609 (5 uM) for 1 h prior to LPS stimulation and subjected to similar immuno-blot analysis. Representative blot of 3 individual experiments. B, RAW 264.7 cells were subjected to similar conditions as described above. Cell viability was evaluated by MTT assay and is shown as mean ± sem fold change relative to control, untreated cell population (n=4). C, Murine peritoneal Mϕ were isolated and treated with LPS and STO609 as previously described. The supernatant was harvested, subjected to western blot analysis, and probed for HMGB1. Representative blot of 3 individual experiments.

We confirmed that the CaM kinase cascade also mediated LPS-induced HMGB1 release in primary peritoneal Mϕ. Similar to RAW 264.7 cells, LPS induced HMGB1 release by peritoneal Mϕ that was inhibited by upstream CaM kinase inhibition with STO609 (Figure 2, panel C)

CaMKIV mediates LPS-induced HMGB1 release

The previous observations suggested that the CaM kinase cascade is integral to LPS-induced Mϕ HMGB1 release. We utilized RNAi to study the individual role of downstream CaMKIV in these events. As determined by fluorescent microscopy, cell transfection with fluorescent cyclophilin B siRNA was efficacious (Figure 3, panel A) and, as determined by SDS-PAGE, CaMKIV RNAi markedly reduced CaMKIV expression (Figure 3, panel B). Control, non-target RNAi-treated cells released HMGB1 in response to LPS similar to untreated RAW 264.7 cells and peritoneal Mϕ (Figure 3, panel C, lanes 1 and 2). By contrast, CaMKIV RNAi almost completely inhibited LPS-induced HMGB1 release (Figure 3, panel C, lanes 3 and 4). The effects of CaMKIV RNAi were not related to cell death as the MTT assay demonstrated similar viability for all cells regardless of how they were treated (Figure 3, panel D).

Figure 3. CaMKIV mediates LPS-induced HMGB1 release.

Figure 3

Open in a new tab

A, RAW 264.7 cells were transfected with fluorescent cyclophin B siRNA for 24 h and imaged by confocal microscopy. Transfection efficiency was determined by determining the ratio of fluorescent cells to total number of cells. B, RAW 264.7 cells were transfected with either non-target (NT) or CaMKIV siRNA for 72 h, at which time total cell lysate was harvested, subjected to immuno-blot analysis, and probed for CaMKIV. Representative blot of 3 individual experiments. C, RAW 264.7 cells were transfected with either NT or CaMKIV siRNA for 72 h and then stimulated with LPS (100 ng/ml) for 16 h. The supernatant was harvested, subjected to immuno-blot analysis, and probed for HMGB1. Representative blots of 3 individual experiments. D, RAW 264.7 cells were subjected to similar conditions as described above. Cell viability was evaluated by MTT assay and is shown as mean ± sem fold change relative to control, untreated cell population (n=4).

CaMKIV mediates nuclear export of HMGB1 after LPS stimulation

HMGB1 release is an active process by which HMGB1 is shuttled from nucleus to cytoplasm and then out of the cell. Because most of the identified functions of CaMKIV occur within the nucleus, we hypothesized that CaMKIV plays an integral role in the translocation of HMGB1 from nucleus to cytoplasm. We initially explored the spatial and temporal relationships of CaMKIV phosphorylation and HMGB1 release. As shown in Figure 4, HMGB1 (green) is predominantly intranuclear under basal, unstimulated conditions (Figure 4, top row). Within 120 min of LPS stimulation, HMGB1 is observed within the cytoplasm and continues to increase within the cytoplasm over the ensuing 8 h (Figure 4, top row). Unstimulated RAW 264.7 cells demonstrate minimal CaMKIV Thr196 phosphorylation (red), but within 15 min of LPS stimulation, phosphorylation increases and continues to increase with time, peaking at 120 min after LPS stimulation (Figure 4, middle row). Though some active CaMKIV is apparent within the cytoplasm, most of this p-Thr196-CaMKIV seems to be concentrated within the nucleus. This localization appears to result from translocation of active CaMKIV to the nucleus as demonstrated by the increased fluorescence of both p-Thr196-CaMKIV (Figure 4, panel A, middle row) and total CaMKIV (Figure 4, panel B, top row) within the nucleus after LPS stimulation. Inhibition of CaMKIV kinase with STO609 inhibits the Thr196 phosphorylation of CaMKIV and the translocation of HMGB1 to the cytoplasm (Figure 4, panel A, last column).

Figure 4. Spatial and temporal relationship of LPS-induced CaMKIV Thr196 phosphorylation and HMGB1 nucleocytoplasmic shuttling.

Figure 4

Figure 4

Open in a new tab

A, RAW 264.7 cells were stimulated with LPS (100 ng/ml) for 15 min, 1, 2, and 8 h at which time they were fixed, permeabilized, stained for HMGB1 (green) or p-Thr196-CaMKIV (red), and imaged by confocal microscopy at 630X. Green, HMGB1; red, p-Thr196-CaMKIV; blue, DAPI. Representative image of 3 individual experiments. B, RAW 264.7 cells were subjected to similar conditions as described above, stained for total CaMKIV, and imaged by confocal microscopy at 630X. red, CaMKIV; blue, DAPI. Representative image of 3 individual experiments.

To confirm that this translocation process was CaMKIV-dependent we conducted similar experiments using cells treated with CaMKIV RNAi. RAW 264.7 cells transfected with control, non-target siRNA demonstrated nucleocytoplasmic shuttling of HMGB1 (green) at 8 h after LPS stimulation (Figure 5, panel A, left). On the other hand, CaMKIV RNAi inhibited LPS-induced HMGB1 translocation with strong nuclear and minimal cytoplasmic staining of HMGB1 at 8 h after LPS stimulation (Figure 5, panel A, right). This inhibition was similar to that induced by pretreatment with the CaMKIV kinase inhibitor STO609 (Figure 4, panel A, last column).

Figure 5. CaMKIV mediates HMGB1 nucleocytoplasmic shuttling.

Figure 5

Open in a new tab

A, RAW 264.7 cells underwent RNAi using non-target (NT) siRNA or CaMKIV siRNA. Cells were stimulated with LPS (100 ng/ml) for 8 h and then fixed, permeabilized, stained for HMGB1 (green) and imaged by confocal microscopy at 630X. Green, HMGB1; blue, DAPI. Representative image of 3 individual experiments. B, RAW 264.7 cells were subjected to STO609 (5 uM) or KN93 (10 uM) or underwent NT or CaMKIV RNAi prior to stimulation with LPS (100 ng/ml) as detailed above. Nuclear and cytoplasmic protein were isolated, subjected to immuno-blot analysis, and probed for HMGB1. Representative blot of 3 separate experiments.

We confirmed these immunofluorescent microscopic observations by analyzing the HMGB1 concentration of nuclear and cytoplasmic protein isolated from Mϕ subjected to similar conditions as detailed above. As shown in Figure 5, panel B, LPS induced the translocation of HMGB1 from the nucleus to the cytoplasm. By comparison to LPS-stimulated Mϕ, there was a significant reduction in HMGB1 translocation to the cytoplasm in response to either KN93 (which inhibits CaMKIV) or STO609 (which inhibits CaMKIV kinase) (Figure 5, panel B). Similarly, by comparison to control, non-target RNAi, CaMKIV RNAi reduced the LPS-induced nucleocytoplasmic shuttling of HMGB1 (Figure 5, panel B). These results confirm our idea that a CaMKK/CaMKIV cascade regulates LPS-induced nuclear to cytoplasmic translocation of HMGB1.

CaMKIV directly serine phosphorylates HMGB1 after LPS stimulation

Our results demonstrate that CaMKIV mediates LPS-induced HMGB1 release, in part, through processes guiding the nuclear exportation of HMGB1. Recently, HMGB1 translocation to the cytoplasm has been demonstrated to require serine phosphorylation within its NLSs.(9) We first confirmed that LPS-induced serine phosphorylation of HMGB1. As shown in Figure 6, panel A, stimulation of RAW 264.7 cells with LPS results in serine phosphorylation of HMGB1 within 2 h. In addition, this phosphorylation event may require CaMKIV, as preincubation of primary peritoneal Mϕ with STO609 inhibited LPS-induced serine phosphorylation of HMGB1 (Figure 6, panel B). Similarly, CaMKIV RNAi treatment of Mϕ also reduced LPS-induced HMGB1 serine phosphorylation (Figure 6, panel B) and the mean degree of inhibition determined by densitometry is illustrated in Figure 6, panel C. Finally, we compared the degree of serine phosphorylated HMGB1 in peritoneal Mϕ isolated from either CaMKIV +/+ or CaMK IV -/- mice. As shown in Figure 6, panel D, control CaMKIV +/+ Mϕ show serine phosphorylation of HMGB1 after LPS stimulation, whereas the extent of this induced HMGB1 phosphorylation is reduced in CaMKIV -/- Mϕ.

Figure 6. CaMKIV mediates serine phorphorylation of HMGB1.

Figure 6

Open in a new tab

A, RAW 264.7 cells were stimulated with LPS (100 ng/ml) for 15 min and 1, 2, and 4 h at which point total cell lysate was harvested, immunoprecipitated for HMGB1, subjected to immuno-blot analysis, and probed for phosphorylated serine residues. Each membrane was stripped and probed with anti-HMGB1 antibody to confirm equal loading. B, Murine peritoneal Mϕ were stimulated with LPS (100 ng/mL) for 2 h either in the presence or absence of STO609 (5 uM) or after CaMKIV RNAi. Total cell lysate was harvested, immunoprecipitated for HMGB1, subjected to immuno-blot analysis, and probed for phosphorylated serine residues. Each membrane was stripped and probed with anti-HMGB1 antibody to confirm equal loading. C, Densitometry represents mean ± sem optical density of individual phosphoserine HMGB1 immuno-blots (n=4); *p<0.05 vs. LPS stimulated Mϕ; #p<0.05 vs. LPS stimulated non-target RNAi Mϕ. D, Peritoneal Mϕ, isolated from CaMKIV -/- or CaMKIV +/+ mice were exposed to LPS 100 ng/ml for 2 h at which point total cell lysate was harvested, immunoprecipitated for phosphoserine, subjected to immuno-blot analysis, and probed for HMGB1.

Our immunocytochemistry data suggest colocalization of CaMKIV and HMGB1 after LPS stimulation, and hence, we investigated whether CaMKIV interacts with HMGB1. As shown in Figure 7, panel A, LPS stimulation markedly increased the degree to which HMGB1 co-immunoprecipitated with CaMKIV. One hour after stimulation with LPS, CaMKIV and HMGB1 co-immunoprecipitation was markedly increased and peaked by 2 h. Reciprocal co-immunoprecipitation experiments yielded similar results (data not shown). These LPS-stimulated interactions likely require the phosphorylation and activation of CaMKIV, as preincubation of cells with STO609 prior to addition of LPS inhibited the co-immunoprecipitation of HMGB1 with CaMKIV (Figure 7, panel A).

Figure 7. CaMKIV directly serine phosphorylates HMGB1.

Figure 7

Open in a new tab

A, RAW 264.7 cells were stimulated with LPS (100 ng/ml) either in the presence or absence of STO609 (5 uM) for 1, 2, and 4 h at which point total cell lysate was harvested, immunoprecipitated for HMGB1, subjected to immuno-blot analysis, and probed for CaMKIV. Representative blot of 3 separate experiments. B, Recombinant HMGB1 (1 ug) was incubated in the presence or absence of activated p-Thr196-CaMKIV (25 ng) for 10 min at 30° C with the following additions: 10 mM MgCl2, 0.2 mM ATP, 1 mM CaCl2, and 1uM CaM. Reactions were terminated by boiling in SDS-β-mercaptoethanol dissociation solution, subjected to 10% SDS-PAGE, and probed with anti-phosphoserine antibody. Representative blot of 3 separate experiments.

To determine whether CaMKIV could directly serine phosphorylate HMGB1 we conducted in vitro kinase assays. Active p-Thr196-CaMKIV was unable to phosphorylate HMGB1 in the absence of Mg2+/ATP (Figure 7, lane 1). Similarly, in the absence of p-Thr196-CaMKIV, there was minimal serine phosphorylation of HMGB1 (Figure 7, lane 2). However, activated p-Thr196-CaMKIV, in combination with Mg2+/ATP, was able to serine phosphorylate HMGB1 (Figure 7, lane 4).

Active CaMKIV is sufficient for HMGB1 release

To assess whether active CaMKIV is sufficient for HMGB1 release, we transfected RAW 264.7 cells with plasmids expressing either a truncated, constitutively active form of CaMKIV (CaMKIV-dCT) or a similarly truncated kinase-inactive mutant of CaMKIV (CaMKIV-dCTK75E). Both plasmids were successfully transfected and expressed, although expression of the active CaMKIV-dCT was greater than that of CaMKIV-dCTK75E (Figure 8, panel A), confirming previously published observations that substitutions that disrupt kinase activity, including K75E, result in less protein expression in mammalian cells compared to wild type CaMKIV-dCT (Figure 8, panel A).(20) As shown in Figure 8 (panel B) expression of the active CaMKIV-dCT induced the secretion of HMGB1 from the cells whereas CaMKIV-dCTK75E failed to do so (Figure 8, panel B). This two-fold induction of HMGB1 release in response to CaMKIV-dCT was highly reproducible in 3 independent experiments (Figure 8, panel C).

Figure 8. Active CaMKIV is sufficient for HMGB1 release.

Figure 8

Open in a new tab

A, RAW 264.7 cells were transfected with either a constitutively active CaMKIV-dCT or a kinase-dead mutant CaMKIV-dCTK75E. Eight hours later total cell lysate or nuclear protein were isolated, resolved by SDS-PAGE, and probed for kinase expression using an anti-FLAG antibody. Representative blot of 3 separate experiments. B, RAW 264.7 cells were transfected with the indicated kinase construct as detailed above. After 24 h the supernatant was harvested, resolved by SDS-PAGE, and probed with an anti-HMGB1 antibody. Representative blot of 3 separate experiments. C, Densitometry represents mean ± sem optical density of individual supernatant HMGB1 immuno-blots (n=3); *p=0.03 vs. CaMKIV-dCTK75E.

DISCUSSION

During sepsis, perturbations in cellular calcium homeostasis are postulated to mediate the aberrant inflammation underlying organ dysfunction and death.(22, 23) Recently, HMGB1, an architectural chromatin-binding factor that bends DNA and directs protein assembly on specific DNA targets, has been demonstrated to function as a late mediator of mortality in murine endotoxemia and sepsis.(1-3) Monocytes and Mϕ have been demonstrated to be a primary source of HMGB1, and evidence is accumulating that production of this inflammatory mediator is Ca2+-dependent. Here, we characterize that LPS-induced HMGB1 release is mediated by a Ca2+-dependent signaling cascade involving a CaMKIV kinase and CaMKIV. Our data suggest that this series of reactions may terminate in the nucleus where CaMKIV phosphorylates HMGB1, an event that is required to facilitate the translocation of HMGB1 from nucleus to cytoplasm.(24)

Substantial work has been conducted to elucidate the mechanisms by which HMGB1 is released, in part, because interventions that inhibit systemic HMGB1 concentrations reduce mortality in murine models of sepsis.(2) Current data support an active process initiated by HMGB1-histone disengagement, HMGB1 hyperacetylation, and shuttling of the protein from nucleus to cytoplasm.(6) Recently, serine phosphorylation of HMGB1 has been demonstrated to be essential for this translocation event, though the kinase responsible had not been identified.(9) We hypothesized that CaMKIV mediates this process, in part, because this enzyme has been shown to function downstream of TLR4 in the pathway by which LPS induces the Ca2+-dependent survival of dendritic cells.(17) In addition, prior studies demonstrated that activation of CaMKIV by Ca2+/CaM and threonine phosphorylation (Thr196 in mice, Thr200 in humans) by an upstream CaMK kinase generates increased and autonomous CaMKIV activity that enables the kinase to translocate to the nucleus where it modulates gene expression.(11, 25, 26)

Indeed, our data demonstrate that LPS induces this Thr196-phosphorylated and autonomous species of CaMKIV in Mϕ, which then enters the nucleus where it interacts with and phosphorylates HMGB1. The evidence to support this contention is as follows: 1) CaMKIV translocation to the nucleus preceded HMGB1 translocation to the cytoplasm; 2) CaMKIV RNAi reduced cytoplasmic HMGB1 concentration by retaining HMGB1 in the nucleus; 3) CaMKIV co-immunoprecipitated with HMGB1 in response to LPS; and 4) activated CaMKIV directly phosphorylated HMGB1 in in vitro kinase assays. The modest degree of HMGB1 phosphorylation observed in our in vitro kinase assay suggests that, perhaps, additional protein components may be necessary to assemble a signaling complex that facilitates CaMKIV phosphorylation of HMGB1. The minimum consensus CaMKIV substrate recognition sequence Hyd-X-R-X-X-(S/T) provides only a rough template for CaMKIV-mediated phosphorylation. In HMGB1 only serines 39 and 46 in NLS1 meet the hydrophobic requirement at the -5 position amino acid, and serine 46 carries a lysine substitution at -3, which is also present in the well-characterized substrate oncoprotein-18.(27)

Interestingly, HMGB1 has two NLS sequences and current evidence suggests that phosphorylation of both sequences is important for the cytoplasmic localization of HMGB1.(9) Our data support a role for CaMKIV in the mechanism that controls the nuclear export of HMGB1.(9) Regarding this mechanism, Bianchi et al contend that the strength of HMGB1-histone binding is inversely related to the histone acetylation status, and that increased histone acetylation may enable HMGB1-histone disengagement and subsequent cellular release of HMGB1.(6, 8) The CaMKs have been demonstrated to modulate the nuclear export of various Class II histone deacetylases HDAC4 and HDAC5, a process that could favor histone acetylation.(28-31) In addition, HMGB1 requires direct hyperacetylation prior to export from the nucleus.(8) Further investigation of how CaMKIV activation and histone and HMGB1 acetylation are related will be an important aspect of future studies on HMGB1 nuclear export.

Although LPS stimulation of TLR4 can clearly activate CaMKIV, as shown here and in a prior study, the signaling events that occur between receptor ligation and CaMKIV activation have yet to be determined.(17) Prior studies have established the dependency of Mo/Mϕ function on Ca2+ transients and CaM activation, and although it remains unclear precisely how the Ca2+ transients are generated, the multifunctional CaMKs respond to relatively small changes in intracellular [Ca2+].(32) Regarding CaMKIV activation and generation of autonomous activity, published data have established a requirement for binding of the Ca2+/CaM complex to both the CaMKK and CaMKIV.(11, 12, 25) We note the presence of nuclear and cytoplasmic activated CaMKIV in resting cells and an increasing concentration of activated and total CaMKIV within the nucleus after LPS stimulation. These observations support an LPS-mediated increase in the cytoplasmic Ca2+ signal that is sufficient to activate CaMKIV and induce its nuclear translocation. Alternatively, it is possible that CaMK may be activated by reactive oxygen species in the absence of a Ca2+ rise. For example, Howe et al suggest that IκB phosphorylation in lymphocytes in response to hydrogen peroxide is mediated by Ca2+-independent activation of CaMKs.(33, 34) Hence, additional studies are necessary to determine the spatiotemporal patterns of Ca2+ signaling and CaMKIV activation following LPS stimulation as well as the TLR4-dependence of such events.

In summary, CaMKIV kinase/CaMKIV mediates Mϕ LPS-induced HMGB1 production by translocating to the nucleus after activation and phosphorylating HMGB1in a manner that enables nuclear export of HMGB1 that must occur in order for the protein to be secreted from the cell. The combined observations of investigations conducted by our labs and others are beginning to highlight the integral role of the CaMK transduction cascade in Mϕ function and cytokine production and inflammation. Future studies will elucidate the sites on both proteins that participate in the CaMKIV-HMGB1 interaction and serine phosphorylation of HMGB1. Interestingly precedent exists for CaMKIV forming a stable complex with PP2A that is competitive with Ca2+/CaM and CaMKKβ, one of the two CaMKKs that has been shown to form stable complexes with CaMKIV and PP2A or AMPK.(15, 35) In the latter but not the former case, the interaction requires the requires the “RP” domain of CaMKKβ.(35) Perhaps, HMGB1 will also utilize a unique sequence of CaMKKβ to form a complex. At any rate, these combined observations suggest that modulation of CaMKK and/or CaMKIV activity may be of potential utility in diseases characterized by heightened and aberrant inflammation.

ACKNOWLEDGEMENTS

Special thanks to Naohito Nozaki, PhD who provided the monoclonal anti-p-Thr196-CaMKIV antibodies and Douglas Black, PhD, who provided the CaMKIV-dCT and CaMKIV-dCTK75E plasmids. Without the gracious assistance of these individuals, a considerable portion of this work would not be possible.

Matthew R. Rosengart was supported by Grant # 1KL2 RR024154-01 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH), and NIH Roadmap for Medical Research. This work was also supported by NIH grant DK074701 to ARM.

REFERENCES

  • 1.Wang H, Yang H, Czura CJ, Sama AE, Tracey KJ. HMGB1 as a late mediator of lethal systemic inflammation. Am J Respir Crit Care Med. 2001;164:1768–1773. doi: 10.1164/ajrccm.164.10.2106117. [DOI] [PubMed] [Google Scholar]
  • 2.Yang H, Ochani M, Li J, Qiang X, Tanovic M, Harris HE, Susarla SM, Ulloa L, Wang H, DiRaimo R, Czura CJ, Wang H, Roth J, Warren HS, Fink MP, Fenton MJ, Andersson U, Tracey KJ. Reversing established sepsis with antagonists of endogenous high-mobility group box 1. Proc Natl Acad Sci U S A. 2004;101:296–301. doi: 10.1073/pnas.2434651100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J, Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ. HMG-1 as a late mediator of endotoxin lethality in mice. Science. 1999;285:248–251. doi: 10.1126/science.285.5425.248. [DOI] [PubMed] [Google Scholar]
  • 4.Angus DC, Yang L, Kong L, Kellum JA, Delude RL, Tracey KJ, Weissfeld L. Circulating high-mobility group box 1 (HMGB1) concentrations are elevated in both uncomplicated pneumonia and pneumonia with severe sepsis. Crit Care Med. 2007;35:1061–1067. doi: 10.1097/01.CCM.0000259534.68873.2A. [DOI] [PubMed] [Google Scholar]
  • 5.Ombrellino M, Wang H, Ajemian MS, Talhouk A, Scher LA, Friedman SG, Tracey KJ. Increased serum concentrations of high-mobility-group protein 1 in haemorrhagic shock. Lancet. 1999;354:1446–1447. doi: 10.1016/S0140-6736(99)02658-6. [DOI] [PubMed] [Google Scholar]
  • 6.Bonaldi T, Talamo F, Scaffidi P, Ferrera D, Porto A, Bachi A, Rubartelli A, Agresti A, Bianchi ME. Monocytic cells hyperacetylate chromatin protein HMGB1 to redirect it towards secretion. Embo J. 2003;22:5551–5560. doi: 10.1093/emboj/cdg516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gardella S, Andrei C, Ferrera D, Lotti LV, Torrisi MR, Bianchi ME, Rubartelli A. The nuclear protein HMGB1 is secreted by monocytes via a non-classical, vesicle-mediated secretory pathway. EMBO Rep. 2002;3:995–1001. doi: 10.1093/embo-reports/kvf198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Scaffidi P, Misteli T, Bianchi ME. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature. 2002;418:191–195. doi: 10.1038/nature00858. [DOI] [PubMed] [Google Scholar]
  • 9.Youn JH, Shin JS. Nucleocytoplasmic shuttling of HMGB1 is regulated by phosphorylation that redirects it toward secretion. J Immunol. 2006;177:7889–7897. doi: 10.4049/jimmunol.177.11.7889. [DOI] [PubMed] [Google Scholar]
  • 10.Tsung A, Klune JR, Zhang X, Jeyabalan G, Cao Z, Peng X, Stolz DB, Geller DA, Rosengart MR, Billiar TR. HMGB1 release induced by liver ischemia involves Toll-like receptor 4 dependent reactive oxygen species production and calcium-mediated signaling. J Exp Med. 2007;204:2913–2923. doi: 10.1084/jem.20070247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Soderling TR. The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem Sci. 1999;24:232–236. doi: 10.1016/s0968-0004(99)01383-3. [DOI] [PubMed] [Google Scholar]
  • 12.Braun AP, Schulman H. The multifunctional calcium/calmodulin-dependent protein kinase: from form to function. Annu Rev Physiol. 1995;57:417–445. doi: 10.1146/annurev.ph.57.030195.002221. [DOI] [PubMed] [Google Scholar]
  • 13.Kitsos CM, Sankar U, Illario M, Colomer-Font JM, Duncan AW, Ribar TJ, Reya T, Means AR. Calmodulin-dependent protein kinase IV regulates hematopoietic stem cell maintenance. J Biol Chem. 2005;280:33101–33108. doi: 10.1074/jbc.M505208200. [DOI] [PubMed] [Google Scholar]
  • 14.Lemrow SM, Anderson KA, Joseph JD, Ribar TJ, Noeldner PK, Means AR. Catalytic activity is required for calcium/calmodulin-dependent protein kinase IV to enter the nucleus. J Biol Chem. 2004;279:11664–11671. doi: 10.1074/jbc.M312613200. [DOI] [PubMed] [Google Scholar]
  • 15.Anderson KA, Noeldner PK, Reece K, Wadzinski BE, Means AR. Regulation and function of the calcium/calmodulin-dependent protein kinase IV/protein serine/threonine phosphatase 2A signaling complex. J Biol Chem. 2004;279:31708–31716. doi: 10.1074/jbc.M404523200. [DOI] [PubMed] [Google Scholar]
  • 16.Chow FA, Anderson KA, Noeldner PK, Means AR. The autonomous activity of calcium/calmodulin-dependent protein kinase IV is required for its role in transcription. J Biol Chem. 2005;280:20530–20538. doi: 10.1074/jbc.M500067200. [DOI] [PubMed] [Google Scholar]
  • 17.Illario M, Giardino-Torchia ML, Sankar U, Ribar TJ, Galgani M, Vitiello L, Masci AM, Bertani FR, Ciaglia E, Astone D, Maulucci G, Cavallo A, Vitale M, Cimini V, Pastore L, Means AR, Rossi G, Racioppi L. Calmodulin-dependent kinase IV links Toll-like receptor 4 signaling with survival pathway of activated dendritic cells. Blood. 2008;111:723–731. doi: 10.1182/blood-2007-05-091173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tokumitsu H, Inuzuka H, Ishikawa Y, Ikeda M, Saji I, Kobayashi R. STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase. J Biol Chem. 2002;277:15813–15818. doi: 10.1074/jbc.M201075200. [DOI] [PubMed] [Google Scholar]
  • 19.Xie J, Black DL. A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels. Nature. 2001;410:936–939. doi: 10.1038/35073593. [DOI] [PubMed] [Google Scholar]
  • 20.Chatila T, Anderson KA, Ho N, Means AR. A unique phosphorylation-dependent mechanism for the activation of Ca2+/calmodulin-dependent protein kinase type IV/GR. J Biol Chem. 1996;271:21542–21548. doi: 10.1074/jbc.271.35.21542. [DOI] [PubMed] [Google Scholar]
  • 21.Sun Z, Means RL, LeMagueresse B, Means AR. Organization and analysis of the complete rat calmodulin-dependent protein kinase IV gene. J Biol Chem. 1995;270:29507–29514. doi: 10.1074/jbc.270.49.29507. [DOI] [PubMed] [Google Scholar]
  • 22.Zaloga GP, Chernow B. The multifactorial basis for hypocalcemia during sepsis. Studies of the parathyroid hormone-vitamin D axis. Ann Intern Med. 1987;107:36–41. doi: 10.7326/0003-4819-107-1-36. [DOI] [PubMed] [Google Scholar]
  • 23.Zaloga GP, Sager A, Black KW, Prielipp R. Low dose calcium administration increases mortality during septic peritonitis in rats. Circ Shock. 1992;37:226–229. [PubMed] [Google Scholar]
  • 24.Sparatore B, Passalacqua M, Patrone M, Melloni E, Pontremoli S. Extracellular high-mobility group 1 protein is essential for murine erythroleukaemia cell differentiation. Biochem J. 1996;320(Pt 1):253–256. doi: 10.1042/bj3200253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tokumitsu H, Soderling TR. Requirements for calcium and calmodulin in the calmodulin kinase activation cascade. J Biol Chem. 1996;271:5617–5622. doi: 10.1074/jbc.271.10.5617. [DOI] [PubMed] [Google Scholar]
  • 26.Corcoran EE, Means AR. Defining Ca2+/calmodulin-dependent protein kinase cascades in transcriptional regulation. J Biol Chem. 2001;276:2975–2978. doi: 10.1074/jbc.R000027200. [DOI] [PubMed] [Google Scholar]
  • 27.White DJ, Maass DL, Sanders B, Horton JW. Cardiomyocyte intracellular calcium and cardiac dysfunction after burn trauma. Crit Care Med. 2002;30:14–22. doi: 10.1097/00003246-200201000-00003. [DOI] [PubMed] [Google Scholar]
  • 28.Miska EA, Langley E, Wolf D, Karlsson C, Pines J, Kouzarides T. Differential localization of HDAC4 orchestrates muscle differentiation. Nucleic Acids Res. 2001;29:3439–3447. doi: 10.1093/nar/29.16.3439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Davis FJ, Gupta M, Camoretti-Mercado B, Schwartz RJ, Gupta MP. Calcium/calmodulin-dependent protein kinase activates serum response factor transcription activity by its dissociation from histone deacetylase, HDAC4. Implications in cardiac muscle gene regulation during hypertrophy. J Biol Chem. 2003;278:20047–20058. doi: 10.1074/jbc.M209998200. [DOI] [PubMed] [Google Scholar]
  • 30.Chawla S, Vanhoutte P, Arnold FJ, Huang CL, Bading H. Neuronal activity-dependent nucleocytoplasmic shuttling of HDAC4 and HDAC5. J Neurochem. 2003;85:151–159. doi: 10.1046/j.1471-4159.2003.01648.x. [DOI] [PubMed] [Google Scholar]
  • 31.McKinsey TA, Zhang CL, Lu J, Olson EN. Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature. 2000;408:106–111. doi: 10.1038/35040593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Anderson KA, Means RL, Huang QH, Kemp BE, Goldstein EG, Selbert MA, Edelman AM, Fremeau RT, Means AR. Components of a calmodulin-dependent protein kinase cascade. Molecular cloning, functional characterization and cellular localization of Ca2+/calmodulin-dependent protein kinase kinase beta. J Biol Chem. 1998;273:31880–31889. doi: 10.1074/jbc.273.48.31880. [DOI] [PubMed] [Google Scholar]
  • 33.Howe CJ, LaHair MM, Maxwell JA, Lee JT, Robinson PJ, Rodriguez-Mora O, McCubrey JA, Franklin RA. Participation of the calcium/calmodulin-dependent kinases in hydrogen peroxide-induced Ikappa B phosphorylation in human T lymphocytes. J Biol Chem. 2002;277:30469–30476. doi: 10.1074/jbc.M205036200. [DOI] [PubMed] [Google Scholar]
  • 34.Howe CJ, Lahair MM, McCubrey JA, Franklin RA. Redox regulation of the calcium/calmodulin-dependent protein kinases. J Biol Chem. 2004;279:44573–44581. doi: 10.1074/jbc.M404175200. [DOI] [PubMed] [Google Scholar]
  • 35.Anderson KA, Ribar TJ, Lin F, Noeldner PK, Green MF, Muehlbauer MJ, Witters LA, Kemp BE, Means AR. Hypothalamic CaMKK2 Contributes to the Regulation of Energy Balance. Cell Metab. 2008;7:377–388. doi: 10.1016/j.cmet.2008.02.011. [DOI] [PubMed] [Google Scholar]

RESOURCES