Abstract
The long-term treatment of tamoxifen (TAM), widely used for adjuvant chemotherapy and chemoprevention for breast cancer, increases a risk of developing endometrial cancer. A high frequency of K-ras mutations has been observed in the endometrium of women treated with TAM. Human DNA polymerase (pol) η and pol κ are highly expressed in the reproductive organs and associate with translesion synthesis past bulky DNA adducts. To explore the miscoding properties of α-(N2-deoxyguanosinyl)tamoxifen (dG-N2-TAM), a major TAM-DNA adduct, site-specifically modified oligodeoxynucleotides containing a single diastereoisomer of trans- or cis-forms of dG-N2-TAM were prepared by phosphoramidite chemical procedure and used as templates. The primer extension reaction catalyzed by pol κΔC, a truncated form of pol κ, extended more efficiently past the adduct than that of pol η by incorporating dCMP, a correct base, opposite the adduct. With pol η, all diastereoisomers of dG-N2-TAM promoted small amounts of direct incorporation of dAMP and deletions. With pol κΔC, dG-N2-TAM promoted small amounts of dTMP and/or dAMP incorporations and deletion. The miscoding properties varied depending on the diastereoisomer of dG-N2-TAM adducts and DNA pol used. Steady-state kinetic studies were also performed using either non-specific sequence or K-ras gene sequence containing a single dG-N2-TAM at the second base of codon 12. With pol η, the bypass frequency past the dA•dG-N2-TAM pair positioned in the K-ras sequence was only 2.3 times lower than that for the dC•dG-N2-TAM pair, indicating that dG-N2-TAM in K-ras sequence has higher miscoding potential than that in the non-specific sequence. However, with pol κΔC, the bypass frequency past the dC•dG-N2-TAM pair was higher than that of the dT•dG-N2-TAM pair in both sequences. The properties of pol η and pol κ are consistent with the mutagenic events attributed to TAM-DNA adducts.
Tamoxifen (TAM, the structure in Fig. 1) is widely used as a first-line endocrine therapy for breast cancer patients who are estrogen receptor positive and is also a prophylactic agent for preventing breast cancer in women at a high risk of this disease. Beside the significant benefit, long-term treatment of TAM in women increases the risk of developing endometrial cancer (1-5).
Fig. 1.
Structures of dG-N2-TAM adduct.
In rats, a high level of TAM-DNA adducts are produced in the liver (6, 7) and initiate the development of hepatocellular carcinomas (8, 9). TAM is converted to several α-hydroxylated metabolites which are in turn O-sulfonated by hydroxysteroid sulfotransferases and react with cellular DNA, resulting in the formation of four diastereoisomers [two trans-forms (fr-1 and fr-2) and two cis-forms (fr-3 and fr-4)] of α-(N2-deoxyguanosinyl)tamoxifen (dG-N2-TAM) and/or α-(N2-deoxyguanosinyl)-N-desmethyltamoxifen (dG-N2-N-desTAM) adducts (Fig. 1) (reviewed by 10). Among the diastereoisomers, a trans-form (fr-2) of dG-N2-TAM and dG-N2-N-desTAM were detected as a major TAM-DNA adduct in rodents (11-13) and monkey (14, 15). TAM-DNA adducts were also detected in the endometrium of women treated with TAM (16-18) although there is some contradiction regarding the detection of TAM-DNA adducts in human tissues (19-22). A high frequency of K-ras mutations was recently observed in the endometrium of women treated with TAM (23); the mutational specificity was consistent with that occurred at the dG-N2-TAM adduct (24). In addition to the genotoxic events, TAM has partial estrogenic activity through the estrogen receptor in endometrial cells and rat uterus (25). This effect may enhance in promoting cancer. Therefore, genotoxic damage and estrogenic activity may cause TAM-induced cancers.
Several human DNA polymerases (pol) are associated with translesion synthesis past DNA adducts (26, 27). Among them, pol η and pol κ lack the 3’-5’ exonuclease activity and as a result, copy DNA templates with low fidelity, thereby increasing the frequency of spontaneous mutations (28, 29) and catalyzing miscoding reactions at several DNA lesions including UV-induced damages (30, 31), 8-oxo-7,8-dihydro-deoxyguanosine (8-oxodG) (32) and 2-acetylaminofluorene (AAF)- (33) and 7,8-dihydroxy-anti-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE)-derived adducts (34). Pol κ also conducts translesion synthesis past abasic sites (35), 8-oxodG (36), 2-AAF- and BPDE-derived adducts (35-39). Both enzymes are highly expressed in human ovary and uterus (40-44) which are highly responsible for the production of steroidal hormones. The activated metabolites of endogenous and synthetic estrogens are suspected to form DNA adducts that are miscoded by such enzymes (40, 41). Due to the structural similarity, the DNA pols may also miscode TAM-DNA adduct during translesion synthesis, increasing the risk of developing cancers in reproductive organs.
In the present study, site-specifically modified oligodeoxynucleotides containing a single diastereoisomer of dG-N2-TAM were used as the DNA template for primer extension reactions catalyzed by pol η or a truncated form of human pol κ (pol κΔC). The miscoding properties of the TAM-DNA adducts were analyzed using an in vitro experimental system that quantifies base substitutions and deletions (45). A phosphoramidite chemical procedure established recently in our laboratory (46) makes it possible to prepare oligodeoxynucleotides containing a single diastereoisomer of dG-N2-TAM adduct into the second base of codon 12 in K-ras gene sequence. Using the modified oligodeoxynucleotide as a template, steady-state kinetic studies were performed to determine the frequency of nucleotide insertion opposite the lesion and chain extension reactions for measuring the relative frequency of translesion synthesis past the dG-N2-TAM adduct. Taken together, we found that dG-N2-TAM is a miscoding adduct in reactions catalyzed by pol η and κ, suggesting the contribution of these enzymes to TAM mutagenicity.
MATERIALS AND METHODS
Synthesis of oligodeoxynucleotides
Oligodeoxynucleotides used as DNA template (5’CCTTCXCTTCTTTCCTCTCCCTTT and 5’CATGCTGATGAATTCCTTCXCTTCTTTCCTCTCCCTTT; where X is G), primer and standard markers were prepared by solid-state synthesis on an automated DNA synthesizer. A 24-mer (5’CCTTCXCTTCTTTCCTCTCCCTTT; where X is dG-N2-TAM) containing a mixture of trans-forms (fr-1 and fr-2) of dG-N2-TAM was prepared from the trans-dG-N2-TAM phosphoramidite by chemical procedure established in our laboratory (46). The 24-mer oligomer containing fr-1 was isolated from that containing fr-2 by HPLC (46). Similarly, a 24-mer containing a mixture of cis-forms (fr-3 and fr-4) of dG-N2-TAM was prepared from the cis-dG-N2-TAM phosphoramidite and the oligomers containing fr-3 or fr-4 were separated by HPLC. The dG-N2-TAM-modified 24-mer containing each diastereoisomer was then ligated to a 14-mer (5’CATGCTGATGAATT) to prepare the 38-mer template (5’CATGCTGATGAATTCCTTCXCTTCTTTCCTCTCCCTTT; where X is dG-N2-TAM) (47). The dG-N2-TAM-modified and unmodified oligomers were purified on a Water's reverse-phase μBondapak C18 (0.39 × 30 cm), using a linear gradient of 0.05 M triethylammonium acetate, pH 7.0, containing 10 - 50% acetonitrile with an elution time of 60 min and a flow rate of 1.0 mL/min (24). The oligomers were further purified by electrophoresis on 20% polyacrylamide denaturing gel (PAGE) (35 × 42 × 0.04 cm) (48). Oligomers were labeled at the 5' terminus by treating with T4 polynucleotide kinase in the presence of [γ-32P]ATP (49) and subjected to 20% PAGE containing 7M urea (35 × 42 × 0.04 cm) to establish homogeneity. The position of the oligomers was established by β-phosphorimager analysis (Molecular Dynamics Inc.).
Primer extension reactions
Pol η and a truncated form of pol κ (pol κΔC) were prepared as described previously (30, 35). Although pol κΔC has a lower processivity than the full-length pol κ, the miscoding rate on the undamaged DNA by pol κΔC was similar to that of pol κ (28). A 10-mer (5’AGAGGAAAGA) or 12-mer (5’AGAGGAAAGAAG) was labeled at the 5’ terminus with T4 polynucleotide kinase and [γ-32P]-ATP (49). Using dG-N2-TAM-modified or unmodified 38-mer oligodeoxynucleotide (200 fmol) primed with a 32P-labeled 10-mer (5’AGAGGAAAGA; 100 fmol) or 12-mer (5’AGAGGAAAGAAG; 100 fmol), primer extension reactions catalyzed by pol η or pol κΔC were conducted at 25°C for 30 min in a buffer (10 μL) containing four dNTPs (100 μM each) (Fig. 2). The reaction buffer for pol η contains 40 mM Tris-HCl (pH 8.0), 1 mM MgCl2, 10 mM DTT, 250 μg/mL BSA, 60 mM KCl, and 2.5 % glycerol. A similar reaction buffer was used for pol κΔC, using 5 mM MgCl2 instead of 1 mM MgCl2. Reactions were stopped with the addition of 5 μL of formamide dye. The samples were subjected to 20% PAGE (35 × 42 × 0.04 cm). The radioactivity of extended products was measured by β-phosphorimager (Molecular Dynamics).
Fig. 2. Diagram of the method used to determine miscoding specificities.
Unmodified or dG-N2-TAM-modified 38-mer templates are annealed to a 32P-labeled 10-mer primer. Primer extension reactions catalyzed by pol η or pol κΔC were conducted in the presence of four dNTPs. Fully extended products formed during DNA synthesis are recovered from the polyacrylamide gel (35 × 42 × 0.04 cm), annealed with a complementary 38-mer, cleaved with EcoRI, and subjected to a two-phase PAGE (15 × 72 × 0.04 cm), as described in Materials and Methods. To determine miscoding specificity, mobility of the reaction products are compared with those of 18-mer standards containing dC, dA, dG or dT opposite the lesion and one (Δ1) or two-base (Δ2) deletions.
Miscoding Analysis
Using dG-N2-TAM-modified or unmodified 38-mer oligodeoxynucleotide (450 fmol) primed with a 32P-labeled 12-mer (5’AGAGGAAAGTAG; 300 fmol), primer extension reactions catalyzed by pol η or pol κΔC (15 ng for the unmodified template; 150 ng for the modified templates) were conducted at 25°C for 30 min in a buffer (30 μl) containing four dNTPs (100 μM each) and subjected to 20% PAGE (35 × 42 × 0.04 cm). Extended reaction products (approximately 28−32 bases long) were extracted from the gels. The recovered oligodeoxynucleotides were annealed with an unmodified 38-mer, cleaved with Eco RI, and subjected to electrophoresis on two-phase 20% polyacrylamide gels (15 × 72 × 0.04 cm) containing 7M urea in the upper phase and no urea in the lower phase (two-phase PAGE) (45) (Fig. 2). To quantify base substitutions and deletions, mobility of the reaction products were compared with those of 18-mer standards containing dC, dA, dG or dT opposite the lesion and one (Δ1) or two-base (Δ2) deletions. The detection limit on the gel was 0.03% of the labeled oligomers.
Steady-state kinetic studies
Kinetic parameters associated with nucleotide insertion opposite dG-N2-TAM lesion and chain extension from the 3’ primer terminus, were determined at 25 °C, using varying amounts of single dNTPs (0 - 500 μM). For insertion kinetics, reaction mixtures containing dNTP (0 - 500 μM) and either pol η (0.5 - 5 ng) or pol κΔC (0.5 - 5 ng) were incubated at 25 °C for 2 min in 10 μL of Tris-HCl buffer (pH 8.0) using a 24-mer template (150 fmol; 5’CCTTCXCTTCTTTCCTCTCCCTTT, where X is G or dG-N2-TAM) primed with a 32P-labeled 12-mer primer (100 fmol; 5’AGAGGAAAGAAG). Reaction mixtures containing a template (150 fmol) primed with a 32P-labeled 13-mer primer (100 fmol; 5’AGAGGAAAGAAGN, where N is C, A, G or T), with varying amounts of dGTP (0 - 500 μM), and either pol η (0.5 - 5 ng) or pol κΔC (0.5 - 5 ng) were used to measure chain extension. Another 21-mer template containing a codon 12 of K-ras sequence [150 fmol; 5’GGAGCTGXTGGCGTAGGCTGT (codons 10−16), where X is G or dG-N2-TAM] was also used for determining the frequency of dNTP insertion opposite the lesion using a 32P-labeled 13-mer primer (100 fmol; 5’ACAGCCTACGCCA). Reaction mixtures containing a template (150 fmol) primed with a 32P-labeled 14-mer primer (100 fmol; 5’ACAGCCTACGCCAN, where N is C, A, G or T), with varying amounts of dCTP (0 - 500 μM), and either pol η (0.5 - 5 ng) or pol κΔC (0.5 - 5 ng) were used to measure chain extension. The reaction samples were subjected to 20% denaturing PAGE (35 × 42 × 0.04 cm). The Michaelis constants (Km) and maximum rates of reaction (Vmax) were obtained from Hanes-Woolf plots. Frequencies of dNTP insertion (Fins) and chain extension (Fext) were determined relative to the dC•dG base pair according to the equation: F = (Vmax/Km)[wrong pair]/(Vmax/Km)[correct pair=dC•dG] (50, 51).
RESULTS
Miscoding properties of dG-N2-TAM DNA adducts in reactions catalyzed by pol η
Primer extension reactions catalyzed by pol η were conducted on unmodified or dG-N2-TAM-modified 38-mer template in the presence of four dNTPs (Fig. 3). On the templates containing a single unmodified dG, primer extensions catalyzed by this enzyme readily occurred to form the extended products. With the modified templates containing a single diastereoisomer (fr-1, fr-2, fr-3 and fr-4) of dG-N2-TAM adduct, primer extensions were retarded one-base prior to the adduct, opposite the adduct, and one-base past the adduct. The extended products past the dG-N2-TAM lesions were obtained by increasing the amount of the enzyme. When 500 fmol of pol η was used, approximately 4.5 ± 1.0 % for fr-1, 47 ± 3.4 % for fr-2, 33 ± 2.6 % for fr-3, and 17 ± 1.9 % for fr-4 of the starting primer were extended past the adducts respectively to form the fully-extended products (28−34 mers). Blunt-end addition to the fully extended product (33−34 mers) was observed (52, 53). The primer extension past the fr-2 or fr-3 was more efficient than that of fr-1 and fr-4, indicating that the frequency past the adducts varied depending on the diastereoisomers.
Fig. 3. Primer extension reactions catalyzed by pol η or pol κΔC on the dG-N2-TAM-modifiedtemplates.
Using unmodified or dG-N2-TAM-modified 38-mer templates primed with a 32P-labeled 10-mer (32P-AGAGGAAAGA), primer extension reactions were conducted at 25°C for 30 min in a buffer containing four dNTPs (100 μM each) and variable amounts (0, 1.0, 10, 100, and 500 fmol) of pol η or pol κΔC as described in Materials and Methods. One-third of the reaction mixture was subjected to PAGE (35 × 42 × 0.04 cm). The radioactivity of extended products was measured by β-phosphorimager. 13X shows the location opposite the dG-N2-TAM lesion. A 32-mer (5’AGAGGAAAGAAGCGAAGGAATTCATCAGCATG) was used as a marker of fully extended product (Stn.).
The fully extended products (approximately 28−34-mers) past the unmodified or modified adducts were recovered, digested by Eco RI, and subjected to two-phase PAGE for quantitative analysis of base substitutions and deletions (Fig. 2). A standard mixture of six 32P-labeled oligodeoxynucleotides containing dC, dA, dG, or dT opposite the adduct, and containing one- and two-base deletions can be resolved by this method (Fig. 4). Preferential incorporation of dCMP, the correct bases, opposite the unmodified dG was observed. As indicated by arrows, small amounts of unknown products were detected; the migration of these products differed from those of standard markers. Since the amount of the fully extended products past the dG-N2-TAM were less than that past the unmodified dG, the fully extended products past the each diastereoisomer of dG-N2-TAM were recovered from several reactions and used for the two-phase PAGE analysis (Fig. 4). The amounts of dNMP incorporation opposite each diastereoisomer were normalized for the amounts of their starting primer. dG-N2-TAM promoted preferential incorporation of dCMP (4.3 % for fr-1; 32.0 % for fr-2; 22.5 % for fr-3; 13.8 % for fr-4, respectively) opposite the adducts. A small amount of dAMP incorporation (0.04 % for fr-1; 1.2 % for fr-2; 2.3 % for fr-3; 1.1 % for fr-4) opposite the adduct was observed, in addition to significant amounts of one-base (0.08−2.4 %) and two-base (0.06−9.9 %) deletions. As observed for the unmodified dG, small amount of unknown products were observed.
Fig. 4. Quantitation of miscoding specificities induced by dG-N2-TAM adduct.
A 12-mer primer (32P-AGAGGAAAGAAG) was used for the primer extension reactions catalyzed by 100 fmol of pol η or pol κΔC, as described in Fig. 3. Three each independent reaction samples were combined and subjected to PAGE (35 × 42 × 0.04 cm). The fully-extended products recovered from the gel were used for analysis of base substitutions and deletions, as described in the legend of Fig. 2.
Miscoding properties of dG-N2-TAM adducts in reactions catalyzed by pol κΔC
Primer extension reactions catalyzed by pol κΔC readily occurred on the templates containing unmodified dG to form the extended products (Fig. 3). When 10 and 100 fmol of this enzyme were used, 68 % and 92 %, respectively, of the primer were extended past dG to form the fully extended products. Unlike pol η, the primer extension reactions were retarded one-base prior to the fr-1 of dG-N2-TAM and opposite the adduct; with 100 fmol of pol κΔC, only 9.0 % of primers were extended past this adduct to form the fully extended products. However, using the same amount of enzyme, majority of primers (81−90 %) were readily extended past the fr-2, fr-3 or fr-4 of dG-N2-TAM to form the fully extended products.
The extended products past the unmodified and modified adducts were used for miscoding analysis using two-phase PAGE. When the unmodified template was used, an expected incorporation of dCMP was observed opposite the dG (Fig. 4). All diastereoisomers of dG-N2-TAM promoted incorporation of dCMP (36.7 % for fr-1; 83.3 % for fr-2; 82.3 % for fr-3; 72.7 % for fr-4, respectively) as a primary product. When the fr-1 was used, small amount of dAMP (0.7 %) and dTMP (0.55 %) incorporation and one-base deletion (1.0 %) were observed at the adduct. With other diastereoisomers (fr-2, fr-3 and fr-4), only a small amount of dTMP incorporation (0.6 % for fr-2; 1.8 % for fr-3; 1.4 % for fr-4) was observed.
Kinetic studies on dG-N2-TAM-modified DNA templates
The frequency of dNTP incorporation (Fins) opposite a trans-form (fr-2) of dG-N2-TAM and the frequency of chain extension (Fext) from dN•dG-N2-TAM pairs were measured within the linear range of the reaction, using the same sequence context that was used for the two-phase PAGE assay (Table 1). With pol η, the Fins value for dCTP (2.45 × 10−2), the correct base, opposite the dG-N2-TAM was only 1.7 times higher than that of dATP (1.44 × 10−2) and was 13 and 41 times higher than that of dGTP and dTTP, respectively. Since the Fext for the dC•dG-N2-TAM pair was 36 times higher than that for the dA•dG-N2-TAM pair, the relative bypass frequency (Fins×Fext) past the dC•dG-N2-TAM pair was approximately 62 times higher than that for the dA•dG-N2-TAM pair. The Fins×Fext past the dC•dG-N2-TAM pair was two to three orders of magnitude higher than that of the other dN•dG-N2-TAM pairs. When pol κΔC was used, the Fins for dCTP opposite the dG-N2-TAM was 11 and 35 times higher than that of dTTP and dATP, respectively (Table 1). The Fins for dGTP was not detected. The Fins×Fext for the dC•dG-N2-TAM pair was 50 and 940 times higher than that for the dT•dG-N2-TAM and dA•dG-N2-TAM pairs, respectively.
Table 1.
Kinetic Parameters for Nucleotide Insertion and Chain Extension Reactions Catalyzed by DNA pol η and pol κa
![]() |
![]() |
||||||
---|---|---|---|---|---|---|---|
N:X | Km (μM) | Vmax(%min−1) | Fins | Km (μM) | Vmax(%min−1) | Fext | Fins×Fext |
Pol η | |||||||
X = dG | |||||||
C:G | 0.87± 0.08b | 47.8 ± 0.19b | 1.0 | 0.47± 0.12b | 54.8 ± 4.1b | 1.0 | 1.0 |
X = dG-N2-TAM | |||||||
C:X | 2.44 ± 0.04 | 3.28 ±0.39 | 2.45 × 10−2 | 7.61 ± 0.53 | 5.05 ± 0.45 | 5.69 × 10−3 | 1.39 × 10−4 |
A:X | 22.5 ± 1.0 | 17.8 ± 0.09 | 1.44 × 10−2 | 13.1 ± 2.4 | 0.24 ± 0.03 | 1.57 × 10−4 | 2.26 × 10−6 |
G:X | 23.2 ± 1.4 | 2.37 ± 0.01 | 1.86 × 10−3 | 14.3 ± 1.4 | 0.23 ± 0.01 | 1.38 × 10−4 | 2.57 × 10−7 |
T:X | 69.5 ± 6.2 | 2.31 ±0.07 | 6.05 × 10−4 | 16.7 ± 1.9 | 0.08 ± 0.01 | 4.10 × 10−5 | 2.48 × 10−8 |
Pol κΔC | |||||||
X = dG | |||||||
C:G | 1.68 ± 0.23b | 39.1 ± 3.46b | 1.0 | 1.61 ± 0.08b | 111.0 ± 7.7b | 1.0 | 1.0 |
X = dG-N2-TAM | |||||||
C:X | 12.5 ± 0.1 | 5.47 ± 0.01 | 1.88 × 10−2 | 5.06 ± 1.17 | 2.42 ± 0.01 | 6.94 × 10−3 | 1.30 × 10−4 |
A:X | 32.3 ± 6.4 | 0.41 ± 0.02 | 5.45 × 10−4 | 33.9 ± 0.7 | 0.59 ± 0.01 | 2.53 × 10−4 | 1.38 × 10−7 |
G:X | N.D. | N.D. | N.D. | 115 ± 26 | 1.21 ± 0.10 | 1.53 × 10−4 | N.D. |
T:X | 19.3 ± 2.2 | 0.80 ± 0.11 | 1.78 × 10−3 | 6.65 ± 1.06 | 0.67 ± 0.01 | 1.46 × 10−3 | 2.60 × 10−6 |
![]() |
![]() |
||||||
---|---|---|---|---|---|---|---|
N:X | Km (μM) | Vmax(%min−1) | Fins | Km (μM) | Vmax(%min−1) | Fext | Fins×Fext |
Pol η | |||||||
X = dG | |||||||
C:G | 0.82 ± 0.13b | 436 ± 27b | 1.0 | 0.33 ± 0.10b | 260 ± 4.8b | 1.0 | 1.0 |
X = dG-N2-TAM | |||||||
C:X | 3.99 ± 0.69 | 2.93 ± 0.02 | 1.50 × 10−3 | 0.85 ± 0.17 | 1.97 ± 0.01 | 2.85 × 10−3 | 4.26 × 10−6 |
A:X | 8.18 ± 0.1 | 2.47 ± 0.04 | 5.59 × 10−4 | 0.88 ± 0.19 | 2.42 ± 0.10 | 3.37 × 10−3 | 1.89 × 10−6 |
G:X | 17.9 ± 0.8 | 2.57 ± 0.09 | 2.66 × 10−4 | 3.94 ± 0.22 | 1.17 ± 0.01 | 3.58 × 10−4 | 9.52 × 10−8 |
T:X | 29.1 ± 5.5 | 1.88 ± 0.16 | 1.20 × 10−4 | 6.26 ± 0.86 | 0.06 ± 0.01 | 1.15 × 10−5 | 1.38 × 10−9 |
Pol κΔC | |||||||
X = dG | |||||||
C:G | 2.31 ± 0.22b | 136 ± 18b | 1.0 | 1.02 ± 0.03b | 127 ± 3b | 1.0 | 1.0 |
X = dG-N2-TAM | |||||||
C:X | 11.6 ± 2.0 | 3.24 ± 0.03 | 4.80 × 10−3 | 3.41 ± 0.83 | 1.11 ± 0.01 | 2.69 × 10−3 | 1.29 × 10−5 |
A:X | N.D. | N.D. | N.D. | 5.62 ± 0.21 | 0.94 ± 0.01 | 1.34 × 10−3 | N.D. |
G:X | N.D. | N.D. | N.D. | 31.8 ± 9.4 | 2.84 ± 0.16 | 7.42 × 10−4 | N.D. |
T:X | 34.6 ± 3.4 | 0.21 ± 0.01 | 1.01 × 10−4 | 32.2 ± 2.01 | 1.19 ± 0.06 | 2.95 × 10−4 | 2.99 × 10−8 |
Kinetics of nucleotide insertion and chain extension reactions were determined as described in Materials and Methods. Frequencies of nucleotide insertion (Fins) and chain extension (Fext) were estimated by the equation: F = (Vmax/Km)[wrong pair]/(Vmax/Km) [correct pair =dC:dG]. X = dG or dG-N2-TAM lesion.
Data expressed as mean ± S.D. obtained from three independent experiments.
Steady-state kinetic studies were also performed using K-ras sequence containing a single dG-N2-TAM (fr-2) positioned at the second base of codon 12 (Table 1). With pol η, the Fins value for dCTP opposite the dG-N2-TAM was 2.7, 5.6 and 13 times higher than that of dATP, dGTP and dTTP, respectively. Interestingly, the Fext for dA•dG-N2-TAM pair (3.37 × 10−3) was slightly higher than that of the dC•dG-N2-TAM pair (2.85 × 10−3), resulting that the Fins×Fext for dA•dG-N2-TAM pair was only 2.3 times lower than that of the dC•dG-N2-TAM pair. The Fins×Fext for dC•dG-N2-TAM pair was 45 and 3100 times higher than that of dG•dG-N2-TAM and dT•dG-N2-TAM pairs, respectively. When pol κΔC was used, the Fins for dCTP and dTTP were only detected; the Fins for dTTP was 48 times lower than that of dCTP. The Fins×Fext for dT•dG-N2-TAM was 430 times lower than that of the dC•dG-N2-TAM pair.
DISCUSSION
Pol η and pol κ are highly expressed in the reproductive organs including ovary and uterus (40-44) where steroidal hormones are produced. Since TAM has a partial structure of estrogen, these DNA pols may contribute to translesion synthesis past DNA adducts derived from TAM. In fact, the primer extension reactions catalyzed by pol κΔC occurred more rapidly past the dG-N2-TAM adduct than that of pol η by incorporating preferentially dCMP, the correct base, opposite the adduct. With pol η, a small amount of direct dAMP incorporation was observed with deletions, indicating that G → T mutations and deletions were produced. With pol κΔC, dG-N2-TAM promoted small amounts of dTMP incorporations, indicating that G → A mutations occurred. This observation was supported by steady-state kinetic studies. The miscoding specificities detected with these enzymes were consistent with mutagenic events induced by dG-N2-TAM in a single-strand vector propagated in simian kidney (COS-7) cells (24).
Unlike other bulky DNA adducts (38, 39, 54), dG-N2-TAM allowed pol α, β, or δ, in addition to pol η and κ, to extend past the adduct (47). Pol α promoted the misincorporation of dAMP and deletions at all the diastereoisomers, accompanied by small amounts of dGMP incorporation. Pol β promoted deletions and misincorporation of dAMP and dGMP. With pol δ, preferential incorporation of dCMP was observed: fr-1 of dG-N2-TAM only promoted a small amount of dTMP incorporation. Some of these replicative DNA pols may also be involved in the miscoding events induced by TAM. Thus, the miscoding specificities and frequencies varied depending on the DNA polymerase used.
Among four diastereisomers [two trans-forms (fr-1 and fr-2) and two cis-forms (fr-3 and fr-4)], the primer extension reactions catalyzed by pol η and pol κΔC were retarded strongly at the fr-1; therefore, with pol η, formation of dCMP and dAMP incorporations and deletions at the fr-1 was much lower than that observed with other diastereoisomers. With pol κΔC, small amounts of dAMP and dTMP incorporations and one-base deletion were observed opposite the fr-1 while a small amount of dTMP incorporation was only observed with other diastereoisomers. Thus, the miscoding specificity and frequency also varied depending on the diastereoisomer of dG-N2-TAM adduct. The confirmation of each diastereoisomer in the replication folk may affect the miscoding properties, as suggested by the three dimensional NMR studies (55).
As observed with COS-7 cells (24) and with pol η and κ in the present study, a high frequency of G → T and G → A mutations were detected at the second base in K-ras codon 12 in the endometrium of women treated with TAM (23). A phosphoramidite chemical synthesis established in our laboratory has made it possible to insert dG-N2-TAM into the oligomers having any sequence context such as K-ras gene. The frequencies of dNTP insertion opposite the dG-N2-TAM and the chain extension from the dN•dG-N2-TAM pair were determined using the K-ras sequence and compared it with those observed with non-specific sequence. Since a trans-form (fr-2) of dG-N2-TAM was a major TAM-DNA adducts in rodents (11-13) and primate (14, 15), this isomer was used for this kinetic studies. With pol η, the Fins×Fext for the dA•dG-N2-TAM pair in the K-ras sequence was only 2.3 times lower than that of the dC•dG-N2-TAM pair while, with the non-specific sequence, the Fins×Fext for dA•dG-N2-TAM pair in the K-ras sequence was 62 times lower than that of the dC•dG-N2-TAM pair (Table 1). This indicated that specific sequence context such as K-ras gene may affect to increase the miscoding frequency, resulting in the construction of mutational hot-spots.
Since G → A mutations also were observed in codon 12 of K-ras gene in the endometrium of women treated with TAM (23), some of DNA pols are expected to insert dTMP opposite the dG-N2-TAM lesion. Only pol κ has this ability among DNA pols examined. Although with pol κΔC, the Fins×Fext past the dT•dG-N2-TAM was 50 times lower than that of dC•dG-N2-TAM pair, a low level of direct dTMP incorporation was detected during translesion synthesis catalyzed by this enzyme (Fig. 4). Since pol ι is highly expressed in the reproductive organs (44, 56) and tends to incorporate dTMP opposite the bulky DNA adducts (27), this enzyme may contribute to the mutagenic events of TAM-DNA adducts, resulting in the increase of G → A mutations.
To compare the behavior of pol η or pol κ past the dG-N2-TAM adduct with that past several bulky dG-N2 adducts such as dG-N2-3MeE, (+)-trans-dG-N2-BPDE, or dG-N2-AAF, these adducts were embedded in a similar sequence context (39, 54, 57) (Table 2). With pol η, like dC•dG-N2-AAF and dC•dG-N2-3MeE pairs, the Fins×Fext for the dC•dG-N2-TAM pair was one to four orders of magnitude higher than that of any of the nucleotides paired with dG-N2-TAM. Interestingly, the Fins×Fext ratio for dC•dG-N2-TAM/dA•dG-N2-TAM pair was 62 and that number was higher than that for the dC•dG-N2-3MeE/dA•dG-N2-3MeE (310) or dC•dG-N2-AAF/dA•dG-N2-AAF (165) pair, indicating that dG-N2-TAM adduct may have higher miscoding potential than dG-N2-3MeE or dG-N2-AAF. Pol κ bypassed dG-N2-TAM adduct more efficiently by incorporating dCMP opposite the lesion, as observed with dG-N2-3MeE, (+)-trans-dG-N2-BPDE, or dG-N2-AAF lesion (Table 2). However, the Fins×Fext ratio for dC•dG-N2-TAM/dT•dG-N2-TAM pair was 50 and that number was one to three orders of magnitude higher than that for the dC•dG-N2-3MeE/dT•dG-N2-3MeE (5400) or dC•(+)-trans-dG-N2-BPDE/dT•(+)-trans-dG-N2-BPDE (21000), or dC•dG-N2-AAF/dT•dG-N2-AAF (210) pair, indicating that dG-N2-TAM adduct may also have higher miscoding potential than other bulky DNA adducts. Pol κ and pol η may have evolved to bypass dG-N2-TAM.
Table 2.
Fins × Fext Past DNA Adducts by pol η or pol κ.
dG-N2-TAM | dG-N2-3MeEa | dG-N2-AAFb | (+)trans-dG-N2-BPDEc | ||
---|---|---|---|---|---|
pol η | C:X | 1.39 × 10−4 | 9.50 × 10−4 | 1.53 × 10−3 | — |
A:X | 2.26 × 10−6 | 3.06 × 10−6 | 9.34 × 10−7 | — | |
G:X | 2.57 × 10−7 | 2.50 × 10−6 | 3.24 × 10−10 | — | |
T:X | 2.48 × 10−8 | 3.99 × 10−6 | 1.70 × 10−7 | — | |
pol κ | C:X | 1.30 × 10−4 | 1.33 × 10−1 | 1.05 × 10−3 | 1.09 × 10−5 |
A:X | 1.38 × 10−7 | 1.12 × 10−6 | 7.35 × 10−9 | 3.37 × 10−10 | |
G:X | N.D. | 4.30 × 10−7 | 1.07 × 10−8 | 8.24 × 10−12 | |
T:X | 2.60 × 10−6 | 2.48 × 10−5 | 4.90 × 10−6 | 5.20 × 10−10 |
In conclusion, human DNA pols η and κ expressed highly in reproductive organs are more likely to be associated with miscoding events generated by TAM. The high frequency of mutations observed at the K-ras sequence may reflect the sequence context effect. Thus, dG-N2-TAM adducts generate mutations and pose a potential risk to women treated with TAM. This result raises concerns about the use of TAM as a chemopreventive agent for healthy women as well as its use in treatment of breast cancer.
ACKOWLEDGMENT
We thank Drs. F. Hanaoka and H. Ohmori for providing DNA pol η and pol κΔC, respectively.
1Abbreviations
- dNTP
2'-deoxynucleoside triphosphate
- TAM
tamoxifen
- dG-N2-TAM
α-(N2-deoxyguanosinyl)tamoxifen
- pol η
DNA polymerase η
- pol κ
DNA polymerase κ
- pol κΔC
a truncated form of pol κ
- Fins
frequency of insertion
- Fext
frequency of extension
- PAGE
polyacrylamide gel electrophoresis
- HPLC
high performance liquid chromatography.
Footnotes
This research was supported by Grant ES09418 from the National Institute of Environmental Health Sciences
REFERENCES
- 1.Seoud MA-F, Johnson J, Weed JC. Gynecologic tumors in tamoxifen-treated women with breast cancer. Obstet. Gynecol. 1993;82:165–169. [PubMed] [Google Scholar]
- 2.van Leeuwen FE, Benraadt J, Coebergh JWW, Kiemeney LALM, Diepenhorst FW, van den Belt-Dusebout AW, van Tinteren H. Risk of endometrial cancer after tamoxifen treatment of breast cancer. Lancet. 1994;343:448–452. doi: 10.1016/s0140-6736(94)92692-1. [DOI] [PubMed] [Google Scholar]
- 3.Killackey M, Hakes TB, Pierce VK. Endometrial adenocarcinoma in breast cancer patients receiving antiestrogens. Cancer Treat. Rep. 1985;69:237–238. [PubMed] [Google Scholar]
- 4.Bernstein L, Deapen D, Cerhan JR, Schwartz SM, Liff J, McGann-Maloney E, Perlman JA, Ford L. Tamoxifen therapy for breast cancer and endometrial cancer risk. J. Natl. Cancer Inst. 1999;91:1654–1662. doi: 10.1093/jnci/91.19.1654. [DOI] [PubMed] [Google Scholar]
- 5.Bernstein L, Deapen D, Cerhan JR, Schwartz SM, Liff J, McGann-Maloney E, Perlman JA, Ford L. Tamoxifen therapy for breast cancer and endometrial cancer risk. J. Natl. Cancer Inst. 1999;91:1654–1662. doi: 10.1093/jnci/91.19.1654. [DOI] [PubMed] [Google Scholar]
- 6.Han X, Liehr JG. Induction of covalent DNA adducts in rodents by tamoxifen. Cancer Res. 1992;52:1360–1363. [PubMed] [Google Scholar]
- 7.Osborne MR, Hewer A, Hardcastle IR, Carmichael PL, Phillips DH. Identification of the major tamoxifen-deoxyguanosine adduct formed in the liver DNA of rats treated with tamoxifen. Cancer Res. 1996;56:66–71. [PubMed] [Google Scholar]
- 8.Greaves P, Goonetilleke R, Nunn G, Topham J, Orton T. Two-year carcinogenicity study of tamoxifen in Alderley Park Wister-derived rats. Cancer Res. 1993;53:3919–3924. [PubMed] [Google Scholar]
- 9.Hard GC, Iatropoulos MJ, Jordan K, Radi L, Kaltenberg OP, Imondi AR, Williams GM. Major difference in the hepatocarcinogenicity and DNA adduct forming ability between toremifene and tamoxifen in female Crl:CD(BR) rats. Cancer Res. 1993;53:4534–4541. [PubMed] [Google Scholar]
- 10.Kim SY, Suzuki N, Laxmi YRS, Shibutani S. Genotoxic mechanism of tamoxifen in developing endometrial cancer. Drug Metab. Rev. 2004;36:199–218. doi: 10.1081/dmr-120033997. [DOI] [PubMed] [Google Scholar]
- 11.Rajaniemi H, Rasanen I, Koivisto P, Peltonen K, Hemminki K. Identification of the major tamoxifen-DNA adducts in rats liver by mass spectroscopy. Carcinogenesis. 1999;20:305–309. doi: 10.1093/carcin/20.2.305. [DOI] [PubMed] [Google Scholar]
- 12.Umemoto A, Monden Y, Suwa M, Kanno Y, Suzuki M, Lin C-X, Ueyama Y, Momen MA, Ravindernath A, Shibutani S, Komaki K. Identification of hepatic tamoxifen-DNA adducts in mice: α-(N2-deoxyguanosinyl)tamoxifen and α-(N2-deoxyguanosinyl)tamoxifen N-oxide. Carcinogenesis. 2000;21:1737–1744. doi: 10.1093/carcin/21.9.1737. [DOI] [PubMed] [Google Scholar]
- 13.Umemoto A, Komaki K, Monden Y, Suwa M, Kanno Y, Kitagawa M, Suzuki M, Lin C-X, Ueyama Y, Momen MA, Ravindernath A, Shibutani S. Identification and quantification of tamoxifen-DNA adducts in the liver of rats and mice. Chem. Res. Toxicol. 2001;14:1006–1013. doi: 10.1021/tx010012d. [DOI] [PubMed] [Google Scholar]
- 14.Shibutani S, Suzuki N, Laxmi YR, Schild LJ, Divi LJ, Divi RL, Grollman AP, Poirier MC. Identification of tamoxifen-DNA adducts in monkeys treated with tamoxifen. Cancer Res. 2003;63:4402–4406. [PubMed] [Google Scholar]
- 15.Schild LJ, Divi RL, Beland FA, Churchwell MI, Doerge DR, Gamboa da Costa G, Marques MM, Poirier MC. Formation of tamoxifen-DNA adducts in multiple organs of adult female cynomolgus monkeys dosed with tamoxifen for 30 days. Cancer Res. 2003;63:5999–6003. [PubMed] [Google Scholar]
- 16.Shibutani S, Ravindernath A, Suzuki N, Terashima I, Sugarman SM, Grollman AP, Pearl ML. Identification of tamoxifen-DNA adducts in the endometrium of women treated with tamoxifen. Carcinogenesis. 2000;21:1461–1467. [PubMed] [Google Scholar]
- 17.Martin EA, Brown K, Gaskell M, Al-Azzawi F, Garner RC, Boocock DJ, Mattock E, Pring DW, Dingley K, Turteltaub KW, Smith LL, White IN. Tamoxifen DNA damage detected in human endometrium using accelerator mass spectrometry. Cancer Res. 2003;63:8461–8465. [PubMed] [Google Scholar]
- 18.Shibutani S. Tamoxifen is a genotoxic carcinogen. Chem. Res. Toxicol. 2005;18:1509–1511. [Google Scholar]
- 19.Carmichael PL, Ugwumadu AH, Neven P, Hewer AJ, Poon GK, Phillips DH. Lack of genotoxicity of tamoxifen in human endometrium. Cancer Res. 1996;56:1475–1479. [PubMed] [Google Scholar]
- 20.Carmichael PL, Sardar S, Crooks N, Neven P, Van Hoof I, Ugwumadu A, Bourne T, Tomas E, Hellberg P, Hewer AJ, Phillips DH. Lack of evidence from HPLC 32P-post-labeling for tamoxifen-DNA adducts in the human endometrium. Carcinogenesis. 1999;20:339–342. doi: 10.1093/carcin/20.2.339. [DOI] [PubMed] [Google Scholar]
- 21.Beland FA, Churchwell MI, Doerge DR, Parkin DR, Malejka-Giganti D, Hewer A, Phillips DH, Carmichael PL, Gamboa da Costa G, Marques MM. Electrospray ionization-tandem mass spectrometry and 32P-postlabeling analyses of tamoxifen-DNA adducts in humans. J. Natl. Cancer Inst. 2004;96:1099–1104. doi: 10.1093/jnci/djh195. [DOI] [PubMed] [Google Scholar]
- 22.Beland FA, Marques MM, Gamboa da Costa G, Phillips DH. Tamoxifen-DNA adduct formation in human endometrium. Chem. Res. Toxicol. 2005;18:1507–1509. doi: 10.1021/tx050255w. [DOI] [PubMed] [Google Scholar]
- 23.Hachisuga T, Tsujioka H, Horiuchi S, Udou T, Emoto M, Kawarabayashi T. K-ras mutation in the endometrium of tamoxifen-treated breast cancer patients, with a comparison of tamoxifen and toremifene. Br. J. Cancer. 2005;92:1098–1103. doi: 10.1038/sj.bjc.6602456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Shibutani S, Dasaradhi L. Miscoding potential of tamoxifen-derived DNA adducts: α-(N2-deoxyguanosinyl)tamoxifen. Biochemistry. 1997;56:13010–13017. doi: 10.1021/bi970243c. [DOI] [PubMed] [Google Scholar]
- 25.Stygar D, Muravitskaya N, Eriksson B, Eriksson H, Sahlin L. Effects of SERM (selective estrogen receptor modulator) treatment on growth and proliferation in the rat uterus. Reprod. Biol. Endcrinol. 2003;1:1–8. doi: 10.1186/1477-7827-1-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Goodman MF, Tippin B. The expanding polymerase universe. Nat. Rev. Mol. Cell Biol. 2000;1:101–109. doi: 10.1038/35040051. [DOI] [PubMed] [Google Scholar]
- 27.Kunkel TA, Pavlov YI, Bebenek K. Functions of human DNA polymerases η, κ and ι suggested by their properties, including fidelity with undamaged DNA templates. DNA Repair. 2003;3:135–149. doi: 10.1016/s1568-7864(02)00224-0. [DOI] [PubMed] [Google Scholar]
- 28.Ohashi E, Bebenek K, Matsuda T, Feaver WJ, Gerlach VL, Friedberg EC, Ohmori H, Kunkel TA. Fidelity and processivity of DNA synthesis by DNA polymerase kappa, the product of the human DINB1 gene. J. Biol. Chem. 2000;275:39678–84. doi: 10.1074/jbc.M005309200. [DOI] [PubMed] [Google Scholar]
- 29.Zhang Y, Yuan F, Xin H, Wu X, Rajpal DK, Yang D, Wang Z. Human DNA polymerase κ synthesizes DNA with extraordinarily low fidelity. Nucleic Acids Res. 2000;28:4147–4156. doi: 10.1093/nar/28.21.4147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Masutani C, Araki M, Yamada A, Kusumoto R, Nogimori T, Maekawa T, Iwai S, Hanaoka F. Xeroderma pigmentosum variant (XP-V) correcting protein from HeLa cells has a thymine dimer bypass DNA polymerase activity. EMBO J. 1999;18:3491–3501. doi: 10.1093/emboj/18.12.3491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Johnson RE, Prakash S, Prakash L. Efficient bypass of a thymine-thymine dimer by yeast DNA polymerase, pol η. Science. 1999;283:1001–1004. doi: 10.1126/science.283.5404.1001. [DOI] [PubMed] [Google Scholar]
- 32.Haracska L, Yu SL, Johnson RE, Prakash L, Prakash S. Efficient and accurate replication in the presence of 7,8-dihydro-8-oxoguanine by DNA polymerase η. Nat. Genet. 2000;25:458–461. doi: 10.1038/78169. [DOI] [PubMed] [Google Scholar]
- 33.Masutani C, Kusumoto R, Iwai S, Hanaoka F. Mechanisms of accurate translesion synthesis by human DNA polymerase η. EMBO J. 2000;19:3100–3109. doi: 10.1093/emboj/19.12.3100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhang Y, Yuan F, Wu X, Rechkoblit O, Taylor JS, Geacintov NE, Wang Z. Error-prone lesion bypass by human DNA polymerase η. Nucleic Acids Res. 2000;28:4717–4724. doi: 10.1093/nar/28.23.4717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ohashi E, Ogi T, Kusumoto R, Iwai S, Masutani C, Hanaoka F, Ohmori H. Error-prone bypass of certain DNA lesions by the human DNA polymerase κ. Genes & Development. 2000;14:1589–1594. [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang Y, Yuan F, Wu X, Wang M, Rechkoblit O, Taylor J-S, Geacintov NE, Wang Z. Error-free and error-prone lesion bypass by human DNA polymerase κ in vitro. Nucleic Acids Res. 2000;28:4138–4146. doi: 10.1093/nar/28.21.4138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Gerlach VL, Feaver WJ, Fischhaber PL, Friedberg EC. Purification and characterization of pol κ, a DNA polymerase encoded by the human DINB1 gene. J. Biol. Chem. 2001;276:92–98. doi: 10.1074/jbc.M004413200. [DOI] [PubMed] [Google Scholar]
- 38.Suzuki N, Ohashi E, Hayashi K, Ohmori H, Grollman AP, Shibutani S. Translesional synthesis past acetylaminofluorene-derived DNA adducts catalyzed by human DNA polymerase κ and Escherichia coli DNA polymerase IV. Biochemistry. 2001;40:15176–15183. doi: 10.1021/bi010702g. [DOI] [PubMed] [Google Scholar]
- 39.Suzuki N, Ohashi E, Kolbanovskiy A, Geacintov NE, Grollman AP, Ohmori H, Shibutani S. Translesion synthesis by human DNA polymerase κ on a DNA template containing a single stereoisomer of dG-(+)- or dG-(−)-anti-N2-BPDE (7,8-dihydroxy-anti-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene). Biochemistry. 2002;41:6100–6106. doi: 10.1021/bi020049c. [DOI] [PubMed] [Google Scholar]
- 40.Gerlach VL, Aravind L, Gotway G, Schultz RA, Koonin EV, Friedberg EC. Human and mouse homologs of Escherichia coli DinB (DNA polymerase IV), members of the UmuC/DinB superfamily. Proc. Natl. Acad. Sci. USA. 1999;96:11922–11927. doi: 10.1073/pnas.96.21.11922. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ogi T, Kato T, Jr., Kato T, Ohmori H. Mutation enhancement by DINB1, a mammalian homologue of the Escherichia coli mutagenesis protein dinB. Genes Cells. 1999;4:607–618. doi: 10.1046/j.1365-2443.1999.00289.x. [DOI] [PubMed] [Google Scholar]
- 42.Velasco-Miguel S, Richardson JA, Gerlach VL, Lai WC, Gao T, Russell LD, Hladik CL, White CL, Friedberg EC. Constitutive and regulated expression of the mouse Dinb (Pol κ) gene encoding DNA polymerase κ. DNA Repair. 2003;2:91–106. doi: 10.1016/s1568-7864(02)00189-1. [DOI] [PubMed] [Google Scholar]
- 43.Yamada A, Masutani C, Iwai S, Hanaoka F. Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase η. Nucleic Acids Res. 2000;28:2473–2480. doi: 10.1093/nar/28.13.2473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Kawamura K, Bahar R, Seimiya M, Chiyo M, Wada A, Okada S, Hatano M, Tokuhisa T, Kimura H, Watanabe S, Honda I, Sakiyama S, Tagawa M, O-Wang J. DNA polymerase θ is preferentially expressed in lymphoid tissues and upregulated in human cancers. Int. J. Cancer. 2004;109:9–16. doi: 10.1002/ijc.11666. [DOI] [PubMed] [Google Scholar]
- 45.Shibutani S, Suzuki N, Matsumoto Y, Grollman AP. Miscoding properties of 3,N4-etheno-2'-deoxycytidine in reactions catalyzed by mammalian DNA polymerases. Biochemistry. 1996;35:14992–14998. doi: 10.1021/bi961446o. [DOI] [PubMed] [Google Scholar]
- 46.Laxmi YRS, Suzuki N, Dasaradhi L, Johnson F, Shibutani S. Preparation of oligodeoxynucleotides containing a diastereoisomer of α-(N2-2'-deoxyguanosinyl)tamoxifen by phosphoramidite chemical synthesis. Chem. Res. Toxicol. 2002;15:218–225. doi: 10.1021/tx0101494. [DOI] [PubMed] [Google Scholar]
- 47.Terashima I, Suzuki N, Shibutani S. Mutagenic potential of α-(N2-deoxyguanosinyl)tamoxifen lesions, the major DNA adducts detected in endometrial tissues of patients treated with tamoxifen. Cancer Res. 1999;59:2091–2095. [PubMed] [Google Scholar]
- 48.Shibutani S. Quantitation of base substitutions and deletions induced by chemical mutagens during DNA synthesis in vitro. Chem. Res. Toxicol. 1993;6:625–629. doi: 10.1021/tx00035a006. [DOI] [PubMed] [Google Scholar]
- 49.Maniatis T, Fritsch EF, Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY: 1982. [Google Scholar]
- 50.Mendelman LV, Boosalis MS, Petruska J, Goodman MF. Nearest neighbor influences on DNA polymerase insertion fidelity. J. Biol. Chem. 1989;264:14415–14423. [PubMed] [Google Scholar]
- 51.Mendelman LV, Petruska J, Goodman MF. Base mispair extension kinetics. J. Biol. Chem. 1990;265:2338–2346. [PubMed] [Google Scholar]
- 52.Clark JM, Joyce CM, Beardsley GP. Novel blunt-end addition reactions catalyzed by DNA polymerase I of Escherichia coli. J. Mol. Biol. 1987;198:123–127. doi: 10.1016/0022-2836(87)90462-1. [DOI] [PubMed] [Google Scholar]
- 53.Terashima I, Suzuki N, Dasaradhi L, Tan CK, Downey KM, Shibutani S. Translesional synthesis on DNA templates containing an estrogen quinone-derived adduct: N2-(2-hydroxyestron-6-yl)-2'-deoxyguanosine and N6-(2-hydroxyestron-6-yl)-2'-deoxyadenosine. Biochemistry. 1998;37:13807–13815. doi: 10.1021/bi981235e. [DOI] [PubMed] [Google Scholar]
- 54.Suzuki N, Itoh S, Poon K, Masutani C, Hanaoka F, Ohmori H, Yoshizawa I, Shibutani S. Translesion synthesis past estrogen-derived DNA adducts by human DNA polymerases η and κ. Biochemistry. 2004;43:6304–6311. doi: 10.1021/bi0360298. [DOI] [PubMed] [Google Scholar]
- 55.Shimotakahara S, Gorin A, Kolbanovskiy A, Kettani A, Hingerty BE, Amin S, Broyde S, Geacintov N, Patel DJ. Accomodation of S-cis-tamoxifen-N2-guanine adduct within a bent and widened DNA minor groove. J. Mol. Biol. 2000;302:377–393. doi: 10.1006/jmbi.2000.4071. [DOI] [PubMed] [Google Scholar]
- 56.Frank EG, Tissier A, McDonald JP, Rapić-Otrin V, Zeng X, Gearhart PJ, Woodgate R. Altered nucleotide misinsertion fidelity associated with poliota-dependent replication at the end of a DNA template. EMBO J. 2001;20:2914–2922. doi: 10.1093/emboj/20.11.2914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Yasui M, Dong H, Bonala RR, Suzuki N, Ohmori H, Hanaoka F, Johnson F, Grollman AP, Shibutani S. Mutagenic properties of 3-(deoxyguanosin-N2-yl)-2-acetylaminofluorene, a persistent acetylaminofluorene-derived DNA adduct in mammalian cells. Biochemistry. 43:15005–15013. doi: 10.1021/bi048279+. [DOI] [PubMed] [Google Scholar]