Skip to main content
Journal of Medical Genetics logoLink to Journal of Medical Genetics
. 2006 Sep 1;44(1):16–23. doi: 10.1136/jmg.2006.044446

IRAK4 and NEMO mutations in otherwise healthy children with recurrent invasive pneumococcal disease

Cheng‐Lung Ku 1,2,3,4, Capucine Picard 1,2,3,4, Melinda Erdős 1,2,3,4, Axel Jeurissen 1,2,3,4, Jacinta Bustamante 1,2,3,4, Anne Puel 1,2,3,4, Horst von Bernuth 1,2,3,4, Orchidée Filipe‐Santos 1,2,3,4, Huey‐Hsuan Chang 1,2,3,4, Tatiana Lawrence 1,2,3,4, Marc Raes 1,2,3,4, László Maródi 1,2,3,4, Xavier Bossuyt 1,2,3,4, Jean‐Laurent Casanova
PMCID: PMC2597905  PMID: 16950813

Abstract

Background

About 2% of childhood episodes of invasive pneumococcal disease (IPD) are recurrent, and most remain unexplained.

Objective

To report two cases of otherwise healthy, unrelated children with recurrent IPD as the only clinical infectious manifestation of an inherited disorder in nuclear factor‐κB(NF‐κB)‐dependent immunity.

Results

One child carried two germline mutations in IRAK4, and had impaired cellular responses to interleukin (IL)1 receptor and toll‐like receptor (TLR) stimulation. The other child carried a hemizygous mutation in NEMO, associated with a broader impairment of NF‐κB activation, with an impaired cellular response to IL‐1R, TLR and tumour necrosis factor receptor stimulation. The two patients shared a narrow clinical phenotype, associated with two related but different genotypes.

Conclusions

Otherwise healthy children with recurrent IPD should be explored for underlying primary immunodeficiencies affecting the IRAK4‐dependent and NEMO‐dependent signalling pathways.


The known inherited risk factors for invasive pneumococcal disease (IPD) in children include sickle‐cell disease1 and primary immunodeficiencies (PIDs).2 PIDs include defects in the classic complement activation pathway, defects in carbohydrate‐specific antibody responses, congenital asplenia and the more recently discovered IRAK4 and NEMO deficiencies.2 These defects impair a step in the process leading to the phagocytosis of opsonised bacteria by splenic macrophages. NEMO and IRAK4 deficiencies also involve an impaired mucosal and systemic inflammation response, due to the impaired activation of nuclear factor‐κB (NF‐κB) by microbes and cytokines.3,4,5,6 Although the risk of IPD in children with these PIDs is well known, the fraction of patients with IPD cases associated with a PID in the general population is unknown. This fraction is, however, thought to be small, because PIDs are usually associated with multiple infectious diseases, whereas IPD mostly affects otherwise healthy children. Thus, most cases of IPD remain unexplained genetically and immunologically, at least partly because they are not investigated.

We hypothesisd that isolated IPD may be due to inborn errors in immunity to infection in an unexpectedly large fraction of children.7 We first focused on recurrent IPD,8 which is arbitrarily defined as two episodes of IPD occurring at least 1 month apart, whether caused by the same or different serotypes or strains. Recurrent IPD occurs in at least 2% of patients in most series, making IPD the most important known risk factor for subsequent IPD.8,9,10,11,12,13,14,15,16,17,18 Most series of recurrent cases of IPD have included mostly adults, many with overt underlying conditions, such as HIV infection, organ failure, or cancer.8,17,18,19,20 The situation is much less clear for recurrent IPD in children. The risk factors for this condition identified to date in paediatric patients are sickle‐cell disease12,21 and congenital22,23 or acquired14 cerebrospinal fluid leaks, specifically predisposing the patient to recurrent meningitis. In a North American series, six children with recurrent IPD had sickle‐cell disease, whereas the recurrence remained idiopathic in the other 10 children.12 In a Swiss series, two children had a history of basal skull fracture, whereas the remaining eight were idiopathic.14

A high proportion of children with idiopathic recurrent IPD are likely to have undetected PIDs. The diagnosis of these PIDs is difficult, because PIDs are rare and diverse, and because immunological investigations, and assays of antibody response in particular, are difficult to perform in children aged <2 years. Several PIDs probably associated with an IPD have not yet been discovered.2 Only a few cases of children with PIDs and isolated recurrent IPD have been reported. They include children with congenital asplenia,24,25,26,27 complement pathway deficiencies,28,29,30,31,32,33,34,35 X‐linked agammaglobulinaemia36 and selective antipolysaccharide antibody deficiency.37 Transient IgG2 deficiency has also been described in one child.38 Isolated recurrent IPD has been reported in a single patient with a mild form of X‐linked recessive anhydrotic ectodermal dysplasia with immunodeficiency bearing a NEMO mutation,39 but not in patients with autosomal recessive IRAK4 deficiency, or in patients with mutations in NEMO but no developmental phenotype. Autosomal recessive IRAK4 deficiency and X‐linked recessive NEMO deficiencies correspond to two recently described PIDs that affect NF‐κB‐mediated immunity and cause a relatively broad susceptibility to infections. We report here two otherwise healthy boys with isolated, recurrent IPD and inherited NEMO and IRAK4 defects. These patients displayed none of the other known infectious phenotypes associated with these disorders.

Patients and methods

Case reports

Patient 1 was a 7‐year‐old boy born to unrelated Hungarian parents. He received routine immunisations with no complications. At age 3 years, he had arthritis of the right hip, caused by Streptococcus pneumoniae serotype 14. He was successfully treated with intravenous ceftriaxone for 12 days, and was then given clindamycin prophylaxis for 10 days. He had only two episodes of low‐grade fever (<38°C) during the course of this severe purulent infection, accompanied by anaemia, an erythrocyte sedimentation rate of 81 mm/h, a high serum C reactive protein (CRP) concentration of 89 mg/l and a leucocyte count of 4700/mm3 with 42% polymorphonuclear neutrophils (PMNs).

At age 5½ years, the patient developed meningitis caused by Streptococcus pneumoniae serotype 14, with moderate headache and a slightly high temperature (38°C). CRP levels were normal on day 1, and increased 2 days after diagnosis (87 mg/l). His erythrocyte sedimentation rate was 40 mm/h and his leucocyte count was 4800/mm3 with 56% PMNs at the onset of the disease. The patient recovered without sequelae after treatment for 12 days with intravenous cefotaxime. He was given oral amoxicillin for another 4 weeks. During the episode of meningitis, the patient's temperature remained below 38°C. After this second episode of IPD, he was immunised with the heptavalent pneumococcal conjugate vaccine (Prevenar Wyeth‐pharmaceuticals, Lyon, France) and with the 23‐valent pneumococcal vaccine (Pneumovax 23, Aventis‐Pasteur MSD, Madison, New Jersey, USA), and prescribed monthly intravenous immunoglobulin (Ig)G infusions. He has since been well with no further infections.

The immunological profile of the patient was assessed at ages 3 and 5½ years. The classic and alternative complement pathways, in vitro granulocyte killing of viable Staphylococcus aureus and superoxide anion release by granulocytes were normal. He had normal numbers of white cells, total lymphocytes, and T, B and natural killer cells, with slightly high serum immunoglobulin isotype levels (table 1). Antibody responses to tetanus and diphtheria toxoids and Haemophilus influenzae type b conjugate vaccine were normal, but the patient failed to mount a detectable antibody response to six of the seven pneumococcal serotypes tested, including the pathogenic serotype 14 (table 2). The spleen was visible on ultrasound scans.

Table 1 Immunologic explorations.

Tests Results for patient 1 Results for patient 2 Normal range
Lymphocyte count (/1) 1.86×109 4.54×109 1.7–7×109
Lymphocyte subsets (%)
 CD3 71 68 50–76
 CD4 45 48 25–53
 CD8 25 21 14–34
 CD19 20 26 14–44
 CD3− CD56+ 4 2 4–26
Serum immunglobulins (g/l)
 IgG 13.97 5.83 6.1–11.8
 IgA 3.35 0.82 0.46–1.34
 IgM 0.74 0.28 0.50–1.14
IgG subclasses (g/l)
 IgG1 8.41 4.81 4–9.45
 IgG2 3.12 2.41 0.36–2.25
 IgG3 0.34 0.575 0.13–1.22
 IgG4 3.54 0.038 0.02–1.12
Specific antibodies (ELISA)
 Anti‐Hib (μg/ml) 0.19 <0.15 >1
 Anti‐tetanus (IU/ml) 0.59 <0.01 >0.10
 Anti‐diphtheria (IU/ml) 0.10 <0.01 >0.10

Table 2 Serotype‐specific antibody responses to polysaccharide antigens.

Pneumococcus Response of patient 1 (age 5¾ years) μg/ml Response of patient 2 (age 2½ years) μg/ml Normal responses (age >3 years ) μg/ml
Serotype 3 3.02 1.4 >0.74
Serotype 4 0.22 0.1 >0.91
Serotype 6B 0.34 0.17 >0.68
Serotype 9N 0.54 0.46 >0.97
Serotype 14 0.55 0.3 ND
Serotype 18C 0.75 0.18 >0.58
Serotype 19F 0.9 0.26 >1.79
Serotype 23F ND <0.4 ND

For patient 1, data show specific antibody concentrations 2 weeks after immunisation with Pneumovax 23 plus the conjugate pneumococcal vaccine Prevenar (and 3 months after the secondary invasive pneumococcal disease caused by serotype 14). For patient 2, data show specific antibody concentrations 2 weeks after immunisation with Pneumovax 23 and 3 months after the last of a series of four monthly immunisations with Prevenar (13 and 7 months after the two episodes of invasive disease caused by Streptococcus pneumoniae serotypes 23F and 33F). Of the serotypes shown, 4, 6B, 9V, 14, 18C, 19F and 23F are present in both vaccines. Concentrations of specific antibodies were determined by ELISA (μg/ml). As a reference, the US Pneumococcal Reference Serum Lot 89‐SF was used. Normal responses were determined in 37 children (aged 4–15 years; distribution: 1, 8, 12 and 16 for the age groups 3–4, 5–6, 7–9, and 10–15 years, respectively). Antibody levels were determined 2–3 weeks after vaccination with Pneumovax. Cut‐off values given are the 5th percentile for the total group of controls. ND, not done.

At age 6½ years, IgG infusions were stopped. The antibody response to immunisation with 23‐valent pneumococcal vaccines remained impaired for six of the seven serotypes tested. Serotypes 4, 6B, 14, 18C and 19F are present in the heptavalent pneumococcal conjugate vaccine. We have no age‐matched normal values for serotype 14. However, for the other serotypes, normal values are consistently above 20% of the reference batch 89‐SF. In patient 1, the specific antibody concentration against serotype 14 was only 2% of the reference value. Natural blood allohaemagglutinin concentrations were very low (Group A Rh+, anti‐B antibody titre: 1/1).

Patient 2 was a 4½‐year‐old boy born to unrelated Belgian parents. He received all routine vaccinations with no adverse effect. In infancy, he developed mild but distinctive clinical features, such as frontal bossing, hypodontia with conical incisors and dry skin with normal sweating, consistent with a mild form of anhydrotic ectodermal dysplasia (EDA). At age 15 months he was hospitalised for 4 days for persistent fever (>38.5°C) with buccal cellulitis, caused by Streptococcus pneumoniae serotype 33. He recovered completely after treatment with intravenous cefuroxime for 7 days. Biological signs of inflammation were partly mild, with a CRP concentration of 52 mg/l but 20 000 leucocytes/mm3 with 43% PMNs.

At age 22 months, the patient developed a left‐sided limp with no fever, and mild periorbital cellulitis of the left eye caused by Streptococcus pneumoniae serotype 33. He was treated with intravenous ceftriaxone for 7 days. He had again dissociated biological signs of inflammation, with a CRP concentration of 31 mg/l and 23 000 leucocytes/mm3 with 55% PMNs. The local inflammation of the left foot gradually improved and the patient started walking again. He was given oral amoxicillin on discharge. Ten days later, while still taking this course of oral antibiotics, osteomyelitis of the left talus relapsed. The patient had dissociated biological signs of inflammation, with no raised CRP level and 14 500 leucocytes/mm3 with 39% PMNs. He was treated for 6 weeks with intravenous ampicillin, followed by a 1‐month course of oral clindamycin. He recovered without sequelae.

At age 23 months, the patient was vaccinated with heptavalent pneumococcal conjugate vaccine. He was given a second dose 2 months later. After 15 months, he received a 23‐valent pneumococcal vaccine. Despite these vaccinations, at age 2 years 7 months, he presented with isolated fever (38.7°C) because of infection with Streptococcus pneumoniae serotype 23. He recovered after a 10‐day course of oral ampicillin. Three months later he developed arthritis of the left hip, caused by Streptococcus pneumoniae serotype 23. He had again dissociated biological signs of inflammation, with a CRP concentration of 13 mg/l and 16 100 leucocytes/mm3 with 71% PMNs. He was given intravenous ceftriaxone for 15 days and underwent surgical drainage of the left hip. On discharge, treatment with oral amoxicillin was initiated. Monthly prophylactic treatment with intravenous immunoglobulins was started when the patient was 3 years 8 months old. This treatment was maintained until the patient's last follow‐up visit, at age 4 years 7 months.

The immunological profile of the patient was assessed at age 3½ years, before the initiation of immunoglobulin substitution. The spleen was visible on ultrasound scans. The classic and alternative complement pathways were normal. The patient had normal numbers of white cells and lymphocytes, normal levels of serum immunoglobulin isotypes and IgG subclasses, and normal numbers of T, B and natural killer cells (table 1). However, he had impaired antibody responses to tetanus and diphtheria toxoids, pertussis antigens, and measles and mumps viruses. The antibody response to rubella virus was positive. The antibody response to H influenzae type b conjugate vaccine was impaired. The antibody response to combined immunisation with both heptavalent pneumococcal conjugate vaccine and 23‐valent pneumococcal plain polysaccharide was impaired for all five serotypes tested, including the pathogenic serotypes 23F and 33F (table 2). Natural blood anti‐B allohaemagglutinin levels were low (group A Rh+, anti‐B antibody titre 1/2).

Immunological diagnostic procedures

Serum levels of the IgM, IgG, IgG subclasses, and of IgA, the killing of viable S aureus, the generation of superoxide anion by granulocytes and complement activity were assessed by standard techniques. Immunoglobulins and immunoglobulin subclasses were determined by nephelometry (Immage instrument, Beckman‐Coulter, Brea, California, USA) using reagents obtained from Beckman‐Coulter and Sanquin (Amsterdam, The Netherlands). Lymphocyte subsets were determined by routine flow cytometry. Flow cytometry was carried out on whole‐blood samples after red cell lysis, using an FACScan instrument (BD Biosciences, San Jose, California, USA). CD4 (FITC) and CD40L (PE) were obtained from BD Biosciences. We measured levels of IgG against H influenzae PRP antigens, tetanus toxoid and diphtheria toxoid by ELISA, using antigen‐coated plates. Antibody titres against serotype‐specific pneumococcal capsular polysaccharides were determined as described previously.40 The US Pneumococcal Reference Serum Lot 89‐SF was used as a reference.41 We determined IgG concentrations against serotype 3 (a strong immunogen), serotypes 4, 14, and 19F (intermediate immunogens), and serotypes 6B, 9N, and 18C (weak immunogens).

Primer sequence for genomic coding region of NEMO

  • Exon2

    • -

      Sense 5′‐TCTGCTGGGTAAGGATGTGG‐3′

    • -

      Antisense 5′‐TCTGCAGGTGGGGAGAAGAC‐3′

  • Exon3

    • -

      Sense 5′‐CCCAGCTCCCCTCCACTGTC‐3′

    • -

      Antisense 5′‐TAACCTGTGTCCTTTCCTTGT‐3′

  • Exon4

    • -

      Sense 5′‐CAGTGCTGACAGGAAGTGGC‐3′

    • -

      Antisense 5′‐GCCCCGGTCTATCCTCATCA‐3′

  • Exon5

    • -

      Sense 5′‐CATCAGCTCGCAGTCACAGG‐3′

    • -

      Antisense 5′‐CCGACACTTCTCAGCCTTTC‐3′

  • Exon6

    • -

      Sense 5′‐AAGGGGGTAGAGTTGGAAGC‐3′

    • -

      Antisense 5′‐AGGCAAGTCTAAGGCAGGTC‐3′

  • Exon7

    • -

      Sense 5′‐TCAGCATCTCCTCCTGTCGTT‐3′

    • -

      Antisense 5′‐CTGGGCAACAAGAGCAAAAC‐3′

  • Exon8

    • -

      Sense 5′‐TGCCTGGTGGGTGGCTGGCT‐3′

    • -

      Antisense 5′‐CAGTGTCGCACCCACTGCTCA‐3′

  • Exon9

    • -

      Sense 5′‐AGCTGCTTTGACACTAGTCCA‐3′

    • -

      Antisense 5′‐CAGAGAGCAACAGGAAGGTC‐3′

  • Exon10

    • -

      Sense 5′‐CGGCGGCTCCTGGTCTTACA‐3′

    • -

      Antisense 5′‐GCCACCCAGCCCATCCT‐3′

Cell stimulation by cytokines

For cytokine production, whole blood and SV40‐transformed fibroblasts were activated as previously described.39 ELISA tests for interleukin (IL)‐6 and IL‐10 (PeliPair reagent set, Sanquin) were carried out according to the manufacturer's instructions.

Biochemistry

For electrophoretic mobility shift assays, nuclear extracts were prepared as previously described4 from SV‐40‐transformed fibroblasts, after incubation with or without IL‐1β (10 ng/ml) and tumour necrosis (TNFα (20 ng/ml)) for 20 or 40 min. Electrophoretic mobility shift assays were carried out with a phosphorous32‐labelled NF‐κB‐specific DNA probe (5′‐GAT CAT GGG GAA TCC CCA‐3′, 5′‐GAT CTG GGG AAT TCC CCC AT‐3′). For western blotting, total proteins were extracted from SV40‐transformed fibroblasts. We used rabbit antibodies to IRAK4 (Tularik, Thousand Oaks, California, USA), rabbit antibodies against GADPH (SC‐25778, Santa Cruz Biotechnology, Santa Cruz, California, USA), mouse antibodies against STAT2 (SC‐476, Santa Cruz) and anti‐NEMO antibodies (3328, polyclonal rabbit antibody, a gift from Gilles Courtois and Alain Israel).

Human molecular genetics

We isolated genomic DNA from blood cells by phenol–chloroform extraction. RNA was extracted from Epstein–Barr virus‐immortalised lymphoblastoid cell lines or SV40‐transformed fibroblasts, using Trizol (Invitrogen, Carlsbad, California, USA), according to the manufacturer's instructions. RNA was reverse transcribed directly, with Oligo‐dT (Invitrogen) and reverse transciptase (Invitrogen). Polymerase chain reaction (PCR) was carried out with Taq polymerase (Invitrogen), using the GeneAmp PCR System 9700 (Applied Biosystems, Foster City, California, USA). The cDNA, exons and flanking intron regions of IRAK4 and NEMO were amplified by PCR. Box 1 gives the primer sequences for the genomic coding region of NEMO.

The PCR products were purified by centrifugation through Sephadex G‐50 Superfine resin (Amersham Biosciences) and sequenced using the BigDye Terminator Cycle sequencing kit (Applied Biosystems). Sequencing products were purified by centrifugation through Sephadex G‐50 Superfine resin and sequences were analysed with an ABI Prism 3100 apparatus (Applied Biosystems).

Results

Our two patients had impaired antibody responses to pneumococcal carbohydrates. In both patients, poor clinical and biological inflammatory responses during the infectious episodes42 and antipolysaccharide antibody deficiency6 suggested genetic defects in toll like receptor (TLR)–NF‐κB‐mediated immunity.5,6 The broader antibody deficiency in patient 2 suggested a defect further downstream in NF‐κB activation.39 After the activation of whole‐blood cells with TNFα, IL‐10 production was impaired in patient 2, but not in patient 1 (fig 1A), whereas IL‐6 production by whole‐blood cells in response to stimulation with IL‐1β and lipopolysaccharide was abolished in patient 1, and mildly but reproducibly impaired in patient 2 (fig 1B).

graphic file with name mg44446.f1.jpg

Figure 1 Stimulation of blood cells. (A) Interleukin (IL)10 production by whole‐blood cells from patient 1 (P1), patient 2 (P2), and 10 unrelated healthy controls (C) after stimulation with tumour necrosis factor (TNF)α (20 ng/ml) and (PMA)/ionomycin (10−7/10−5 M) for 48 h, as measured by ELISA. Control values are the means of independent experiments carried out on 10 controls, experiments carried out twice on the two patients. (B) IL‐6 production by whole‐blood cells from P1, P2 and six unrelated controls after stimulation with IL‐1β (10 ng/ml), lipopolysaccharide (LPS 10 ng/ml), and PMA/ionomycin (10−7/10−5 M) for 48 h, as measured by ELISA. Control values are the means of independent experiments carried out on 10 controls, experiments carried out twice on the two patients.

We then tested the response to IL‐1β, TNFα and PMA/ionomycin of SV40‐transformed skin‐derived fibroblasts from our patients, a healthy control (positive control, C+), and a NEMO‐deficient fetus (negative control, C–). Fibroblasts from patient 1 showed no response to IL‐1β but normal responses to TNFα (fig 2A, B), whereas fibroblasts from patient 2 showed impaired responses to both IL‐1β and TNFα (fig 2A, B). Overall, the pattern of response in patient 1 suggested a defect in the TLR and IL‐1R signalling pathways.4,5,6 By contrast, patient 2 probably had a defect downstream from the Toll/IL‐1R signalling pathway, affecting the TNFR pathway to a greater extent, possibly at the level of NF‐κB. The only known specific defect of the Toll/IL‐1R pathway is autosomal recessive IRAK4 deficiency.4 Mutations in NEMO3,43,44 and IKBA45 are associated with defects in NF‐κB activation.

graphic file with name mg44446.f2.jpg

Figure 2 Stimulation of fibroblasts. (A) Nuclear protein extracts from SV40‐transformed fibroblast lines from a healthy positive control (C+), a NEMO‐deficient fetus negative control (C–, bearing a large NEMO deletion encompassing exons 4–10 (from Smahi et al. Genomic rearrangement in NEMO impairs NF‐kappaB activation and is a cause of incontinentia pigmenti. The International Incontinentia Pigmenti (IP) Consortium. Nature 2000; 405:466–72; C–), patient 1 (P1) and patient 2 (P2) with or without stimulation with tumour necrosis factor (TNF)α (20 ng/ml), interleukin (IL)1β (10 ng/ml) for 20 or 40 min, were tested for DNA‐binding activity, using the κB DNA probe, and detected by electrophoretic mobility shift assay. (B) IL‐6 production by fibroblasts from a C+, a NEMO‐deficient fetus (C–), P1 and P2 after stimulation with TNF‐α (20 ng/ml), IL‐1β (10 ng/ml) or PMA/ionomycin (10−7/10−5 M). IL‐6 production was measured by ELISA after 24 h of activation and results are presented as a ratio.

In patient 1, we detected two heterozygotic mutations in IRAK4 in the intron located between exons 10 and 11 (1189–1 G→T and 1188+520 A→G) (fig 3A, B). We found no other mutation in the remaining exons. The 1189–1 G→T mutation was carried by the father and 1188+520 A→G by the mother (fig 3B). We did not detect these two mutations in 60 healthy Europeans. Reverse transcription PCR (RT‐PCR) of mRNA extracted from fibroblasts of patient 1 showed only trace amounts of full‐length wild‐type mRNA, with no detectable alternative splicing products (fig 4A). The paternal mutation, 1189–1 G→T, located in intron 10, probably affects mRNA splicing, whereas the effect of the maternal mutation, 1188+520 A→G, also located in intron 10, is less predictable. However, patient 1 and his mother produced an alternative mRNA product, corresponding to the retention of a fragment of the intron, as detected by RT‐PCR amplification of the region between exons 10 and 12 (fig 4B). This alternative mRNA was not detected in the patient's father. Western blotting showed that the IRAK4 protein was absent from the patient's fibroblasts (fig 4C), as in two previously described patients with IRAK4 deficiency.4 These data strongly suggest that the two single‐nucleotide mutations carried by the patient affect the splicing of IRAK4 mRNA, and are therefore disease‐causing mutations. Patient 1 is the first IRAK4‐deficient patient with non‐coding mutations to be identified.

graphic file with name mg44446.f3.jpg

Figure 3 IRAK4 and NEMO mutations. (A) Mutant (bottom) and wild‐type (top) sequences from patient 1 (P1) (IRAK4, 1188+520 A→G/1189–1 G→T) and patient 2 (P2) (NEMO, R173G). The mutated nucleotides are indicated by an arrow. (B) Pedigree of the families. Patients with clinical infectious diseases are shown in black, the heterozygotic, asymptomatic carrier of the NEMO mutant allele is indicated by a small black spot. (C) Schematic representation of the IRAK4 and NEMO coding regions, with the known IRAK4 amorphic and NEMO hypomorphic mutations, including the mutations found in P1 and P2 (underlined).

graphic file with name mg44446.f4.jpg

Figure 4 IRAK4 and NEMO expression. (A) Left: IRAK4 expression (full‐length cDNA) in fibroblasts from a healthy positive control (C+), IRAK4‐deficient fibroblasts (C–, mutation Q293X4) and patient 1 (P1). Right: NEMO expression (full‐length cDNA) in fibroblasts from a healthy positive control (C+), a NEMO‐deficient fetus (C–) and patient 2 (P2). (B) IRAK4 3′‐terminal real‐time polymerase chain reaction, corresponding to a segment spanning exons 10–12; additional alternative splicing caused by the 1188+520 A→G mutation was found in P1 and his mother (indicated by *). F, father; M, mother. (C) Top: IRAK4 protein production in fibroblasts from C+, two IRAK4‐deficient fibroblastic cell lines (mutations 821delT and Q293X4) and P1, as detected by western blotting with an anti‐IRAK4 antibody. Bottom: NEMO protein levels in fibroblasts from C+, a NEMO‐deficient fetus negative control (C–) and P2, as detected by western blotting with an anti‐NEMO antibody.

The sequencing of NEMO cDNA in patient 2 led to identification of the R173G mutation in exon 4 (nucleotide 518, C →G), two nucleotides away from the end of the exon (fig 3A, B). The mother of patient 2 was heterozygotic for this mutation, which was not found in 120 European controls (174 X chromosomes; fig 3B). We could not test for X inactivation in the mother's blood cells as she was homozygotic, and therefore not informative for the HUMARA and FMR1 loci (data not shown). Residue R173 in NEMO is conserved in all mammalian species studied to date—rats, mice and cows (NCBI GI40018574, GI31321959 and GI59858109, respectively)—and may help to stabilise the first coiled‐coil domain. RT‐PCR was carried out to amplify the full‐length NEMO cDNA, together with two additional lower‐molecular‐weight splicing products, corresponding to skipping of exons 4–6 and exons 5–6. The mutation therefore had an unexpected effect on mRNA splicing, probably owing to its location near the 3′ boundary of exon 4 (fig 4A). Western blotting showed that NEMO was produced but present in only small amounts in patient 2 (fig 4C). Our data show that patient 1 has autosomal recessive, complete IRAK4 deficiency, whereas patient 2 has X‐linked recessive, partial NEMO deficiency. As a result, both children had recurrent IPD.

Discussion

We report here on two otherwise healthy patients with recurrent IPD and mutations in NEMO or IRAK4. These two patients had no other bacterial, viral or fungal disease. All IRAK4‐deficient patients previously reported had pyogenic bacterial diseases.4,46,47,48,49,50,51 Similarly most previously reported patients with mutations in NEMO had a broad developmental or infectious phenotype.3,43,44,52,53,54 Not all children with mutations in NEMO have detectable signs of EDA,54,55,56,57 and a lack of developmental features should not exclude this diagnosis. However, patients with NEMO mutations and developmental abnormalities also tend to have a broad infectious phenotype, with multiple infectious diseases, unlike patient 2. The only other known patient with a mutation in NEMO and recurrent IPD as the sole infectious phenotype also had mild clinical EDA.39 All IRAK4‐deficient patients were reported to have multiple pyogenic bacterial diseases.4,46,47,48,49,50,51 Together, these data show that otherwise healthy children with recurrent IPD should be explored for NEMO and IRAK4 deficiencies.

Low‐level or delayed fever, or a slow or delayed rise in inflammatory markers, are suggestive of NEMO and IRAK4 deficiencies,42,47 even if antibodies against carbohydrates have been detected. Although most patients carrying mutations in NEMO (including patient 2) were shown to have an impaired antibody response to polysaccharides,5,6 all except two patients with IRAK4 deficiency (including patient 14,46,47,48,49,50,51; unpublished data) had apparently normal antibody responses to carbohydrates, including pneumococcal capsular antigens. It is unclear why most NEMO‐deficient patients cannot mount an antibody response to pneumococcus, whereas most IRAK‐deficiency patients can. In any event, our report indicates that patients having mutations in NEMO or IRAK4 may present with the narrow infectious phenotype of recurrent IPD. Otherwise healthy children with recurrent IPD should therefore be tested for disorders in the TLR–NF‐κB pathway, such as NEMO and IRAK4 deficiency, notably, but not exclusively, in the presence of poor inflammation or poor antibody responses to pneumococcus.

Abbreviations

CRP - C reactive protein

EDA - ectodermal dysplasia

IPD - invasive pneumococcal disese

PCR - polymerase chain reaction

PID - primary immunodeficiency

PMN - polymorphonuclear neutrophil

RT‐PCR - reverse transcription PCR

TLR - toll like receptor

TNF - tumour necrosis factor

Footnotes

Funding: The Laboratory of Human Genetics of Infectious Diseases is supported in part by grants from the Schlumberger and BNP Paribas Foundations, the Deutsche Forschungsgemeinschaft (VO 995‐1/1) and EU grant QLK2‐CT‐2002‐00846. Grants from the Hungarian Research Fund (OTKA T 038095 and OTKA T 049017) and the European Commission (EURO‐PID‐NAS QLQ1‐CT‐2001‐01395) to LM supported this work.

Competing interests: XB is a senior clinical investigator of the Fund for Scientific Research—Flanders. J‐LC is an International Scholar of the Howard Hughes Medical Institute.

References

  • 1.Wong W Y, Overturf G D, Powars D R. Infection caused by Streptococcus pneumoniae in children with sickle cell disease: epidemiology, immunologic mechanisms, prophylaxis, and vaccination. Clin Infect Dis 1992141124–1136. [DOI] [PubMed] [Google Scholar]
  • 2.Picard C, Puel A, Ku C L, Casanova J L. Primary immunodeficiencies associated with pneumococcal disease. Curr. Opin. Allergy Clin. Immunol 20033451–459. [DOI] [PubMed] [Google Scholar]
  • 3.Doffinger R, Smahi A, Bessia C, Geissmann F, Feinberg J, Durandy A, Bodemer C, Kenwrick S, Dupuis‐Girod S, Blanche S, Wood P, Rabia S H, Headon D J, Overbeek P A, Le Deist F, Holland S M, Belani K, Kumararatne D S, Fischer A, Shapiro R, Conley M E, Reimund E, Kalhoff H, Abinun M, Munnich A, Israel A, Courtois G, Casanova J L. X‐linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF‐kappaB signaling. Nat Genet 200127277–285. [DOI] [PubMed] [Google Scholar]
  • 4.Picard C, Puel A, Bonnet M, Ku C L, Bustamante J, Yang K, Soudais C, Dupuis S, Feinberg J, Fieschi C, Elbim C, Hitchcock R, Lammas D, Davies G, Al‐Ghonaium A, Al‐Rayes H, Al‐Jumaah S, Al‐Hajjar S, Al‐Mohsen I Z, Frayha H H, Rucker R, Hawn T R, Aderem A, Tufenkeji H, Haraguchi S, Day N K, Good R A, Gougerot‐Pocidalo M A, Ozinsky A, Casanova J L. Pyogenic bacterial infections in humans with IRAK‐4 deficiency. Science 20032992076–2079. [DOI] [PubMed] [Google Scholar]
  • 5.Puel A, Picard C, Ku C L, Smahi A, Casanova J L. Inherited disorders of NF‐kappaB‐mediated immunity in man. Curr Opin Immunol 20041634–41. [DOI] [PubMed] [Google Scholar]
  • 6.Ku C L, Yang K, Bustamante J, Puel A, von Bernuth H, Dos Santos O, Lawrence T, Chang H H, Al‐Mousa H, Picard C, Casanova J L. Inherited disorders of human Toll‐like receptor signalling: immunological implications. Immunol Rev 200520310–20. [DOI] [PubMed] [Google Scholar]
  • 7.Casanova J L, Abel L. Inborn errors of immunity to infection: the rule rather than the exception. J Exp Med 2005202197–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.King M D, Whitney C G, Parekh F, Farley M M. Recurrent invasive pneumococcal disease: a population‐based assessment. Clin Infect Dis 2003371029–1036. [DOI] [PubMed] [Google Scholar]
  • 9.Eskola J, Takala A K, Kela E, Pekkanen E, Kalliokoski R, Leinonen M. Epidemiology of invasive pneumococcal infections in children in Finland. Jama 19922683323–3327. [PubMed] [Google Scholar]
  • 10.Davidson M, Parkinson A J, Bulkow L R, Fitzgerald M A, Peters H V, Parks D J. The epidemiology of invasive pneumococcal disease in Alaska, 1986‐1990—ethnic differences and opportunities for prevention. J Infect Dis 1994170368–376. [DOI] [PubMed] [Google Scholar]
  • 11.Rodriguez‐Creixems M, Munoz P, Miranda E, Pelaez T, Alonso R, Bouza E. Recurrent pneumococcal bacteremia. A warning of immunodeficiency. Arch Intern Med 19961561429–1434. [DOI] [PubMed] [Google Scholar]
  • 12.Orlicek S L, Herrod H G, Leggiadro R J, Luedtke G, English B K. Repeated invasive pneumococcal infections in young children without apparent underlying immunodeficiency. J Pediatr 1997130284–288. [DOI] [PubMed] [Google Scholar]
  • 13.Totapally B R, Walsh W T. Pneumococcal bacteremia in childhood: a 6‐year experience in a community hospital. Chest 19981131207–1214. [DOI] [PubMed] [Google Scholar]
  • 14.Venetz I, Schopfer K, Muhlemann K. Paediatric, invasive pneumococcal disease in Switzerland, 1985‐1994. Swiss Pneumococcal Study Group. Int J Epidemiol 1998271101–1104. [DOI] [PubMed] [Google Scholar]
  • 15.Kalima P, Emmanuel F X, Riordan T. Epidemiology of Streptococcus pneumoniae infections at the Edinburgh City Hospital: 1980‐95. Epidemiol Infect 1999122251–257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Eriksson M, Henriques B, Ekdahl K. Epidemiology of pneumococcal infections in Swedish children. Acta Paediatr Suppl 20008935–39. [DOI] [PubMed] [Google Scholar]
  • 17.Font B, Lliminana C, Fontanals D, Pineda V, Segura F. Eleven‐year study of recurrent pneumococcal bacteremia. Eur J Clin Microbiol Infect Dis 200120636–638. [PubMed] [Google Scholar]
  • 18.Turett G S, Blum S, Telzak E E. Recurrent pneumococcal bacteremia: risk factors and outcomes. Arch Intern Med 20011612141–2144. [DOI] [PubMed] [Google Scholar]
  • 19.Coccia M R, Facklam R R, Saravolatz L D, Manzor O. Recurrent pneumococcal bacteremia: 34 episodes in 15 patients. Clin Infect Dis 199826982–985. [DOI] [PubMed] [Google Scholar]
  • 20.McEllistrem M C, Mendelsohn A B, Pass M A, Elliott J A, Whitney C G, Kolano J A, Harrison L H. Recurrent invasive pneumococcal disease in individuals with human immunodeficiency virus infection. J Infect Dis 20021851364–1368. [DOI] [PubMed] [Google Scholar]
  • 21.Hongeng S, Wilimas J A, Harris S, Day S W, Wang W C. Recurrent Streptococcus pneumoniae sepsis in children with sickle cell disease. J Pediatr 1997130814–816. [DOI] [PubMed] [Google Scholar]
  • 22.Teo D T, Tan T Y, Eng S P, Chan Y M. Spontaneous cerebrospinal fluid otorrhoea via oval window: an obscure cause of recurrent meningitis. J Laryngol Otol 2004118717–720. [DOI] [PubMed] [Google Scholar]
  • 23.Motojima T, Fujii K, Ishiwada N, Takanashi J, Numata O, Uchino Y, Yamakami I, Kohno Y. Recurrent meningitis associated with a petrous apex cephalocele. J Child Neurol 200520168–170. [DOI] [PubMed] [Google Scholar]
  • 24.Gopal V, Bisno A L. Fulminant pneumococcal infections in 'normal' asplenic hosts. Arch Intern Med 19771371526–1530. [PubMed] [Google Scholar]
  • 25.Gill D G, Kara M. Septicaemia and adrenal haemorrhage in congenital asplenia. Arch Dis Child 1991661366–1367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gilbert B, Menetrey C, Belin V, Brosset P, de Lumley L, Fisher A. Familial isolated congenital asplenia: a rare, frequently hereditary dominant condition, often detected too late as a cause of overwhelming pneumococcal sepsis. Report of a new case and review of 31 others. Eur J Pediatr 2002161368–372. [DOI] [PubMed] [Google Scholar]
  • 27.Schutze G E, Mason E O., Jr Barson WJ, Kim KS, Wald ER, Givner LB, Tan TQ, Bradley JS, Yogev R, Kaplan SL. Invasive pneumococcal infections in children with asplenia. Pediatr Infect Dis J 200221278–282. [DOI] [PubMed] [Google Scholar]
  • 28.Figueroa J E, Densen P. Infectious diseases associated with complement deficiencies. Clin Microbiol Rev 19914359–395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Thong Y H, Simpson D A, Muller‐Eberhard H J. Homozygous deficiency of the second component of complement presenting with recurrent bacterial meningitis. Arch Dis Child 198055471–473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Attwood J T, Williams Y, Feighery C. Impaired IgG responses in a child with homozygous C2 deficiency and recurrent pneumococcal septicaemia. Acta Paediatr 20019099–101. [DOI] [PubMed] [Google Scholar]
  • 31.Jonsson G, Truedsson L, Sturfelt G, Oxelius V A, Braconier J H, Sjoholm A G. Hereditary C2 deficiency in Sweden: frequent occurrence of invasive infection, atherosclerosis, and rheumatic disease. Medicine (Baltimore) 20058423–34. [DOI] [PubMed] [Google Scholar]
  • 32.Hazlewood M A, Kumararatne D S, Webster A D, Goodall M, Bird P, Daha M. An association between homozygous C3 deficiency and low levels of anti‐pneumococcal capsular polysaccharide antibodies. Clin Exp Immunol 199287404–409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Totan M. Recurrent pneumococcal meningitis in homozygous C3 deficiency. Indian J Pediatr 200269625–626. [DOI] [PubMed] [Google Scholar]
  • 34.Farhoudi A, Bazargan N, Pourpak Z, Mahmoudi M. Two related cases of primary complement deficiency. Immunol Invest 200332313–321. [DOI] [PubMed] [Google Scholar]
  • 35.Gelfand E W, Rao C P, Minta J O, Ham T, Purkall D B, Ruddy S. Inherited deficiency of properdin and C2 in a patient with recurrent bacteremia. Am J Med 198782671–675. [DOI] [PubMed] [Google Scholar]
  • 36.Peters T R, Brumbaugh D E, Lawton A R, Crowe J E., Jr Recurrent pneumococcal arthritis as the presenting manifestation of X‐linked agammaglobulinemia. Clin Infect Dis 2000311287–1288. [DOI] [PubMed] [Google Scholar]
  • 37.Wood P M, Mayne A, Joyce H, Smith C I, Granoff D M, Kumararatne D S. A mutation in Bruton's tyrosine kinase as a cause of selective anti‐polysaccharide antibody deficiency. J Pediatr 2001139148–151. [DOI] [PubMed] [Google Scholar]
  • 38.Ohga S, Okada K, Asahi T, Ueda K, Sakiyama Y, Matsumoto S. Recurrent pneumococcal meningitis in a patient with transient IgG subclass deficiency. Acta Paediatr Jpn 199537196–200. [DOI] [PubMed] [Google Scholar]
  • 39.Ku C L, Dupuis‐Girod S, Dittrich A M, Bustamante J, Santos O F, Schulze I, Bertrand Y, Couly G, Bodemer C, Bossuyt X, Picard C, Casanova J L. NEMO mutations in 2 unrelated boys with severe infections and conical teeth. Pediatrics 2005115e615–e619. [DOI] [PubMed] [Google Scholar]
  • 40.Jeurissen A, Wuyts G, Kasran A, Ramdien‐Murli S, Blanckaert N, Boon L, Ceuppens J L, Bossuyt X. The human antibody response to pneumococcal capsular polysaccharides is dependent on the CD40‐CD40 ligand interaction. Eur J Immunol 200434850–858. [DOI] [PubMed] [Google Scholar]
  • 41.Wernette C M, Frasch C E, Madore D, Carlone G, Goldblatt D, Plikaytis B, Benjamin W, Quataert S A, Hildreth S, Sikkema D J, Kayhty H, Jonsdottir I, Nahm M H. Enzyme‐linked immunosorbent assay for quantitation of human antibodies to pneumococcal polysaccharides. Clin Diagn Lab Immunol 200310514–519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.von Bernuth H, Puel A, Ku C L, Yang K, Bustamante J, Chang H H, Picard C, Casanova J L. Septicaemia without sepsis: inherited disorders of NF‐kB‐mediated inflammation. Clin Infect Dis 200541S436–S439. [DOI] [PubMed] [Google Scholar]
  • 43.Zonana J, Elder M E, Schneider L C, Orlow S J, Moss C, Golabi M, Shapira S K, Farndon P A, Wara D W, Emmal S A, Ferguson B M. A novel X‐linked disorder of immune deficiency and hypohidrotic ectodermal dysplasia is allelic to incontinentia pigmenti and due to mutations in IKK‐gamma (NEMO). Am J Hum Genet 2000671555–1562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jain A, Ma C A, Liu S, Brown M, Cohen J, Strober W. Specific missense mutations in NEMO result in hyper‐IgM syndrome with hypohydrotic ectodermal dysplasia. Nat Immunol 20012223–228. [DOI] [PubMed] [Google Scholar]
  • 45.Courtois G, Smahi A, Reichenbach J, Doffinger R, Cancrini C, Bonnet M, Puel A, Chable‐Bessia C, Yamaoka S, Feinberg J, Dupuis‐Girod S, Bodemer C, Livadiotti S, Novelli F, Rossi P, Fischer A, Israel A, Munnich A, Le Deist F, Casanova J L. A hypermorphic IkappaBalpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cell immunodeficiency. J Clin Invest 20031121108–1115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Medvedev A E, Lentschat A, Kuhns D B, Blanco J C, Salkowski C, Zhang S, Arditi M, Gallin J I, Vogel S N. Distinct mutations in IRAK‐4 confer hyporesponsiveness to lipopolysaccharide and interleukin‐1 in a patient with recurrent bacterial infections. J Exp Med 2003198521–531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Enders A, Pannicke U, Berner R, Henneke P, Radlinger K, Schwarz K, Ehl S. Two siblings with lethal pneumococcal meningitis in a family with a mutation in Interleukin‐1 receptor‐associated kinase 4. J Pediatr 2004145698–700. [DOI] [PubMed] [Google Scholar]
  • 48.Currie A J, Davidson D J, Reid G S, Bharya S, MacDonald K L, Devon R S, Speert D P. Primary immunodeficiency to pneumococcal infection due to a defect in Toll‐like receptor signaling. J Pediatr 2004144512–518. [DOI] [PubMed] [Google Scholar]
  • 49.Chapel H, Puel A, von Bernuth H, Picard C, Casanova J L. Shigella sonnei meningitis due to interleukin‐1 receptor‐associated kinase‐4 deficiency: first association with a primary immune deficiency. Clin Infect Dis 2005401227–1231. [DOI] [PubMed] [Google Scholar]
  • 50.Cardenes M, von Bernuth H, Garcia‐Saavedra A, Santiago E, Puel A, Ku C L, Emile J F, Picard C, Casanova J L, Colino E, Bordes A, Garfia A, Rodriguez‐Gallego C. Autosomal recessive Interleukin‐1 receptor‐associated kinase 4 deficiency in fourth‐degree relatives. J Pediatr 2006148549–551. [DOI] [PubMed] [Google Scholar]
  • 51.Takada H, Yoshikawa H, Imaizumi M, Kitamura T, Takeyama J, Kumaki S, Nomura A, Hara T. Delayed separation of the umbilical cord in two siblings with Interleukin‐1 receptor‐associated kinase 4 deficiency: rapid screening by flow cytometer. J Pediatr 2006148546–548. [DOI] [PubMed] [Google Scholar]
  • 52.Orange J S, Jain A, Ballas Z K, Schneider L C, Geha R S, Bonilla F A. The presentation and natural history of immunodeficiency caused by nuclear factor kappaB essential modulator mutation. J Allergy Clin Immunol 2004113725–733. [DOI] [PubMed] [Google Scholar]
  • 53.Orstavik K H, Kristiansen M, Knudsen G P, Storhaug K, Vege A, Eiklid K, Abrahamsen T G, Smahi A, Steen‐Johnsen J. Novel splicing mutation in the NEMO (IKK‐gamma) gene with severe immunodeficiency and heterogeneity of X‐chromosome inactivation. Am J Med Genet A 200614031–39. [DOI] [PubMed] [Google Scholar]
  • 54.Filipe‐Santos O, Bustamante J, Haverkamp M H, Vinolo E, Ku C L, Puel A, Frucht D M, Christel K, von Bernuth H, Jouanguy E, Feinberg J, Durandy A, Senechal B, Chapgier A, Vogt G, de Beaucoudrey L, Fieschi C, Picard C, Garfa M, Chemli J, Bejaoui M, Tsolia M N, Kutukculer N, Plebani A, Notarangelo L, Bodemer C, Geissmann F, Israel A, Veron M, Knackstedt M, Barbouche R, Abel L, Magdorf K, Gendrel D, Agou F, Holland S M, Casanova J L. X‐linked susceptibility to mycobacteria is caused by mutations in NEMO impairing CD40‐dependent IL‐12 production. J Exp Med 20062031745–1759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Orange J S, Levy O, Brodeur S R, Krzewski K, Roy R M, Niemela J E, Fleisher T A, Bonilla F A, Geha R S. Human nuclear factor kappa B essential modulator mutation can result in immunodeficiency without ectodermal dysplasia. J Allergy Clin Immunol 2004114650–656. [DOI] [PubMed] [Google Scholar]
  • 56.Niehues T, Reichenbach J, Neubert J, Gudowius S, Puel A, Horneff G, Lainka E, Dirksen U, Schroten H, Döffinger R, Casanova J L, Wahn V. A NEMO‐deficient child with immunodeficiency yet without anhidrotic ectodermal dysplasia. J Allergy Clin Immunol 20041141456–1462. [DOI] [PubMed] [Google Scholar]
  • 57.Puel A, Reichenbach J, Bustamante J, Ku C L, Feinberg J, Doffinger R, Bonnet M, Filipe‐Santos O, Beaucoudrey L, Durandy A, Horneff G, Novelli F, Wahn V, Smahi A, Israel A, Niehues T, Casanova J L. The NEMO mutation creating the most‐upstream premature stop codon is hypomorphic because of a reinitiation of translation. Am J Hum Genet 200678691–701. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Medical Genetics are provided here courtesy of BMJ Publishing Group

RESOURCES