Mechanisms and regulation of vitamin C uptake: studies of the hSVCT systems in human liver epithelial cells

Abstract

Humans use two sodium-ascorbate cotransporters (hSVCT1 and hSVCT2) for transporting the dietary essential micronutrient ascorbic acid, the reduced and active form of vitamin C. Although the human liver plays a pivotal role in regulating and maintaining vitamin C homeostasis, vitamin C transport physiology and regulation of the hSVCT systems in this organ have not been well defined. Thus, this research used a human hepatic cell line (HepG2), confirming certain results with primary human hepatocytes and determined the initial rate of ascorbic acid uptake to be Na⁺ gradient, pH dependent, and saturable as a function of concentration over low and high micromolar ranges. Additionally, hSVCT2 protein and mRNA are expressed at higher levels in HepG2 cells and native human liver, and the cloned hSVCT2 promoter has more activity in HepG2 cells. Results using short interfering RNA suggest that in HepG2 cells, decreasing hSVCT2 message levels reduces the overall ascorbic acid uptake process more than decreasing hSVCT1 message levels. Activation of PKC intracellular regulatory pathways caused a downregulation in ascorbic acid uptake not mediated by a single predicted PKC-specific amino acid phosphorylation site in hSVCT1 or hSVCT2. However, PKC activation causes internalization of hSVCT1 but not hSVCT2. Examination of other intracellular regulatory pathways on ascorbic acid uptake determined that regulation also potentially occurs by PKA, PTK, and Ca²⁺/calmodulin, but not by nitric oxide-dependent pathways. These studies are the first to determine the overall ascorbic acid uptake process and relative expression, regulation, and contribution of the hSVCT systems in human liver epithelial cells.

vitamin c (ascorbic acid), a water-soluble micronutrient, is required for normal cellular functions, growth, and development. Although most mammals synthesize vitamin C via the glucuronic acid pathway in the liver, during the course of evolution, humans have lost the ability to make vitamin C and must obtain it from dietary sources. Most vitamin C exists in two forms as ascorbic acid (reduced active form) and dehydro-ascorbic acid (oxidized form). Ascorbic acid is an effective antioxidant, acting as a free radical scavenger, and an essential cofactor in numerous enzymatic reactions (16). A dietary deficiency of vitamin C can lead to clinical abnormalities such as scurvy, delayed wound healing, bone and connective tissue disorders and vasomotor instability (16). Recent studies have implied that optimizing vitamin C body homeostasis can offer a protective effect against gall bladder diseases, nonalcoholic liver diseases, cardiovascular disease, cancers, and cataract formation (5, 10, 12, 23). The molecular mechanisms involved in maintaining and regulating vitamin C body homeostasis are not well understood.

The liver is an important target for the antioxidant effects of vitamin C and plays a role in vitamin body homeostasis, yet the ascorbic acid uptake mechanism in the liver has not been investigated thoroughly (3, 26), especially in humans. In addition, nothing is known about how the liver ascorbic acid uptake systems are regulated or about their contribution to the process. Work in other cell/tissue models (reviewed in Ref. 22) show general ascorbic acid transport to be Na⁺-dependent and temperature-dependent and occur via a specialized carrier-mediated mechanism. Additional studies have shown that ascorbic acid transport occurs via two cloned isoforms, the human sodium-dependent vitamin C transporters-1 and -2 (hSVCT1 and hSVCT2, the product of the SLC23A1 and SLC23A2 genes, respectively), each mediating sodium-dependent accumulation of L-ascorbic acid in a variety of expression systems (6, 14, 18, 27, 28). The transporters are structurally similar with 12 transmembrane spanning topology and cytoplasmic COOH- and NH₂-terminal domains and functionally similar with a high affinity for L-ascorbic acid. The K_m values range from 65 to 237 μM for hSVCT1 and 8–62 μM for hSVCT2, depending on the cell system used, and hSVCT1 exhibits a higher V_max, suggesting the possibility that hSVCT2 is a high-affinity/low-capacity transporter, while hSVCT1 is a high-capacity/low-affinity carrier (22). Interestingly, hSVCT1 and hSVCT2 display differential tissue distribution, studies suggest hSVCT1 expression is confined to epithelia involved in bulk transport, such as the kidney and intestine, and hSVCT2 expression is more widespread occurring in neurons, the endocrine system, bone, and other tissue (25, 27, 28). A simultaneous comparison of the expression levels of the hSVCT systems and a comprehensive study of ascorbic acid uptake and regulation in the liver has not been performed.

The purpose of this investigation was to provide the first detailed study of the physiology of the ascorbic acid uptake process, as well as the expression, contribution, and regulation of the hSVCT transporters in the human liver. We used an established human-derived hepatic cell line (HepG2) complemented by data from primary human liver cells and characterized ascorbic acid uptake and kinetics. We also compared expression of hSVCT1 and hSVCT2 protein and message levels, promoter activities, and ultimately used hSVCT-specific short interfering RNAs (siRNAs) to gain information regarding how each of the hSVCTs may contribute to the overall ascorbic acid uptake in the human liver. Finally, an examination of intracellular regulatory pathways suggest that ascorbic acid uptake is under the regulation of PKC, PKA, PTK, and Ca²⁺/calmodulin (CaM) dependent pathways with the PKC regulatory effect causing internalization of hSVCT1, but not hSVCT2.

MATERIALS AND METHODS

Materials.

[¹⁴C]-Ascorbic acid (13 mCi/mmol) and [³H]-biotin (30 Ci/mmol) were purchased from Amersham (Arlington Heights, IL) and American Radiolabeled Chemicals (St. Louis, MO), respectively. All chemicals and reagents used in this study were of analytical/molecular biology grade and were purchased from commercial sources.

Cell culture and uptake studies.

Human primary hepatocytes were purchased from Cellzdirect, (Austin, TX). These cells were isolated from anonymous donors and are considered Institutional Review Board exempt. The human-derived hepatic epithelial HepG2 cells (passage 20; American Type Culture Collection, Manassas, VA; these cells were derived from a 15-yr-old male Caucasian) were grown in DMEM supplemented with 10% (vol/vol) FBS, glutamine (0.29 g/l), sodium bicarbonate (2.2 g/l), penicillin (100,000 U/l), and streptomycin (10 mg/l) in 75-cm² plastic flasks at 37°C in a 5% CO₂-95% air atmosphere with media changes every 2 or 3 days. The cells were plated at a density of 2 × 10⁵ cells/well onto 12-well plates. Uptake was measured at 37°C in Krebs-Ringer buffer (in mM: 133 NaCl, 4.93 KCl, 1.23 MgSO₄, 0.85 CaCl₂, 5 glucose, 5 glutamine, 10 HEPES, and 10 MES, pH 7.4). Labeled and unlabeled ascorbic acid or biotin was added to the incubation medium at the onset of incubation, and uptake was examined during the initial linear period, as described previously (19). Uptake of ascorbic acid and biotin by the carrier-mediated system was determined by subtracting uptake by passive diffusion (determined from the slope of the line between uptake at a high pharmacological concentration of 1 mM and the point of origin) from total uptake. In studies of the effect of intracellular regulatory pathway modulators on ascorbic acid uptake, cells were pretreated at the specific concentrations given in Table 2 for 1 h. The short incubation time allows effects to be measured that are most likely not due to synthesis of new proteins. Protein content of cell digests was measured in parallel wells by using a Bio-Rad D_c protein assay kit (Bio-Rad, Richmond, VA).

Quantitative real-time PCR and Western blot analysis.

Quantitative PCR (qPCR)was performed using the Bio-Rad iCycler (Hercules, CA) and a Qiagen Quantitect SYBR Green PCR kit (Valencia, CA). RNA from HepG2 cells and human liver RNA (Clontech, Mountain View, CA) was isolated using TriZOL (Invitrogen, Carlsbad, CA), following the manufacturer's instructions. The RNA was DNase treated and first-strand cDNA was made from 5 μg of the isolated total RNA primed with oligo dT using an Invitrogen Superscript synthesis system. The RT products were then used in the subsequent qPCR with primers specific for the human SVCT1 (forward, 5′-TCATCCTCTTCTCCCAGTACCT-3′ and reverse, 5′-AGAGCAGCCACACGGTCAT-3′); human SVCT2 (forward, 5′-TCTTTGTGCTTGGATTTTCGAT-3′ and reverse 5′-ACGTTCAACACTTGATCGATTC-3′); human SMVT (forward, 5′-TGTCTACCTTCTCCATCATGGA-3′ and reverse, 5′-TAGAGCCCAATGGCAAGAGA-3′); or the human β-actin (forward 5′-AGCCAGACCGTCTCCTTGTA-3′ and reverse, 5′-TAGAGAGGGCCCACCACAC-3′). The qPCR consisted of a 15-s 95°C melt followed by 40 cycles of 95°C melt for 30 s, 58°C annealing for 30 s, and 72°C extension and data collection for 1 min. Melt curve analysis with plasmid DNA was performed for the generation of standard curves, and negative controls without RT were used with every reaction. To compare the relative relationship between hSVCT levels, we used a calculation method provided by the iCycler manufacturer (Bio-Rad) described previously (19). Western blot analysis was performed as previously described (21) using antibodies (1:200 dilution) designed to be specific for the human SVCT proteins (Santa Cruz Biotech, Santa Cruz, CA) with protein samples obtained from HepG2 cells and human whole liver tissue lysate (Imgenex, San Diego, CA). Densities of specific bands were determined (as unitless measurements) using the Eagle Eye II system (Stratagene, La Jolla, CA).

Cloning of the 5′-regulatory region for the SLC23A1 gene.

To obtain the genomic DNA fragment that contained the 5′-regulatory region of the SLC23A1 gene, we used the sequence information deposited in GenBank (accession no. AC135457) for the SLC23A1 gene and flanking sequence. A PCR was then performed using two gene specific primers (forward, 5′-CTAGCTAGCTGGTGTGGTGATGTAATCGCC-3′ and reverse, 5′-CCGCTCGAGCTCATCTTTGGGGCACAGGTT-3′) and 100 ng of human genomic DNA (Invitrogen). A reaction buffer and polymerase specially developed to allow amplification through GC-rich regions in the DNA sequence was used (Advantage GC Genomic PCR Kit; Clontech). PCR conditions were denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95 C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 4 min, and then a final extension at 72°C for 15 min. The 3065 base pair product was run on a 0.7% agarose gel and purified. The purified DNA was then cut with the restriction enzymes NheI and XhoI (sequence encoded in the primers) and subcloned into the pGL3-basic vector (Promega, Madison, WI), cut with the same enzymes. The entire DNA sequence was verified (Laragen, Los Angeles, CA).

Cell culture, transfection, and luciferase assay.

Four micrograms of each of the full-length promoter-luciferase constructs for hSVCT1 and hSVCT2 were transfected separately into HepG2 cells using the Lipofectamine 2000 reagent (Invitrogen, San Diego, CA) and the manufacturer's procedure. To normalize for transfection efficiency, the cells were cotransfected with 100 ng of pRL-TK (Promega, Madison, WI) plasmid along with the promoter constructs. Total cell lysate was prepared from cells 24 h posttransfection, and firefly luciferase activity was assayed using the dual luciferase kit (Promega) and a Turner Design 20/20 Luminometer (Sunnyvale, CA). The activity was normalized to the Renilla luciferase activity from pRL-TK in the same extract. Data presented are the means ± SE of at least three independent experiments and given as fold expression over pGL3-basic expression set arbitrarily at one. Statistical analysis was performed using the Student's t-test. For imaging, HepG2 cells were grown on sterile glass-bottomed petri dishes (MatTek, Ashland, MA) and transiently transfected with 4 μg of hSVCT1-YFP or hSVCT2-YFP or mutant constructs at 90% confluency using Lipofectamine 2000 (Invitrogen). After 24–48 h, cells were analyzed by confocal microscopy. For generation of stable cell lines, transiently transfected cells were selected using G418 (0.5 mg/ml) for ∼6–8 wk.

Generation of hSVCT1 and hSVCT2-YFP PKC mutants.

The Quik change site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to introduce insertions of nucleotides into the open reading frame (ORF) of SLC23A1 and SLC23A2. Paired sense and anti-sense primer oligonucleotides encompassing the specified mutation sites (Table 1), as well as a plasmid containing either the ORF of hSVCT1 or hSVCT2 fused to YFP-N1 (24) were used as a template for PCR mutagenesis [hSVCT2 ORF cDNA was obtained from Dr. Horst Fisher, Children's Hospital San Francisco, CA (8)]. Nucleotide changes in all constructs were confirmed by sequencing (Laragen, Los Angeles, CA).

Table 1.

Gene-specific primers used for generating mutations in SLC23A1 and A2

Amino Acid	Forward and Reverse Primers (5′-3′)
hSVCT1
T15A	GGCCGGACACAGCATGAAGCCACCAGGGACCCCTCGACC
	GGTCGAGGGGTCCCTGGTGGCTTCATGCTGTGTCCGGCC
S396A	GGAATTACCAAGGTGGGCGCCCGGCGCGTGGTGCAGTAT
	ATACTGCACCACGCGCCGGGCGCCCACCTTGGTAATTCC
S454A	CAATTTGTGGACATGAACGCCTCTCGCAACCTCTTCGTG
	CACGAAGAGGTTGCGAGAGGCGTTCATGTCCACAAATTG
S540A	AGTGACATGTCTTCCGCCCTCAAGAGCTACGATTTCCCC
	GGGGAAATCGTAGCTCTTGAGGGCGGAAGACATGTCACT
S574A	AAAGGATTTTCTTCAGCTTCAAAAGATCAGATTGCAATT
	AATTGCAATCTGATCTTTTGAAGCTGAAGAAAATCCTTT
hSVCT2
T9A	GGTATTGGTAAGAATACCGCATCCAAATCAATGGAGGCT
	AGCCTCCATTGATTTGGATGCGGTATTCTTACCAATACC
S299A	CCTCTCCCGATTTATAAAGCCAAGAAAGGATGGACTGCG
	CGCAGTCCATCCTTTCTTGGCTTTATAAATCGGGAGAGG
S455A	ATTACAAAGGTCGGCGCCCGCCGCGTGATACAG
	CTGTATCACGCGGCGGGCGCCGACCTTTGTAAT
S513A	CAGTTCATTGATTTAAATGCTTCCCGGAACCTCTTTGTG
	CACAAAGAGGTTCCGGGAAGCATTTAAATCAATGAACTG
T629A	CCAACCTTTGTGGGCTACGCATGGAAAGGCCTCAGGAAG
	CTTCCTGAGGCCTTTCCATGCGTAGCCCACAAAGGTTGG

Nucleotide changes in forward and reverse primers (bold) were used for generating point mutations.

Confocal imaging.

HepG2 cell expressing hSVCT1 or 2-YFP or PKC mutants grown on coverslip-fixed petri dishes (MatTek) were imaged using a Nikon C-1 confocal scanner head attached to Nikon Inverted phase contrast microscope. Fluorophores were excited using the 488-nm line from an argon ion laser, and emitted fluorescence was monitored with a 530 ± 20 nm bandpass yellow fluorescent protein (YFP) (24).

siRNA transfection assay.

Four predesigned siRNAs for hSVCT1 and hSVCT2 and one control were purchased (Qiagen, Germantown, MD), each made from the companies GeneSolution technology, which minimizes the risk of off-target effects (SLC23A1-3, 5′-CAAGACTAATGCATAATATTA-3 targets 2282-2302, SLC23A1-4, 5′-AAGCATGGTATATAACAGGAA-3 targets 1889-1901, SLC23A1-5, 5′-TAAGTTTGACATGTTGTACAA-3 targets 140-160, SLC23A1-6, 5′-TACATTGAATTTGACCCTACA-3 targets 2255-2275, numbering from Entrez mRNA reference NM 152685.2 and SLC23A2-1 5′-AAGACCAAATATCCAAATAAA-3 targets 4468-4488, SLC23A2-2, 5′-CTCGCCTATCTCCTTATTTAA-3 targets 2521-2541, SLC23A2-3, 5′-CCCGATTTATAAATCCAAGAA-3 targets 1275-1295, SLC23A2-4, 5′-AAGAACTTAGATGCTAAATTA-3 targets 4202-4222, numbering from Entrez mRNA reference NM 203327.1; the control is AllStars1, which has a proprietary sequence that is not disclosed). Transient transfection of subconfluent (<80%) HepG2 cells seeded in 12-well plates with each specific siRNA (titration of 25, 50, and 100 pmol/well) were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) and the manufacturers protocol. Cells were incubated in the transfection reagent for 48 h then switched to DMEM with 10% FBS and antibiotics for 24 h. Subsequent uptake experiments, RNA isolation and qPCR were then performed as described above.

Statistical analysis.

Transport data presented in this paper are the result of three separate experiments and are expressed as means ± SE in pmol·mg protein⁻¹·3 min⁻¹. Western blot analysis, qPCR, and siRNA assays were all performed on at least three separate occasions. Differences between the means of control and treated cells for various outcome parameters were tested for significance using either the Student's t-test or initial ANOVA analysis followed by post hoc testing with the critical value P chosen as 0.05. Kinetic parameters of the saturable ascorbic acid uptake process [determined by subtracting the diffusing component (determined from the slope of the uptake line between a high pharmacological concentration of ascorbic acid of 1 mM and the point of origin) from total uptake at each concentration] were calculated using a computerized model of the Michaelis-Menten equation, as described previously by Wilkinson (29).

RESULTS

Ascorbic acid uptake in human hepatic HepG2 cells and isolated primary human liver cells.

We first established that the human-derived hepatic epithelial cell line HepG2 and human primary hepatocytes isolated from human organ donors both possess a potential carrier-mediated mechanism for ascorbic acid uptake. When incubated with ¹⁴C-ascorbic acid (32 μM), both cell lines were found to have a mechanism to take up ascorbic acid (880 ± 12, and 325 ± 9 pmol·mg protein⁻¹·3 min⁻¹ in HepG2 cells and human primary hepatocytes, respectively). The ¹⁴C-ascorbic acid uptake was inhibited by unlabeled ascorbic acid (124 ± 9, and 62 ± 6 pmol·mg protein⁻¹·3 min⁻¹ in HepG2 cells and human primary hepatocytes, respectively). Further characterization of the uptake mechanisms in these liver epithelial cells is described below.

Uptake of ascorbic acid in HepG2 cells; role of Na⁺ and H⁺ gradients.

Using human-derived hepatic epithelial cells (HepG2) uptake of ascorbic acid was determined to be linear as a function of time over an entire 5-min incubation period (data not shown), and thus a 3-min incubation time was used as the standard in all subsequent studies. The role of Na⁺ in ascorbic acid uptake was tested by replacing the Na⁺ in the incubation medium isosmotically with Li⁺, and the results show clear Na⁺ dependence (P < 0.01) for the uptake (889 ± 13 and 112 ± 8 pmol·mg protein⁻¹·3 min⁻¹ in HepG2 cells with Na⁺ and with Li⁺, respectively). In support of this finding, we also demonstrated that the presence of the Na-K-ATPase inhibitor, ouabain caused a significant decrease (P < 0.01) in ascorbic acid uptake (787 ± 23 and 108 ± 6 pmol·mg protein⁻¹·3 min⁻¹ in HepG2 cells in the absence and presence of ouabain, respectively). In another study, ascorbic acid uptake in HepG2 cells was found to be H⁺ sensitive given that changing buffer pH from 5 to 8 showed optimal uptake in the pH neutral range of 7 to 8 and that at lower pH values uptake decreased (Fig. 1A).

Fig. 1.

Initial rate of carrier-mediated ascorbic acid uptake by HepG2 cells and primary human liver cells at various buffer pH. HepG2 (A) or primary human liver (B) cells were incubated for uptake studies at 37°C in Krebs-Ringer buffer pH 5–8. [¹⁴C]-ascorbic acid (32 μM) was added to the incubation medium at the onset of incubation. Uptake was measured after a 3-min incubation (i.e., initial rate; data not shown). Data are the means ± SE of three to five separate uptake determinations.

Uptake of ascorbic acid in primary human hepatocytes: role of Na⁺ and H⁺ gradients.

To further establish the validity of the HepG2 cell model system for studying human liver ascorbic acid uptake and regulation, we confirmed the results with Na⁺ and H⁺ concentration in isolated primary human hepatocytes and found clear Na⁺ dependence (P < 0.01) for the uptake and optimal uptake in the pH neutral range of 7.0 to 8.0 (332 ± 10 pmol·mg protein⁻¹·3 min⁻¹ with Na⁺ and 65 ± 9 pmol·mg protein⁻¹·3 min⁻¹ with Li⁺ and Fig. 1B for pH data). The results further establish the physiological relevance of our studies and give confidence in more elaborate ascorbic acid uptake studies in our human liver HepG2 cell model system, described below.

Uptake of ascorbic acid as a function of concentration.

The initial rate of ascorbic acid uptake in HepG2 cells was examined as a function of increasing the substrate concentration in the medium (Fig. 2). Uptake was found to have a saturable component at both low and high micromolar concentrations, and kinetic parameters (apparent K_m and V_max) were calculated as described previously (29) and in materials and methods. The apparent K_m for the low micromolar (1 to 20 μM) range was calculated to be 10 ± 1.72 μM with a V_max 800 ± 17.6 pmol·mg⁻¹·3 min⁻¹. Extending the study by using higher substrate concentrations (ranging from 20 to 200 μM) yielded values of apparent K_m of 70 ± 1.47 μM and V_max 2,300 ± 55 pmol·mg⁻¹·3 min⁻¹ (Fig. 2, A and B). To support our results, we applied the entire concentration-dependent uptake data to the Eadie-Hofstee plot, a nonlinear relationship was produced (Fig. 2C) that fits well with a model describing the involvement of two saturable transport systems for ascorbic acid uptake in HepG2 cells. These findings are in line with previously published kinetic data for carrier-mediated transport by both hSVCT1 and hSVCT2 (22).

Fig. 2.

Initial rate of ascorbic acid uptake by HepG2 cells as a function of concentration. [¹⁴C]-ascorbic acid uptake by HepG2 cells as a function of concentration over the range of 1 to 20 μM (A) or 20 to 200 μM (B) was examined in Krebs-Ringer buffer (pH 7.4). Kinetic parameters of the carrier-mediated system were determined as previously described (17). Data are the means ± SE of 3 to 5 separate uptake determinations. C: Eadie-Hofstee plot (V/S vs. V), where V is the uptake rate in pmol·mg protein⁻¹·3 min⁻¹, and S is the ascorbic acid concentration in micromoles.

Specificity of ascorbic acid uptake, effect of structural analogs.

The effect of the addition of a high K_m concentration (100 μM) of ascorbic acid structural analogs isoascorbate and dehydro-ascorbate in the incubation medium were examined during ¹⁴C-ascorbic acid uptake in HepG2 cells. The results show the analogs do not inhibit the uptake of ascorbic acid, demonstrating the specificity of the transport process (Fig. 3).

Fig. 3.

Effect of structural analogs on ascorbic acid uptake. The effect of the ascorbic acid (AA) structural analogs isoascorbic acid (iso-AA) and dehydroascorbic acid (DH-AA) is compared with the effect of ascorbic acid (all at 100 μM) on the initial rate of [¹⁴C]-ascorbic acid (32 μM) uptake by HepG2 cells. Data are the means ± SE of 3 to 5 separate uptake determinations.

Effect of membrane transport inhibitors on the ascorbic acid uptake process.

We examined the effect of the membrane transport inhibitors 4,4′-diisothiocyano-2,2′-stillbene-disulfonic acid (DIDS), probenecid, amiloride, and furosemide (all at 1 mM) on the carrier-mediated uptake of ¹⁴C-ascorbic acid in HepG2 cells. The results show that DIDS significantly inhibited (P < 0.01), and probenecid had a moderate inhibition (P < 0.05), yet amiloride and furosemide had no effect on the carrier-mediated uptake process of ascorbic acid (Fig. 4).

Fig. 4.

Effect of membrane transport inhibitors on ascorbic acid uptake. The effect of the membrane transport inhibitors 4,4′-diisothiocyano-2,2′-stillbene-disulfonic acid (DIDS), probenecid, furosemide, and amiloride (all at 1 mM) are compared on the initial rate of [¹⁴C]-ascorbic acid (32 μM) uptake by HepG2 cells. Data are the means ± SE of 3 to 5 separate uptake determinations (*P < 0.01, **P < 0.05). The P values were determined by initial ANOVA analysis followed by post hoc testing.

Expression of hSVCT1 and hSVCT2 protein and mRNA in HepG2 cells and native human liver.

The expression levels of the hSVCT1 and hSVCT2 protein and mRNA were determined in HepG2 cells and compared with samples from isolated native human liver. Western blot analysis was performed on proteins using hSVCT1- or hSVCT2-specific antibodies (Santa Cruz Biotech, Santa Cruz, CA), with loading differences normalized to band densities of the β-actin protein. The hSVCT2 protein levels were found to be higher than hSVCT1 (Fig. 5A) in both HepG2 and human liver samples. (Densities for hSVCT1 1.1 ± 0.1 and 0.82 ± 0.1 and for hSVCT2 1.8 ± 0.17 and 1.3 ± 0.1 in HepG2 and human liver, respectively, for both). The difference in protein levels correlated with differences at the mRNA level, in that quantitative real-time PCR results using hSVCT1 and hSVCT2 gene-specific primers show that hSVCT2 message levels are higher (P < 0.01) than hSVCT1 message levels (Fig. 5B).

Fig. 5.

Expression of hSVCT1 and hSVCT2 protein and mRNA in HepG2 cells and native human liver. A: Western blot analysis was performed using 150 μg of protein from membranous fraction of HepG2 cells or native human liver samples (Imgenex, San Diego, CA). The blot was probed with polyclonal antibodies directed against either hSVCT1 or hSVCT2 and detected using the enhanced chemiluminescence system. An antibody against β-actin was used to normalize data and as a control for sample loading. Note the lane images show proteins detected on a representative single blot; however, they were rearranged for clarity of presentation. B: real-time quantitative PCR was performed using gene-specific primers for hSVCT1 or hSVCT2 and total RNA isolated from HepG2 cells or human liver samples. Data are from 3 different experiments and expressed relative to β-actin as means ± SE and presented as relative expression over control cells that were set at one (*P < 0.01).

Transfected hSVCT1 and hSVCT2 promoter activity in HepG2 cells.

We had previously reported the cloning and characterization of the hSVCT2 promoter and its activity in a variety of epithelial cells (20). The promoter for hSVCT1; however, has not been established, and nothing is known about either of the promoter activities in HepG2 cells. To determine whether the promoter activities of hSVCT1 and hSCVCT2 correlates with the endogenous message levels of hSVCT1 and hSVCT2 in HepG2 cells, we first cloned the hSVCT1 promoter, established the activity in several different cell lines (data not shown), then examined each of the promoters activities in transiently transfected HepG2 cells. The cloned 3,065 base pair hSVCT1 promoter sequence was subjected to computational analysis (MatInspector, Genomatix) and found to contain a predicted promoter with a GC-rich region and TATA box. The results of promoter activity studies show that the hSVCT2 promoter-reporter construct has significantly higher (P < 0.01) activity than the hSVCT1 promoter-reporter construct (Fig. 6). The results support our findings that the level of expression of the endogenous hSVCT2 RNA is higher in HepG2 cells compared with hSVCT1.

Fig. 6.

Transfected hSVCT1 and hSVCT2 promoter activity in HepG2 cells. The cell line was transfected with the promoter-luciferase constructs for hSVCT1 or hSVCT2, with the results of a luciferase assay for each transfection shown. Firefly luciferase activity was normalized relative to the activity of simultaneously expressed Renilla luciferase. The results are expressed relative to the pGL3-basic vector set at 1 and represent means ± SE of at least 3 independent experiments (*P < 0.01).

Relative contribution of hSVCT1 and hSVCT2 to the overall carrier-mediated ascorbic acid uptake: studies with siRNA.

To gain information regarding the relative contribution of hSVCT1 and hSVCT2 toward overall carrier-mediated ascorbic acid uptake in human-derived liver epithelial cells, we used HepG2 cells transiently transfected with specific siRNA. The results show that pretreating HepG2 cells with siRNA for hSVCT1 led to a specific and significant reduction in the endogenous hSVCT1 mRNA (P < 0.01, 80%), while pretreating HepG2 cells with siRNA for hSVCT2 led to a specific and significant reduction in the endogenous hSVCT2 mRNA level (P < 0.01, 75%), compared with control siRNA-treated and -untreated cells (Fig. 7, A and B). The siRNA treatments affected only the intended message; the other hSVCT transporter mRNA levels (Fig. 7, A and B) or the levels of the human biotin transporter hSMVT mRNA (Fig. 7C) were unaltered, demonstrating the specificity of the effect. Western blot analysis revealed that hSVCT1 siRNA treatment reduced hSVCT1 protein levels by 23%, while hSVCT2 siRNA treatment reduced hSVCT2 protein levels by 27%, each compared with control siRNA treated HepG2 cells (Fig. 7D). With findings that confirm the effectiveness of the siRNA approach, we next examined the effect of pretreating the HepG2 cells with specific siRNAs at the functional level of ascorbic acid uptake. The initial rate of carrier-mediated uptake of ascorbic acid (32 μM) into siRNA hSVCT1 and two pretreated, control pretreated and untreated cells was examined. Results show that siRNA for hSVCT1 and hSVCT2 each specifically lead to a significant (P < 0.05, 20% and P < 0.01, 40% for hSVCT1 and hSVCT2, respectively) inhibition in carrier-mediated ascorbic acid uptake compared with control (Fig. 8A). When HepG2 cells were pretreated with specific siRNAs against hSVCT1 and hSVCT2 simultaneously, a reduction of the individual endogenous mRNA was observed (Figs. 7, A and B), and there was also inhibition of carrier-mediated ascorbic acid uptake (Fig. 8A). The specificity of the treatment was observed by comparison of uptake of the unrelated biotin (15 nM), with results showing it was not affected by any siRNA pretreatments (Fig. 8B). Four siRNAs each for either hSVCT1 or hSVCT2 were purchased (Qiagen) and tested by titration at 25, 50, or 100 pmol/well for their ability to selectively and specifically reduce RNA levels (see materials and methods). All of the siRNAs tested were able to specifically decrease either hSVCT1 or hSVCT2 message levels and specifically decrease ascorbic acid uptake, thereby working at the functional level and thus demonstrating multiplicity of controls. The data shown are representative of the results for all siRNAs and was at the optimal siRNA concentration (50 pmol/well) and using the hSVCT1 siRNA SLC23A1-5 and the hSVCT2 siRNA SLC23A2-2.

Fig. 7.

Quantitative PCR analysis of siRNA-treated HepG2 cells. Quantitative real-time PCR (qPCR) was performed on reverse transcribed total RNA isolated from control HepG2 cells and those pretreated with gene-specific short interfering RNA (siRNA). A: hSVCT1-specific qPCR on siRNA-pretreated cells. B: hSVCT2-specific qPCR on siRNA-pretreated cells. C: hSMVT-specific qPCR on siRNA-pretreated cells (*P < 0.01). Primers and PCR conditions used are described under materials and methods. Data (means ± SE) are from at least three separate sets of cells and were normalized relative to β-actin and calculated using a relative relationship method supplied by the iCycler manufacturer (Bio-Rad). D: Western blot analysis was performed using 150 μg of protein from membranous fraction of HepG2 cells treated with siRNA for hSVCT1, hSVCT2, or control probed with indicated specific polyclonal antibodies and detected using the ECL system. Note the lane images show proteins detected on a representative single blot; however, they were rearranged for clarity of presentation.

Fig. 8.

Initial rate of carrier-mediated ascorbic acid uptake by siRNA-treated HepG2 cells. Uptake was performed on cells from control HepG2 cells and those pretreated with gene-specific siRNA. Cells were incubated for uptake studies at 37°C in Krebs-Ringer buffer pH 7.4. [¹⁴C]-ascorbic acid (32 μM) (A) or [³H]-biotin (15 nM) (B) was added to the incubation medium at the onset of incubation. Uptake was measured after a 3-min incubation. Data are the means ± SE of 3 to 5 separate uptake determinations (*P < 0.01, **P < 0.05). The P values were determined by initial ANOVA analysis followed by post hoc testing.

Regulation of ascorbic acid uptake by glucocorticoids.

Previous studies suggested that ascorbic acid uptake in osteoblast cell lines was increased in the presence of glucocorticoids (4, 9, 17). To examine whether a similar effect is observed in HepG2 cells, we performed carrier-mediated ¹⁴C-ascorbic acid uptake studies in the presence of 100 μM concentrations of the glucocorticoid compounds budesonide, dexamethasone, and mifepristone and found no significant changes (819 ± 13, 802 ± 11, 812 ± 9, and 822 ± 13 pmol·mg protein⁻¹·3 min⁻¹ in HepG2 cells with control, budesonide, dexamethasone, and mifepristone, respectively). The results suggest that the glucocorticoid effect may be tissue/cell type specific.

Effect of the PKC intracellular regulatory pathway on ascorbic acid uptake.

This study examined ascorbic acid uptake in HepG2 cells, and the contribution of the intracellular regulatory pathway mediated by PKC. The modulator phorbol 12-myristate 13-acetate (PMA) an activator of the PKC-mediated pathway significantly (P < 0.01) decreased ascorbic acid uptake (Table 2), while the inactive analog 4-α-PMA had no effect compared with vehicle-only controls. Given this result a further examination of the molecular mechanisms involved in the PKC effect were explored as described below.

Table 2.

Effect of intracellular regulatory pathway modulators/inhibitors on ¹⁴C-ascorbic acid uptake in HepG2 cells

Intracellular Regulatory Pathway	Specific Pathway Modulator	14C-Ascorbic Acid Uptake pmol·mg−1·3 min−1
Control	None	700±15
PKC	PMA
	1 μM	352±25
	4-α-PMA
	1 μM	654±24
PKA	8-BrcAMP
	1 mM	406±35
PTK	Genistein
	50 μM	415±13
	100 μM	335±13
	Tyrphostin A25
	50 μM	559±16
	100 μM	355±7
Ca2+/CaM	CaM
	10 μM	303±8
	25 μM	92±10
	50 μM	78±11
	TFP
	50 μM	300±19
	100 μM	64±6
	W13
	100 μM	435±4
NO	SNAP
	0.5 mM	660±24
	SNP
	0.5 mM	650±24
	8-BrcGMP
	0.5 mM	600±30

PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; PKA, protein kinase A; 8-BrcAMP, 8-bromo cyclic-AMP; PTK, protein tyrosine kinase; Ca²⁺/CaM, calcium calmodulin; CaM, calmidazolium; TFP, trifluroperazine; W13, N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide; NO, nitric oxide; SNAP, S-Nitrose-N-acetylpenicillamine; SNP sodium nitroprusside; 8-BrcGMP, 8-bromo cyclic-GMP. For all significant differences, P < 0.01.

Examination of potential sites in hSVCT1 and hSVCT2 for PKC regulation of uptake.

A computational analysis of the hSVCT1 and hSVCT2 primary amino acid sequence revealed each transporter to have potential PKC phosphorylation sites (18, 27). In an attempt to identify which sites in each transporter may be involved in the PKC pathway effects on ascorbic acid uptake in HepG2 cells described above, we performed site-specific mutagenesis, changing potential phosphorylation sites (T or S to A), in hSVCT1 and hSVCT2 (Table 1 lists primers for mutagenesis). Mutated constructs were transfected into HepG2 cells, then cells were treated with PMA, and uptake studies were performed compared with controls to determine whether mutation of specific sites abolished the PMA effect of decreasing ascorbic acid uptake in the HepG2 cells. Mutations in hSVCT1 PKC sites (T15A, S396A, S454A, S540A, or S574A) had no effect on the PMA-induced decrease in ascorbic acid uptake; Fig. 9A shows data for S540A and S574A, and similar results were obtained with the other mutations. In addition, mutations in hSVCT2 PKC sites (T9A, S299A, S455A, S513A, and T629A) also showed no effect on the PMA-induced decrease in ascorbic acid uptake. Figure 9B shows data for S513A and S629A; similar results were obtained with the other mutations. We confirmed, using confocal microscopy, that none of the mutations altered cell membrane targeting of either hSVCT1 or hSVCT2. Figure 9C shows data for hSVCT1 S540A and S574A; similar results were obtained with the other mutations (data not shown). Figure 9D shows data for hSVCT2 S513A and S629A; similar results were obtained with the other mutations (data not shown).

Fig. 9.

Mutational analysis of potential PKC sites in hSVCT1 and hSVCT2. The initial rate of [¹⁴C]ascorbic acid (32 μM) uptake by HepG2 cells transfected with hSVCT1 (A) or hSVCT2 (B) mutated and nonmutated constructs with and without 1 h PMA treatment is shown. The single-letter abbreviation corresponding to the original amino acid, then the new amino acid mutation (S/T→A), and position is given at the bottom (i.e., S540A). Uptake is compared with a nontransfected control HepG2 cell line, as well as a vector alone transfected HepG2 cell line. Data are the means ± SE of 3 to 5 separate uptake determinations (*P < 0.01). C and D: representative confocal lateral (x,y) images showing cell membrane localization of hSVCT1-YFP/hSVCT2-YFP and mutant constructs expressing in HepG2 cells.

Effect of the PKC pathway on hSVCT1 and 2-YFP membrane expression in live HepG2 cells.

To examine the effect of PMA treatment on hSVCT1 and hSVCT2 membrane expression, we used stably transfected hSVCT1-YFP and hSVCT2-YFP constructs and live cell confocal imaging of HepG2 cells. The results show that hSVCT1-YFP fluorescence decreases in the plasma membrane upon PMA treatment with an increase in numerous small-vesicle fluorescence near the membrane and intracellular pool, suggesting an internalization event (Fig. 10, hSVCT1, top). The internalization event does not occur in four α-PMA-treated cells (Fig. 10, hSVCT1, top). However, hSVCT2-YFP membrane fluorescence was unaltered with PMA or four α-PMA treatment (Fig. 10, hSVCT2, top). In addition, we observed that the PMA effect on hSVCT1-YFP fluorescence was reversible, that is, removal of PMA caused the fluorescence to be predominately relocated to the plasma membrane in the same sampled live cell population (Fig. 10, hSVCT1, bottom), while after PMA treatment to hSVCT2-YFP-transfected cells, minor accumulation of fluorescence was observed in a small number of intracellular vesicles in some cells, but the result was not consistent from cell to cell. Therefore, we conclude that the overall fluorescence pattern for hSVCT2-YFP did not change significantly. (Fig. 10, hSVCT2, bottom).

Fig. 10.

Effect of PMA treatment on the cell membrane localization of hSVCT1-YFP and hSVCT2-YFP stably expressing HepG2 cells. Stable hSVCT1-YFP (top) or hSVCT2-YFP (bottom) expressing live HepG2 cells were incubated for 1 h in the presence of 1 μM 4α-PMA or PMA then imaged using confocal microscopy. Bottom panels of hSVCT1 and hSVCT2 images show the removal of PMA or 4α-PMA after 1 h of incubation, and then, cells remained in the 37°C incubator for an additional 24 h.

Effect of other intracellular regulatory pathways on ascorbic acid uptake in HepG2 cells.

These studies examined ascorbic acid uptake in HepG2 cells and the contribution of specific intracellular regulatory pathways mediated by PKA, PTK, Ca²⁺/calmodulin (Ca²⁺/CaM), and nitric oxide (NO). We focused on these pathways because previous studies have documented their role in the regulation of transport of other nutrients/substrates in a variety of epithelial cells (1, 2, 7).

In all experiments, the effects were tested by examining [¹⁴C]ascorbic acid uptake (32 μM) in HepG2 cells pretreated (for 1 h) with specific modulators, as shown in Table 2 or vehicle-only controls. To test for a PKA-mediated pathway, the modulator 8-bromo cAMP (1 mM) was used with the results showing a significant (P < 0.01) effect of decreasing ascorbic acid uptake. PTK-mediated pathway effects were tested with genistein (50 and 100 μM) and tyrphostin A25 (50 and 100 μM), with both these compounds significantly (P < 0.01) decreasing ascorbic acid uptake. The Ca²⁺/CaM-mediated pathway was tested with the specific modulators, calmidazolium (CaM; 10, 25, and 50 μM), trifluroperazine (50 and 100 μM), or N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide (W13; 100 μM). The results show that pretreatment with each of these Ca²⁺/CaM-mediated pathway modulators led to a significant (P < 0.01 for all) inhibition in ascorbic acid uptake. Finally, we determined the potential role of the NO-mediated pathway in the regulation of ascorbic acid uptake by HepG2 cells by pretreating the cells with inhibitors of this pathway, S-nitroso-N-acetylpenicillamine, sodium nitroprusside, and 8-bromo cGMP, all at 0.5 mM. None of the compounds had a significant effect.

DISCUSSION

Although the liver is an important target for the antioxidant effects of vitamin C and plays a role in vitamin body homeostasis, modest work has been performed regarding the ascorbic acid uptake mechanism in this vital organ. The purpose of the work described in this investigation was to provide the first detailed study of the ascorbic acid uptake process, as well as the expression, relative contribution, and regulation of the hSVCT transporters in the human liver. The studies used a human-derived liver epithelial cell line (HepG2) and confirmed the physiological relevance of the studies with findings in isolated human hepatocytes from donors.

Our results indicate that the liver ascorbic acid uptake process is Na⁺ gradient and pH dependent, saturable as a function of concentration with both an apparent K_m for the low and high micromolar range, results that are in line with previously published kinetic data for carrier-mediated transport by both hSVCT1 and hSVCT2 (22). In addition, ascorbic acid uptake in HepG2 cells was not inhibited by structural analogs Iso-ascorbate or dehydro-ascorbate again supporting that the transport process is mediated by the hSVCT transporters. Ascorbic acid uptake in HepG2 cells was inhibited by the membrane transport inhibitors probenecid and DIDS but not by the diuretic agents furosemide or amiloride. These results are consistent with the notion that membrane salt gradients are important for driving ascorbic acid uptake into liver cells.

Further studies designed to gain an understanding of the contribution of the two transport systems determined that hSVCT2 appears to be expressed at higher levels in terms of both protein and message levels in HepG2 cells and in the human liver. This observed mRNA expression data are consistent with previously published data on native human liver mRNA expression levels (18, 27). In addition, our study is supported by promoter analysis of the cloned 5′-regulatory regions for the genes that show both promoters have activity in HepG2 cells with the hSVCT2 promoter, having higher activity than the hSVCT1 promoter. It is interesting to mention that our expression results for hSVCT1 and hSVCT2 contradict results from other studies that used rat or mouse tissues showing SVCT1 is expressed at higher levels than SVCT2 in the liver (11, 15). The difference or lack of agreement between the SVCT expression patterns in rodent and human livers may result from the fact that unlike rodents, humans do not synthesize ascorbic acid and thus may express and regulate the SVCT genes in the liver differently. In addition, our findings further support the necessity of performing detailed studies of ascorbic acid regulation in human cells or human tissue samples.

To gain an understanding of the relative contribution of hSVCT transporters toward overall carrier-mediated ascorbic acid uptake by human liver cells, we used the HepG2 cellular model system that we established and employed an siRNA approach to selectively silence hSVCT1 or hSVCT2. Pretreatment of HepG2 cells with siRNA specific for the hSVCT1 message led to a significant and specific silencing of the hSVCT1 RNA (80%) and a minor but significant (20%) and specific inhibition in the initial rate of uptake of a physiological concentration of ascorbic acid. When the approach was used on hSVCT2, again a significant specific silencing of the message was observed (75%), as well as a more robust and significant (40%) inhibition in carrier-mediated ascorbic acid uptake compared with the hSVCT1 study. When HepG2 cells were simultaneously pretreated with siRNAs specific for hSVCT1 and hSVCT2, although both messages were reduced to similar levels as observed with individual treatment alone, no more inhibition in carrier-mediated ascorbic acid uptake was observed than with the hSVCT2 siRNA alone. These findings suggest that both hSVCT1 and hSVCT2 play a role in carrier-mediated ascorbic acid uptake by human liver epithelial cells and that hSVCT2-mediated ascorbic acid transport may be more sensitive to alterations in its mRNA levels. This conclusion is based on the fact that even though hSVCT1 mRNA was decreased by as much as hSVCT2 mRNA with siRNA, the uptake in the presence of hSVCT2 siRNA was decreased by twice the hSVCT1 siRNA treatment. However, we could not achieve complete inhibition of uptake with both siRNAs, suggesting that there may be an effect on ascorbic acid uptake due to hSVCT1 and/or hSVCT2 protein turnover rate or there may be potential limitations of the siRNA approach. A definitive explanation will require further investigations.

When we examined the effect of the PKC intracellular regulatory pathway on ascorbic acid uptake in HepG2 cells, we found that uptake was inhibited by the modulator PMA. The PKC-mediated pathway was further characterized in this study to begin to gain an understanding of its role in ascorbic acid uptake regulation. First, we used a mutagenesis approach, changing potential PKC regulatory sites in hSVCT1 and hSVCT2 and showed that no single potential amino acid phosphorylation site could be attributed to the effect. The result suggests that the PMA effect may not be mediated through a direct phosphorylation event but could be mediated by other mechanisms, such as protein-protein interactions. However, we cannot rule out the possibility that multiple phosphorylation sites may be involved or that sites other than the ones we targeted are involved. Next, we were able to confirm that in living cells hSVCT1, but not hSVCT2, is internalized during PMA treatment. This result is comparable to a previous finding using fixed Cos-1 cells (13) and supports the idea of a dynamic event of membrane relocalization for hSVCT1 but not hSVCT2. We were able to extend the study by showing that in the same pool of live PMA-treated HepG2 cells when PMA was withdrawn, the hSVCT1-YFP-containing vesicles were no longer predominantly found in the intracellular pool but in the plasma membrane. It is very interesting to speculate that this is a rapid downregulation event that is removing hSVCT1 from the plasma membrane to vesicles that are then poised for return to the plasma membrane to upregulate. The caveat is that the current study does not discern whether internalized hSVCT1-YFP vesicles are destined for degradation and/or whether the hSVCT1-YFP that appears at the plasma membrane after PMA withdrawal is due to new protein synthesis. Further studies will be required to address this issue. In addition, these results suggest that regulation of hSVCT1 in HepG2 cells can occur via a rapid regulatory mechanism that is not dependent on mRNA levels. This may tie in with our siRNA results, which showed alterations in mRNA levels for hSVCT2 had a more dramatic effect on ascorbic acid uptake than alterations in hSVCT1 mRNA levels. More studies will be required to clarify these issues.

When we examined the effect of other intracellular regulatory pathways on ascorbic acid uptake in HepG2 cells, we found no stimulation by glucocorticoids and uptake was not NO dependent. However, we did find uptake was dependent on PKA, PTK, and Ca²⁺/CaM pathways. Modulators of these pathways all led to a significant inhibition in ascorbic acid uptake, a finding that is similar to what has been seen for other nutrient transporters in a variety of cellular systems (1, 2, 7). The findings suggest the possible involvement of a common intracellular pathway for the regulation of nutrient uptake in different human tissues. The cellular mechanism(s), through which any one of these intracellular regulatory pathways exert their effects on ascorbic acid uptake, are not clear and require further investigations.

In summary, this investigation provides novel information on the ascorbic acid uptake process, as well as the expression, relative contribution, and regulation of the hSVCT transporters in the human liver. An established human hepatic cell line (HepG2) was used with data complemented by studies of primary human liver cells. The ascorbic acid uptake process, kinetics, and regulation were characterized. In addition, expression of hSVCT1 and hSVCT2 protein and message levels was compared, and ultimately using hSVCT-specific siRNAs, we gained information regarding how each of the hSVCTs may contribute to the overall ascorbic acid uptake in the human liver. Finally, PKC activation potentially causes internalization of hSVCT1, which appears to be reversible but does not alter hSVCT2 membrane expression. Taken together, our results suggest the possibility that in the human liver, hSVCT2 expression is more susceptible to regulation at the RNA level, while hSVCT1 appears to be regulated at the protein level by membrane redistribution events.

GRANTS

The work was supported by grants from the Department of Veterans Affairs and the National Institutes of Health (DK-56061 and DK-58057 to H. M. Said, DK73032 to J. C. Reidling, and DK71538 to V. S. Subramanian).