Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Aug 1.
Published in final edited form as: Dev Cell. 2008 Aug;15(2):322–329. doi: 10.1016/j.devcel.2008.06.004

Ectodermal Smad4 and p38 MAPK are functionally redundant in mediating TGF-β/BMP signaling during tooth and palate development

Xun Xu 1, Jun Han 1, Yoshihiro Ito 1, Pablo Bringas Jr 1, Chuxia Deng 2, Yang Chai 1
PMCID: PMC2610417  NIHMSID: NIHMS66185  PMID: 18694570

Abstract

Smad4 is a central intracellular effector of TGF-β signaling. Smad-independent TGF-β pathways, such as those mediated by p38 MAPK, have been identified in cell culture systems, but their in vivo functional mechanisms remain unclear. In this study, we investigated the role of TGF-β signaling in tooth and palate development and noted that conditional inactivation of Smad4 in oral epithelium results in much milder phenotypes than those seen with the corresponding receptor mutants, Bmpr1a and Tgfbr2, respectively. Perturbed p38 function in these tissues likewise has no effect by itself, but that when both Smad4 and p38 functions are compromised, dramatic recapitulation of the receptor mutant phenotypes results. Thus, our study demonstrates that p38 and Smad4 are functionally redundant in mediating TGF-β signaling in diverse contexts during embryonic organogenesis. The ability of epithelium to utilize both pathways illustrates the complicated nature of TGF-β signaling mechanisms in development and disease.

Keywords: TGF-β, p38 MAPK, Smad4, Smad-independent pathway, tooth, palate

INTRODUCTION

TGF-β/BMP signaling plays an important role in pattern formation and organogenesis (Andl et al., 2004; Chai and Maxson, 2006; Xu et al., 2006). In the craniofacial region, BMP is a critical regulator for epithelial-mesenchymal interaction during tooth development. Epithelial BMP4 induces the expression of Msx1 in the dental mesenchyme, then Msx1 further induces Bmp4 expression in the mesenchyme. Ectopic BMP4 can rescue the defective tooth phenotype in Msx1-deficient mice (Zhao et al., 2000). BMP4 also induces the expression of p21 and Msx2 in the dental epithelium and is associated with enamel knot formation (Jernvall et al., 1998). Ablation of Bmpr1a in the dental epithelium causes the arrest of tooth development at the early bud stage (Andl et al., 2004; Liu et al., 2005).

TGF-β signaling also plays an important role in regulating palatogenesis. During mouse palate development, TGF-β1 and TGF-β3 are expressed in the medial edge epithelium (MEE), whereas TGF-β2 is expressed in the mesenchyme beneath the MEE (Fitzpatrick et al., 1990; Pelton et al., 1990). Tgfb 3 null mutant mice exhibit cleft palate with 100% phenotype penetrance (Kaartinen et al., 1995; Proetzel et al., 1995), and the failure of palatal fusion can be rescued by adding exogenous TGF-β3 in an organ culture model (Brunet et al., 1995; Taya et al., 1999). TGF-β3 is required for the fusion of palatal shelves by inducing apoptosis in the MEE (Martinez-Alvarez et al., 2000). TGF-β IIR is expressed in both the MEE and the cranial neural crest (CNC) derived palatal mesenchyme (Cui et al., 1998). Ablation of Tgfbr2 in the palatal mesenchyme compromises cell proliferation and causes complete cleft palate (Ito et al., 2003), whereas ablation of Tgfbr2 in the palatal epithelial cells suppresses apoptosis and results in soft palate cleft and submucosal cleft (Xu et al., 2006).

The canonical TGF-β/BMP signaling pathway includes binding of the ligand to initiate the assembly of a heteromeric complex of type II and type I receptors. The activated type I receptor phosphorylates the receptor-regulated Smads (R-Smad), which bind to common Smad (Smad4) and move into the nucleus. In the nucleus, this Smad complex associates with other transcription factors to regulate the expression of target genes. Although Smad4 occupies the central part of this signaling cascade (Massague, 1998; Pelton et al., 1990), studies using Smad4-deficient cells, or dominant-negative Smads, support the possibility that TGF-β/BMP signaling can operate in a Smad4-independent manner (Derynck and Zhang, 2003). TGF-β can activate mitogen activated protein kinases (MAPK) signaling pathways, which include extracellular signal-regulated kinase (Erk), c-Jun N-terminal kinases (JNKs) and p38 kinases pathways (Adachi-Yamada et al., 1999; Hartsough and Mulder, 1995; Yu et al., 2002). However, the in vivo mechanism for this Smad4-independent TGF-β/BMP signaling pathway and the role of Smad4 in craniofacial development still remain unclear.

In this study, we inactivated the Smad4 gene in both dental and palatal epithelium and show that Smad4 is required for the proper patterning of dental cusps. However, ablation of Smad4 in dental and palatal epithelium does not block early tooth development or palatal fusion. The p38 MAPK is activated by TGF-β and can function as a complementary effector to mediate Smad4-independent TGF-β signaling during tooth and palate development.

RESULTS

Cre-mediated inactivation of Smad4 in the dental epithelium causes dental cusp patterning defects

Loss of Smad4 leads to early embryonic mortality by E7. To bypass this early embryonic lethality and study the role of Smad4 during tooth development, we crossed a Smad4 conditional allele (Yang et al., 2002) with K14-Cre transgenic mice (Andl et al., 2004) to generate K14-Cre;Smad4fl/fl mutant embryos. At birth, we recovered K14-Cre;Smad4fl/fl pups at the expected Mendelian frequency. The K14-Cre;Smad4fl/fl mice died soon after birth and lacked milk in their stomachs.

The K14-Cre transgene directed Cre activity in the dental epithelium in K14-Cre;R26R samples (Fig. 1A–G). At E12.5, the lamina stage of tooth development, Cre recombinase is robustly expressed in every cell in the dental epithelium, as demonstrated by lac-Z staining (Fig. 1A). This expression pattern of Cre recombinase was consistent throughout all stages of tooth development until birth. Examination of serial sections from E12.5 to newborn mice did not reveal any β-galactosidase-positive cells in the dental mesenchyme (Fig. 1A–G and data not shown), suggesting that this K14-Cre line can effectively and precisely mediate gene inactivation in the dental epithelium. The successful inactivation of Smad4 was confirmed by immunohistochemical staining using an antibody to Smad4. We found that the dental epithelial cells in K14-Cre;Smad4fl/fl tooth germ were negative for Smad4 (Fig. 1H,I).

Figure 1. Severe tooth defects in K14-Cre;Smad4fl/fl mice.

Figure 1

Open in a new tab

A−G, X-gal staining of K14-Cre;R26 mice. A, E12.5, lamina stage. B, E13.5, bud stage. C, E14.5, cap stage. D, E15.5. E, E16.5, bell stage. F, E17.5. G, newborn. H,I, Smad4 (red staining) in the control (H) and K14-Cre;Smad4fl/fl (I) tooth germs. J,K, HE staining of molar tooth germs from control (J) and K14-Cre;Smad4fl/fl (K) newborn mice. Arrow indicates the disorganized cell mass located in the dental epithelium. L–N, BrdU assay in E17.5 control (L) and K14-Cre;Smad4fl/fl (M) tooth germs. BrdU labeling index (N) of control and mutant tooth germ. DM: dental mesenchyme; DE: dental epithelia. Error bar indicates 95% confidence intervals. * P < 0.05. O–R, Tooth germs from control samples (O, P) and K14-Cre;Smad4fl/fl (Q, R) mice cultured under kidney capsule for 14 days. P and R are enlarged from dotted boxes in O and Q, respectively. Arrows in P, R indicate ameloblast cells. D: dentin; E: enamel. Scale bar: 200µm. S–V, Tooth germs from control (S, T) and K14-Cre;Smad4fl/fl (U, V) mice cultured 28 days under kidney capsule, buccal (S, U) and occlusal (T,V) views. Arrow in S indicates the root. Scale bar: 1mm.

Surprisingly, tooth development progressed beyond the cap stage without obvious defects in K14-Cre;Smad4fl/fl mice. In contrast, tooth development arrested at the early bud stage in Bmpr1a-deficient mice (Andl et al., 2004; Liu et al., 2005). At the newborn stage, the dental epithelium of K14-Cre;Smad4fl/fl mice exhibited severe defects: the differentiation of the inner enamel epithelium was delayed, no clear dental cusps were present, and there was a disorganized cell mass located in the dental epithelium (Fig. 1J,K). We hypothesized that altered dental epithelial cell proliferation or apoptosis activity might have contributed to the disorganization of dental cusp patterning. BrdU incorporation analysis indicated that the Smad4 mice exhibited a significant increase (p<0.05) in cell proliferation in the dental epithelium (Fig. 1L,M,N). Because the Smad4 mice could not survive after birth, we cultured the tooth germs by using kidney capsule grafting in order to investigate the biological function of Smad4 signaling in regulating postnatal tooth development. After 2 weeks culture, some mutant dental epithelial cells differentiated into ameloblasts and formed enamel matrix, which suggests that Smad4 is dispensable for ameloblast differentiation (Fig. 1Q,R). However, the Smad4 mutant tooth germ showed severe defects in the patterning of the dental cusps (Fig. 1Q,R), comparing with the control samples (Fig. 1O,P). After 4 weeks culture, control tooth germ developed into a well-formed tooth (Fig. 1S,T). In contrast, Smad4 mutant tooth germ failed to form dental cusps (Fig. 1U,V); only a fragment of tooth-like structure can be identified.

Defective patterning of the dental epithelium in K14-Cre;Smad4fl/fl tooth germ

To investigate the patterning defects in the K14-Cre;Smad4fl/fl dental cusps, we performed gene marker analyses in control and K14-Cre;Smad4fl/fl molar tooth germs. Msx2 and Shh, downstream targets of BMP signaling, were down-regulated in K14-Cre;Smad4fl/fl tooth germs. In the control tooth germ, Msx2 was expressed in both dental epithelium and mesenchyme (Fig. 2A,G). Msx2 expression was completely absent in the K14-Cre;Smad4fl/fl mutant dental epithelium, whereas the expression level in the dental mesenchyme remained comparable to the control tooth germ (Fig. 2B,H). Shh was expressed in the primary enamel knot during the cap stage in control tooth germs (Fig. 2C). As tooth development progressed, Shh expression extended into the entire inner enamel epithelium and stratum intermedium (Fig. 2I). In the K14-Cre;Smad4fl/fl mutant tooth germ, Shh expression was fairly comparable to control sample at E14.5 (Fig. 2D), but failed to extend in the later stage (Fig. 2J). Fgf4, which is specifically expressed in enamel knots, was not expressed in the K14-Cre;Smad4fl/fl tooth germs, indicating that enamel knot formation was deficient in Smad4 mutant tooth germ (Fig. 2E,K,F,L).

Figure 2. Dental cusp patterning gene expression analyses by in situ hybridization.

Figure 2

Open in a new tab

A,G, Msx2 is expressed in the dental epithelium (arrow) and dental mesenchyme (*) in control. B,H, Msx2 expression is undetectable in K14-Cre;Smad4fl/fl dental epithelium. C,D, Expression of Shh in control and K14-Cre;Smad4fl/fl tooth germs is comparable at E14.5. I,J, Shh expression is significantly reduced in K14-Cre;Smad4fl/fl tooth germ at E16.5. E,K, Fgf4 is expressed in both primary and secondary enamel knots in control tooth germ. F,L, Fgf4 is not detectable in the K14-Cre;Smad4fl/fl tooth germ. M,N, p21 is expressed in the primary enamel knot of both control and K14-Cre;Smad4fl/fl tooth germs (arrow). O–R, Mandibular organ culture with p38 inhibitor, SB203580. In the control sample, tooth germ successfully developed to the cap stage (O) after 3 days, and the primary enamel knot formed, as assayed by p21 expression (Q, arrow). The K14-Cre;Smad4fl/fl tooth germ is arrested at the bud stage and there is no p21 expression (P,R).

Smad4 and p38 MAPK function redundantly to regulate early tooth development

The development of tooth germs in K14-Cre;Smad4fl/fl mice were fairly comparable morphologically to that of control sample at E14.5. Moreover, we detected p21 expression in the enamel knot area (Fig. 2M,N). Previous studies have indicated that the TGF-β superfamily can activate Smad4-independent signaling cascades, such as MAPK pathways (Derynck and Zhang, 2003; Yu et al., 2002). Although there are three subgroups of the MAPK superfamily (JNK, p38, Erk MAPK), p38 MAPK is the only one that has been implicated in TGF-β superfamily signal transduction in Drosophila wing morphogenesis to date (Adachi-Yamada et al., 1999). We hypothesized that a similar signaling scenario might be operative in regulating mammalian organogenesis. To test whether p38 MAPK can mediate Smad4-independent BMP signaling in tooth development, we blocked p38 activity using the imidazole compound SB203580, a p38 MAPK specific inhibitor, in our mandibular organ culture model. Control tooth germ from E12.5 embryos developed from the bud to the cap stage as validated by positive p21 expression after 3 days culture in the presence of the p38 MAPK inhibitor (n=20) (Fig. 2O,P). In contrast, the development of K14-Cre;Smad4fl/fl tooth germ was arrested at the bud stage following the addition of SB203580, as judged by the lack of p21 expression in the enamel epithelium (Fig. 2Q,R). The same effect was seen in all twelve K14-Cre;Smad4fl/fl mandible explants. To rule out the arrested tooth phenotype in K14-Cre;Smad4fl/fl tooth germ was due to delayed development, we also extended the culture time to 5 days, and the K14-Cre;Smad4fl/fl tooth germ treated with SB203580 was still arrested at the bud stage (data not shown).

Smad4 is dispensable for the palatal fusion in the epithelium

Loss of Tgfb3 or tissue-specific inactivation of Tgfbr2 or Tgfbr1 in the palatal epithelium results in cleft palate with complete phenotype penetrance (Xu et al., 2006; Dudas et al., 2006; Kaartinen et al., 1995). Interestingly, however, palatal epithelial tissue specific inactivation of Smad4 did not adversely affect palatal fusion. At birth, the palate formed normally in K14-Cre;Smad4fl/fl mutant mice (Fig. S1A,B). Histological analysis revealed confluent palatal mesenchyme without any residue of epithelial cells at the midline in both control and K14-Cre;Smad4fl/fl mice (Fig. S1C,D). Moreover, we confirmed that we had specifically and completely eliminated Smad4 from the palatal epithelium prior to palatal fusion as judged by immunohistochemical analysis (Fig. S1E,F). These data strongly suggest that a Smad4-independent pathway is also involved in regulating palatogenesis.

Smad4 and p38 MAPK function redundantly to regulate TGF-β induced palatal fusion

Prior to palatal fusion, p38 MAPK was mainly expressed in palatal epithelial cells while there was only sporadic expression in the palatal mesenchyme (Fig. 3A,B). When we blocked TGF-β signaling in K14-Cre;Tgfbr2fl/fl mice, p38 MAPK expression was not affected in the developing palate, implying that the expression of p38 MAPK is not dependent upon TGF-β signaling (Fig. 3C,D). Significantly, p38 MAPK was activated in the palatal epithelium prior to palatal fusion as indicated by anti-phospho-p38 MAPK staining (Fig. 3E,F). In the absence of TGF-β signaling, however, we failed to detect the activation of p38 MAPK in the palatal epithelium of K14-Cre;Tgfbr2fl/fl mice (Fig. 3G,H), suggesting that TGF-β signaling is required for the activation of p38 MAPK activity in the palatal epithelium.

Figure 3. TGF-β is required for the activation of p38 MAPK in the palatal epithelium.

Figure 3

Open in a new tab

By immunohistochemistry, p38 MAPK is detected in both control (A, B) and K14-Cre;Tgfbr2fl/fl mutant (C, D) palatal epithelium. Phospho-p38 MAPK can only be detected in the control (E, F) palatal epithelium, but not in the K14-Cre;Tgfbr2fl/fl mutant (G, H) palatal epithelium. Arrows indicate positive signals in the palatal epithelium. Open arrows in G and H indicate epithelial cells that were negative for phospho-p38 MAPK. Red broken line indicates the persistent MEE cells.

To test whether p38 MAPK is required as a Smad4-independent TGF-β signaling effector during palatal fusion, we conducted experiments using the palatal organ culture model with either siRNA or SB203580 to inactivate p38 MAPK activity. Our control experiment showed that siRNA can effectively enter the palatal epithelium prior to fusion (Fig. 4G) and siRNA treatment alone will not interfere palatal fusion process in vitro (Fig. S2). The treatment of palatal explants with p38 MAPK siRNA significantly reduced the expression level of p38 MAPK in the palatal explants (Fig. 4H,I). Blocking p38 MAPK activity in control samples with the addition of siRNA did not affect palatal fusion (n=13) (Fig. 4A,D). In contrast, inactivation of p38 MAPK in K14-Cre;Smad4fl/fl samples resulted in the failure of palatal fusion and the persistence of midline epithelial cells (n=7) (Fig. 4B,E), a phenotype identical to the palatal fusion failure seen in K14-Cre;Tgfbr2fl/fl samples (Fig. 4C,F).

Figure 4. Smad4 and p38 MAPK are functionally redundant in mediating TGF-β signaling during palatal fusion.

Figure 4

Open in a new tab

Haematoxylin & Eosin staining shows A,D, Control palatal shelves treated with p38 MAPK siRNA are fused after 3 days culture. Boxed area in A is enlarged shown as D. B,E, K14-Cre;Smad4fl/fl mutant palatal shelves treated with p38 MAPK siRNA show persistence of MEE cells in the palate after 3 days culture. C,F, Palatal culture (without inhibitor in the medium) of K14-Cre;Tgfbr2fl/fl shows the persistence of MEE cells. G, Fluorescent detection of control siRNA in palatal epithelium (GFP). H, Western blot analysis shows p38 MAPK is knocked-down by siRNA in palatal culture system (Lane 1–3, protein extracted from siRNA treated samples (experiments were repeated 3 times). Epi, palatal epithelium; mes, palatal mesenchyme; and palate, whole palate. I, p38 MAPK expression level is significantly knocked-down by siRNA treatment (* P <0.01). The values were expressed relative to that of control. J,M, After 3 days culture with SB203580, control E13.5 palatal shelves fused, K,N,L,O, K14-Cre;Smad4fl/fl mutant palatal shelves show the persistence of MEE cells (arrow) after 3 days culture with SB203580. LacZ staining (L,O). P,S, Exogenous TGFβ-3 can rescue Smad4fl/+;Tgfb3−/− palatal fusion in medium containing SB203580. Q,T, Exogenous TGFβ-3 fails to rescue K14-Cre;Smad4fl/fl;Tgfb3−/− palatal fusion in medium containing SB203580. R,U, Exogenous TGFµ-3 can rescue K14-Cre;Smad4fl/fl;Tgfb3−/− palatal fusion. V–Z, In situ hybridization of p21 in palatal shelves of control (V), K14-Cre;Tgfbr2fl/fl (W) and K14-Cre;Smad4fl/fl mice, untreated (X) or cultured with SB203580; Y, control sample; Z, K14-Cre;Smad4fl/fl sample. Dark blue indicates p21 expression. Arrow, MEE cells.

In parallel, inactivation of p38 MAPK in control samples with the addition of SB203580 did not affect palatal fusion in vitro (n=14) (Fig. 4J,M). When we added SB203580 to K14-Cre;Smad4fl/fl samples in culture, palatal fusion was retarded and midline epithelial cells persisted (n=18) (Fig. 4K,N,L,O). This phenotype is indistinguishable from that of the K14-Cre;Tgfbr2fl/fl mutant sample (Fig. 4C,F). To further clarify whether p38 MAPK functions downstream of TGF-β signaling, we cultured Tgfβ3−/−;K14-Cre;Smad4fl/fl compound mutant palatal shelves. Exogenous TGF-β3 is still able to rescue the palatal fusion in this compound mutant samples (n=2) (Fig. 4R,U), implying that TGF-β signaling can still be transmitted successfully in the absence of Smad4. However, in the presence of SB203580, exogenous TGF-β3 failed to rescue palatal fusion in Tgfβ3−/−;K14-Cre;Smad4fl/fl samples (n=3) (Fig. 4Q,T). On the other hand, inhibition of p38 MAPK did not prevent exogenous TGF-β3 from restoring palatal fusion in Tgfβ3−/− mutant palatal shelves (n=5) (Fig. 4P,S).

Apoptosis is a major fate of palatal shelf midline epithelial cells in which p21 is expressed prior to palatal fusion (Fig. 4V). In K14-Cre;Tgfbr2fl/fl mice, we detected diminished apoptosis in the epithelium prior to fusion and persistence of the epithelial seam but failed to detect p21 expression (Fig. 4W). This data suggests that TGF-β signaling is required for p21 expression in order to induce apoptosis in epithelial cells. Interestingly, neither tissue-specific inactivation of Smad4 in the palatal epithelium nor blocking p38 MAPK by SB203580 affects p21 expression (Fig. 4X,Y). We were only able to prevent p21 expression when we blocked p38 MAPK activity in the K14-Cre;Smad4fl/fl sample (n=8), a combination which led to the persistence of midline epithelium (Fig. 4Z). These data demonstrate that Smad4-dependent and –independent pathways are critical and functionally redundant in mediating TGF-β induced p21 expression and apoptotic activity in palatal epithelial cells prior to palatal fusion.

DISCUSSION

Smad4 is crucial for dental epithelium patterning. Disrupting the BMP signaling pathway by eliminating Smad4 in the dental epithelium results in down-regulation of Msx2 and Shh, which are downstream targets of BMP signaling and essential for the patterning of dental cusps (Bei et al., 2004; Dassule et al., 2000). However, eliminating Smad4 alone is not sufficient to block the BMP signaling in the dental epithelium during early tooth development, since it does not recapitulate the Bmpr1a inactivation mutation phenotype. In this study, we show that p38 MAPK functions redundantly with Smad4 to mediate BMP signaling during tooth development, and tooth development can only be arrested at the bud stage by blocking both Smad4 and p38 MAPK. This functional redundancy is in sharp contrast to the result of loss of Smad4 in the cranial neural crest (CNC)-derived dental mesenchyme, in which tooth development is retarded at the dental laminar stage (prior to the bud stage). Thus, there is an absolute requirement for Smad4 in the CNC-derived dental mesenchyme. In addition, Smad4-mediated TGF-β/BMP signaling is required for the homeobox gene patterning of oral/aboral and proximal/distal domains within the first branchial arch (Ko et al., 2007). Therefore, in the CNC-derived mesenchyme, TGF-β/BMP signals rely on Smad4-dependent pathways to mediate epithelial-mesenchymal interactions that control craniofacial organogenesis. Previous studies have shown that BMP4 signaling is critical for mediating cell death in the enamel knot, whereas Msx1-mediated BMP signaling is critical for cell proliferation in the dental mesenchyme (Chai and Maxson, 2006; Thesleff and Sharpe, 1997). Taken together, the temporal and tissue-specific activation of Smad4-dependent or –independent BMP signaling pathway may regulate different downstream target genes and contribute to the diverse functional outcomes of BMP signaling in regulating the fate of dental epithelial and CNC-derived mesenchymal cells during tooth development.

p21, a cyclin-dependent kinase inhibitor that inhibits cell proliferation at the G1/S transition, is a well-documented downstream target gene for TGF-β /BMP signaling (Hu et al., 1999). It is considered a differentiation marker for the cells of the primary enamel knot during tooth development (Jernvall et al., 1998). It is also expressed exclusively in the MEE cells within the palatal shelf during palatogenesis. Our study shows that inactivation of Tgfbr2 in the MEE cells leads to down-regulation of p21 and failure of palatal fusion. These results further confirm that p21 works downstream of TGF-β signaling during palatogenesis. However, in the absence of Smad4, the expression of p21 is unchanged and palatal shelves can fuse without any obvious defects. After blocking p38 MAPK, p21 expression is reduced and palatal fusion is compromised in the K14-Cre;Smad4fl/fl mice. Clearly, p21 expression and palatal fusion are controlled by two parallel signals: Smad4 and p38 MAPK. The results of culture experiments with Tgfβ3−/−;K14-Cre;Smad4fl/fl compound mutant palatal shelves suggest that p38 MAPK is activated by TGF-β and is required specifically for transducing TGF-β signaling. Equally important, our study shows that p38 MAPK is specifically expressed in the palatal epithelium. TGF-β signaling is required for the activation of p38 MAPK, whereas it is not required for p38 expression. We have provided multiple lines of evidence that only simultaneous inactivation of Smad4 and p38 MAPK can completely block the TGF-β signaling in the palatal epithelium. Thus, we conclude that Smad4-dependent and –independent pathways are critical and functionally redundant in mediating TGF-β induced p21 activity in palatal epithelial cells.

The discovery of Smad4-dependent and –independent TGF-β/BMP signaling in the regulation of tooth and palate development has broad implications. The functional redundancy of Smad4-dependent and –independent TGF-β/BMP signaling may be used as a general mechanism in regulating organogenesis and parallels recent findings regarding the mechanism of TGF-β signaling in cancer cell development. For example, Smad4-dependent and -independent TGF-β signaling plays an important role in the fate determination of mouse mammary gland epithelial cells and other tumor cells (Derynck and Zhang, 2003; Yu et al., 2002). Studies using overexpression of dominant negative components of the Rho pathways or pharmacologic inhibitors of p38MAPK suggest that TGF-β signaling can be mediated through Smad4-independent pathway to control the fate of tumor cells in the proinvasive and metastatic states (Bhowmick et al., 2001; Dumont and Arteaga, 2003; Tian et al., 2004). Collectively, these studies highlight the ability of the ectoderm to use Smad4 and p38 MAPK as redundant effectors for TGF-β/BMP signaling and underscore the involvement of a diversified Smad4-dependent and -independent TGF-β signaling network in regulating development and disease.

Experimental Procedures

Generation and analysis of transgenic mice

Male mice carrying the K14-Cre allele (Andl et al., 2004) were crossed with females carrying the R26R conditional reporter allele (Soriano, 1999) to generate K14-Cre;R26R embryos. K14-Cre mice were also crossed with Smad4fl/fl females (Yang et al., 2002) to generate K14-Cre;Smad4fl/+ mice. The male K14-Cre;Smad4fl/+ mice were mated with Smad4fl/fl female mice to generate K14-Cre;Smad4fl/fl null alleles. K14-Cre;Tgfbr2fl/fl mice were generated as previously described (Xu et al., 2006). The male K14-Cre;Smad4fl/+ mice were also mated with Tgfb3+/− female mice (Proetzel et al., 1995) to generate Tgfb3+/−;K14-Cre;Smad4fl/+ mice and Tgfb3+/−;Smad4fl/+ mice. Tgfb3−/−;K14-Cre;Smad4fl/fl embryos were produced by crossing Tgfb3+/−;K14-Cre;Smad4fl/+ and Tgfb3+/−;Smad4fl/+ mice. Detection of β-galactosidase activity in tissue sections, cell proliferation, immunohistochemistry and histological analyses were carried out as previously described (Chai et al., 2000; Xu et al., 2006). The specific anti-Smad4 antibody was purchased from Santa Cruz (cat#: sc-7966), anti-p38 MAPK and anti-phospho-p38 MAPK antibodies were purchased from Cell Signaling (cat#: 9212 and 4631, respectively).

Organ cultures and kidney capsule grafting

Timed-pregnant mice were sacrificed on postcoital day 11.5 (for mandible culture) or 13.5 (for palatal culture). Genotyping was carried out as previously described. The mandibles or palatal shelves were microdissected and cultured in serumless, chemically-defined medium. SB203580 (Sigma) was added into the medium for the experimental groups at the final concentration of 15µM. For TGF-β3, the final concentration was 10ng/ml (R&D systems). Tissues were harvested after 3 days of culture for further processing. Kidney capsule grafting was carried out as previously described (Xu et al., 2005).

siRNA transfection in palatal culture system

E13.5 palatal shelves were cultured in serum and antibiotic free medium for 4 hours as previously described. Replace the medium with siRNA-containing medium. siRNA-containing medium was prepared by following procedures (modified from manufacture’s protocol): Add 200µl of serum-free medium to a clean, sterile microfuge tube; then add 4µl Transfection Reagent (TransIt-TKO, Mirus) to the tube and mix by pipetting up and down, incubate at room temperature for 5 minutes. Add 12µl stock p38 MAPK siRNA (Cell signaling, cat#:6386 or 6385 for kit) to the microfuge tube, and mix by pipetting up and down gently. Incubate for 5 minutes at room temperature. Add 1000µl serum-free medium to yield a final concentration of 100nM. Cultured palatal tissues were harvested after 48 hours for Western blot or real-time PCR procedures, or collected after 72 hours for histological analyses.

Quantitative PCR analysis

Total RNA from the cultured palatal shelves were extracted using RNeasy mini kit and treated with RNase-free DNase I (Qiagen) following the manufacturer’s protocol. The Superscript III with an oligo(dT)20 primer (Invitrogen) was used for the first-strand synthesis. We carried out real-time RT-PCR on the iCycler (Bio-Rad) with gene-specific primers and using SYBR Green. All reactions were under the following cycling protocol: 3 min heat start at 95 °C and 40 cycles of denaturation at 95 °C for 1 min, annealing and extension at 60 °C for 1 min. We normalized relative expression ratios to β-actin. Primer sequences for p38 MAPK (TGACCCTTATGACCAGTCCTTT and GTCAGGCTCTTCCACTCATCTAT) were obtained from Primer Bank: (http://pga.mgh.harvard.edu/primerbank/index.html).

Western analysis

Palatal shelves explants were collected after 48 hours culture with p38MAPK siRNA. Palatal shelves were also collected from E13.5 embryos. Ten pairs of palatal shelves from E13.5 embryos were treated with Dispase I (Roch Diagnostics cat#: 04942086) on ice with final concentration of 2U/ml for 1 hour, then palatal epithelium were separated from mesenchyme and pooled together for protein extraction. Protein samples were loaded in each well of a 12% polyacrylamide gel. Electrophoresis was carried out in a modular mini- Protean II electrophoresis system (Bio-Rad, Hercules, CA). Protein was then transferred to a Millipore Immobilon-P membrane by using a Bio-Rad mini-trans-blot electrophoretic transfer cell. Equal transfer efficiency was confirmed by Coomassie blue staining. Anti-p38MAPK antibody was purchased from Cell Signaling (cat#: 9212). Bovine serum albumin was used as a negative control and was not recognized by any of the antibodies tested.

In Situ Hybridization

In situ hybridizations were performed by following standard procedures. Digoxigenin labeled antisense probes were generated from mouse cDNA clones that were kindly provided by several laboratories: Fgf4 (Y. Chen), Msx2 (R. Maxson), p21 (I. Thesleff), Shh (A. McMahon).

Supplementary Material

01

Supplemental Data 1 (S1). K14-Cre;Smad4fl/fl mice do not have palate defects. A,B, Macroscopic views of control (A) and K14-Cre;Smad4fl/fl (B) palates at the newborn. C,D, Frontal sections of control (C) and K14-Cre;Smad4fl/fl (D) palates are indistinguishable. E,F, Smad4 is expressed at E14 in the control palatal epithelium (E, arrow), but not in the K14-Cre;Smad4fl/fl palatal epithelium (F).

Supplemental Data 2 (S2). siRNA treatment alone does not interfere with palatal fusion. A, B, Wild-type embryonic day 13.5 palatal shelves were cultured with control siRNA treatment for three days. Boxed area in A is enlarged and shown as B.

Acknowledgements

We thank Dr. Sarah Millar for K14-Cre mice and thank Drs.Yiping Chen, Robert Maxson, Irma Thesleff and Andrew McMahon for plasmids. We also thank Dr. Julie Mayo for critical reading of the manuscript. This study was supported by grants from the NIDCR, NIH (DE012711 and DE014078) to Yang Chai.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Reference

  1. Adachi-Yamada T, Nakamura M, Irie K, Tomoyasu Y, Sano Y, Mori E, Goto S, Ueno N, Nishida Y, Matsumoto K. p38 mitogen-activated protein kinase can be involved in transforming growth factor beta superfamily signal transduction in Drosophila wing morphogenesis. Mol Cell Biol. 1999;19:2322–2329. doi: 10.1128/mcb.19.3.2322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Andl T, Ahn K, Kairo A, Chu EY, Wine-Lee L, Reddy ST, Croft NJ, Cebra-Thomas JA, Metzger D, Chambon P, et al. Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development. 2004;131:2257–2268. doi: 10.1242/dev.01125. [DOI] [PubMed] [Google Scholar]
  3. Bei M, Stowell S, Maas R. Msx2 controls ameloblast terminal differentiation. Dev Dyn. 2004;231:758–765. doi: 10.1002/dvdy.20182. [DOI] [PubMed] [Google Scholar]
  4. Bhowmick NA, Ghiassi M, Bakin A, Aakre M, Lundquist CA, Engel ME, Arteaga CL, Moses HL. Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism. Mol Biol Cell. 2001;12:27–36. doi: 10.1091/mbc.12.1.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brunet CL, Sharpe PM, Ferguson MW. Inhibition of TGF-beta 3 (but not TGF-beta 1 or TGF-beta 2) activity prevents normal mouse embryonic palate fusion. Int J Dev Biol. 1995;39:345–355. [PubMed] [Google Scholar]
  6. Chai Y, Jiang X, Ito Y, Bringas P, Jr, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development. 2000;127:1671–1679. doi: 10.1242/dev.127.8.1671. [DOI] [PubMed] [Google Scholar]
  7. Chai Y, Maxson RE., Jr Recent advances in craniofacial morphogenesis. Dev Dyn. 2006;235:2353–2375. doi: 10.1002/dvdy.20833. [DOI] [PubMed] [Google Scholar]
  8. Cui XM, Warburton D, Zhao J, Crowe DL, Shuler CF. Immunohistochemical localization of TGF-beta type II receptor and TGF-beta3 during palatogenesis in vivo and in vitro. Int J Dev Biol. 1998;42:817–820. [PubMed] [Google Scholar]
  9. Dassule H, Lewis P, Bei M, Maas R, McMahon A. Sonic hedgehog regulates growth and morphogenesis of the tooth. Development. 2000;127:4775–4785. doi: 10.1242/dev.127.22.4775. [DOI] [PubMed] [Google Scholar]
  10. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-[beta] family signalling. Nature. 2003;425:577–584. doi: 10.1038/nature02006. [DOI] [PubMed] [Google Scholar]
  11. Dudas M, Kim J, Li WY, Nagy A, Larsson J, Karlsson S, Chai Y, Kaartinen V. Epithelial and ectomesenchymal role of the type I TGF-beta receptor ALK5 during facial morphogenesis and palatal fusion. Dev Biol. 2006;296:298–314. doi: 10.1016/j.ydbio.2006.05.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dumont N, Arteaga CL. Targeting the TGF beta signaling network in human neoplasia. Cancer Cell. 2003;3:531–536. doi: 10.1016/s1535-6108(03)00135-1. [DOI] [PubMed] [Google Scholar]
  13. Fitzpatrick DR, Denhez F, Kondaiah P, Akhurst RJ. Differential expression of TGF beta isoforms in murine palatogenesis. Development. 1990;109:585–595. doi: 10.1242/dev.109.3.585. [DOI] [PubMed] [Google Scholar]
  14. Hartsough MT, Mulder KM. Transforming growth factor beta activation of p44mapk in proliferating cultures of epithelial cells. J Biol Chem. 1995;270:7117–7124. doi: 10.1074/jbc.270.13.7117. [DOI] [PubMed] [Google Scholar]
  15. Hu PP, Shen X, Huang D, Liu Y, Counter C, Wang XF. The MEK pathway is required for a stimulation of p21 (WAF1/CIP1) by transforming growth factor-beta. J. Biol. Chem. 1999;274:35381–35387. doi: 10.1074/jbc.274.50.35381. [DOI] [PubMed] [Google Scholar]
  16. Ito Y, Yeo JY, Chytil A, Han J, Bringas P, Jr, Nakajima A, Shuler CF, Moses HL, Chai Y. Conditional inactivation of Tgfbr2 in cranial neural crest causes cleft palate and calvaria defects. Development. 2003;130:5269–5280. doi: 10.1242/dev.00708. [DOI] [PubMed] [Google Scholar]
  17. Jernvall J, Aberg T, Kettunen P, Keranen S, Thesleff I. The life history of an embryonic signaling center: BMP-4 induces p21 and is associated with apoptosis in the mouse tooth enamel knot. Development. 1998;125:161–169. doi: 10.1242/dev.125.2.161. [DOI] [PubMed] [Google Scholar]
  18. Kaartinen V, Voncken JW, Shuler C, Warburton D, Bu D, Heisterkamp N, Groffen J. Abnormal lung development and cleft palate in mice lacking TGF-beta 3 indicates defects of epithelial-mesenchymal interaction. Nat Genet. 1995;11:415–421. doi: 10.1038/ng1295-415. [DOI] [PubMed] [Google Scholar]
  19. Ko S, Chung I, Xu X, Oka S, Zhao H, Cho E, Deng CX, Chai Y. Smad4 is required to regulate the fate of cranial neural crest cells. Dev. Biol. 2007;312:435–447. doi: 10.1016/j.ydbio.2007.09.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Liu W, Sun X, Braut A, Mishina Y, Behringer RR, Mina M, Martin JF. Distinct functions for Bmp signaling in lip and palate fusion in mice. Development. 2005;132:1453–1461. doi: 10.1242/dev.01676. [DOI] [PubMed] [Google Scholar]
  21. Martinez-Alvarez C, Tudela C, Perez-Miguelsanz J, O'Kane S, Puerta J, Ferguson MW. Medial edge epithelial cell fate during palatal fusion. Dev Biol. 2000;220:343–357. doi: 10.1006/dbio.2000.9644. [DOI] [PubMed] [Google Scholar]
  22. Massague J. TGF-beta signal transduction. Annual Review of Biochemistry. 1998;67:753–791. doi: 10.1146/annurev.biochem.67.1.753. [DOI] [PubMed] [Google Scholar]
  23. Pelton RW, Hogan BL, Miller DA, Moses HL. Differential expression of genes encoding TGFs beta 1, beta 2, and beta 3 during murine palate formation. Dev Biol. 1990;141:456–460. doi: 10.1016/0012-1606(90)90401-4. [DOI] [PubMed] [Google Scholar]
  24. Proetzel G, Pawlowski SA, Wiles MV, Yin M, Boivin GP, Howles PN, Ding J, Ferguson MW, Doetschman T. Transforming growth factor-beta 3 is required for secondary palate fusion. Nat Genet. 1995;11:409–414. doi: 10.1038/ng1295-409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nature Genetics. 1999;21:70–71. doi: 10.1038/5007. [DOI] [PubMed] [Google Scholar]
  26. Taya Y, O'Kane S, Ferguson MW. Pathogenesis of cleft palate in TGF-beta3 knockout mice. Development. 1999;126:3869–3879. doi: 10.1242/dev.126.17.3869. [DOI] [PubMed] [Google Scholar]
  27. Thesleff I, Sharpe P. Signalling networks regulating dental development. Mech Dev. 1997;67:111–123. doi: 10.1016/s0925-4773(97)00115-9. [DOI] [PubMed] [Google Scholar]
  28. Tian F, Byfield SD, Parks WT, Stuelten CH, Nemani D, Zhang YE, Roberts AB. Smad-binding defective mutant of transforming growth factor beta type I receptor enhances tumorigenesis but suppresses metastasis of breast cancer cell lines. Cancer Res. 2004;64:4523–4530. doi: 10.1158/0008-5472.CAN-04-0030. [DOI] [PubMed] [Google Scholar]
  29. Xu X, Bringas P, Jr, Soriano P, Chai Y. PDGFR-alpha signaling is critical for tooth cusp and palate morphogenesis. Dev Dyn. 2005;232:75–84. doi: 10.1002/dvdy.20197. [DOI] [PubMed] [Google Scholar]
  30. Xu X, Han J, Ito Y, Bringas P, Jr, Urata MM, Chai Y. Cell autonomous requirement for Tgfbr2 in the disappearance of medial edge epithelium during palatal fusion. Dev Biol. 2006;297:238–248. doi: 10.1016/j.ydbio.2006.05.014. [DOI] [PubMed] [Google Scholar]
  31. Yang X, Li C, Herrera PL, Deng CX. Generation of Smad4/Dpc4 conditional knockout mice. Genesis. 2002;32:80–81. doi: 10.1002/gene.10029. [DOI] [PubMed] [Google Scholar]
  32. Yu L, Hebert MC, Zhang YE. TGF-beta receptor-activated p38 MAP kinase mediates Smad-independent TGF-beta responses. Embo J. 2002;21:3749–3759. doi: 10.1093/emboj/cdf366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Zhao X, Zhang Z, Song Y, Zhang X, Zhang Y, Hu Y, Fromm SH, Chen Y. Transgenically ectopic expression of Bmp4 to the Msx1 mutant dental mesenchyme restores downstream gene expression but represses Shh and Bmp2 in the enamel knot of wild type tooth germ. Mech Dev. 2000;99:29–38. doi: 10.1016/s0925-4773(00)00467-6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Supplemental Data 1 (S1). K14-Cre;Smad4fl/fl mice do not have palate defects. A,B, Macroscopic views of control (A) and K14-Cre;Smad4fl/fl (B) palates at the newborn. C,D, Frontal sections of control (C) and K14-Cre;Smad4fl/fl (D) palates are indistinguishable. E,F, Smad4 is expressed at E14 in the control palatal epithelium (E, arrow), but not in the K14-Cre;Smad4fl/fl palatal epithelium (F).

Supplemental Data 2 (S2). siRNA treatment alone does not interfere with palatal fusion. A, B, Wild-type embryonic day 13.5 palatal shelves were cultured with control siRNA treatment for three days. Boxed area in A is enlarged and shown as B.

NIHMS66185-supplement-01.pdf (112.6KB, pdf)

RESOURCES