Skip to main content
PMC home page
BMC Microbiology logoLink to BMC Microbiology
. 2008 Dec 3;8:211. doi: 10.1186/1471-2180-8-211

Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression

Marie-Laure Rosso 1,6, Sylvie Chauvaux 2, Rodrigue Dessein 1, Caroline Laurans 1,7, Lionel Frangeul 3, Céline Lacroix 4, Angèle Schiavo 4, Marie-Agnès Dillies 4, Jeannine Foulon 2, Jean-Yves Coppée 4, Claudine Médigue 5, Elisabeth Carniel 2, Michel Simonet 1, Michaël Marceau 1,✉
PMCID: PMC2631605  PMID: 19055764

Abstract

Background

In man, infection by the Gram-negative enteropathogen Yersinia pseudotuberculosis is usually limited to the terminal ileum. However, in immunocompromised patients, the microorganism may disseminate from the digestive tract and thus cause a systemic infection with septicemia.

Results

To gain insight into the metabolic pathways and virulence factors expressed by the bacterium at the blood stage of pseudotuberculosis, we compared the overall gene transcription patterns (the transcriptome) of bacterial cells cultured in either human plasma or Luria-Bertani medium. The most marked plasma-triggered metabolic consequence in Y. pseudotuberculosis was the switch to high glucose consumption, which is reminiscent of the acetogenic pathway (known as "glucose overflow") in Escherichia coli. However, upregulation of the glyoxylate shunt enzymes suggests that (in contrast to E. coli) acetate may be further metabolized in Y. pseudotuberculosis. Our data also indicate that the bloodstream environment can regulate major virulence genes (positively or negatively); the yadA adhesin gene and most of the transcriptional units of the pYV-encoded type III secretion apparatus were found to be upregulated, whereas transcription of the pH6 antigen locus was strongly repressed.

Conclusion

Our results suggest that plasma growth of Y. pseudotuberculosis is responsible for major transcriptional regulatory events and prompts key metabolic reorientations within the bacterium, which may in turn have an impact on virulence.

Background

The Gram-negative bacterium Y. pseudotuberculosis is a human enteropathogen which is able to cross the intestinal mucosa through the M cells in Peyer's patches and thus infect the underlying tissues (causing ileitis and mesenteric lymphadenitis). However, in elderly or debilitated individuals (those suffering from malignancies, immunodeficiencies, chronic liver diseases or diabetes mellitus, for example), the organism frequently gains access to the bloodstream and can cause an often fatal septicemia [1,2]. Known Y. pseudotuberculosis virulence genes are transcriptionally regulated by temperature – most probably in order to adapt to the bacterium's life cycle outside and inside the host. Regulation by the omnipresent thermal stimulus can be modulated (via a wide range of mechanisms) by signals such as pH, other ion concentrations and nutrient availability (reviewed in [3]). This allows bacterial pathogens to (i) adapt their gene transcription profiles in response to environmental cues sensed during the course of infection and (ii) express the most appropriate virulence factors at the expense of useless (or even detrimental) ones.

To date, the transcriptional gene regulation occurring when Y. pseudotuberculosis enters the human bloodstream has only been inferred indirectly from in vivo results in rodent models of infection [4,5] and in vitro gene transcription studies. The in vitro regulation of certain Yersinia virulence loci has mainly been analyzed with respect to single growth parameter changes mimicking the environmental signals known (or assumed) to be detected by bacteria in blood, such as iron scarcity, oxygen tension and pH [6,7]. In the present work, we have adopted an intermediate approach by comparing the overall gene expression profiles of Y. pseudotuberculosis grown in human plasma and in Luria-Bertani broth. We then compared the observed variations with those recently published for Y. pestis [8], an almost genetically identical pathogen which, however, causes plague – one of the most severe systemic infections in humans and other mammals.

Results and discussion

The genome of Y. pseudotuberculosis strain IP32953 has been recently deciphered: it contains 3,951 coding sequences (CDSs), of which 99 are borne by the virulence-associated plasmid pYV and 43 are carried by a 27-kb cryptic plasmid. Only around 49% of CDSs encode a product with a putative or proven function [9]. To gain insight into the transcriptional regulation of virulence and metabolism genes that takes place when Y. pseudotuberculosis enters and multiplies in the bloodstream, we compared the transcriptome of IP32953 grown in human plasma to the one of the same strain grown in Luria-Bertani (LB). To this end, we prepared macroarrays composed of 3,674 PCR fragments of ≈ 400-base pairs (bp), covering 96% of IP32953's CDSs and used them as described elsewhere [8] and in the Methods section. Briefly, in three independent cultures, total RNA was extracted from IP32953 cells grown in LB broth or human plasma, in the exponential or stationary phase and at 28°C or 37°C. Macroarray probing was performed three times with independently retrotranscribed and 33P-radiolabeled RNA samples from each of the eight growth combinations. After macroarray imaging, hybridization intensity data were log-transformed and normalized using a simple median normalization method. Relative data have been deposited in the Genoscript database http://genodb.pasteur.fr/cgi-bin/WebObjects/GenoScript in accordance with standards of the Microarray Gene Expression Data Society (MGED). An analysis of variance (ANOVA) was carried out independently for each gene, with the three biological factors of variation (medium, temperature and growth phase) as fixed effects. This statistical approach allowed us to evaluate the transcriptional variations induced by each factor for the dataset as a whole. Thus, three ratios (corresponding to each parameter) and associated p-values were calculated for each gene. Inter-condition transcriptional differences were considered to be statistically significant if the p-value was below 0.05. Representative macroarray hybridization results were confirmed by qRT-PCR on stored RNA samples, using the constitutively expressed YPTB0775 gene (spot ID YPO3356 and coding for the outer membrane lipoprotein NplD) as a reference (Additional file 1). Since the physiological status of the bacterium during host infection is unknown, we focused our analysis on genes regulated by the temperature and/or the medium in both the exponential and stationary phases. All Y. pseudotuberculosis transcriptional variations discussed herein were compared with those of their respective Y. pestis orthologs and are summarized in Table 1. Y. pseudotuberculosis IP32953 genes regulated at the transcriptional level by growth temperature and/or medium are listed in Tables 2 and 3.

Table 1.

Y. pseudotuberculosis transcriptional variations discussed in this article compared with those recently published for Y. pestis [8]

Locus tags gene transcription fold ratio human plasma/Luria Bertani broth (p-value)
Y. pseudotuberculosis Y. pestis Gene Name Putative product/function Y. pseudotuberculosis Y. pestis
Iron uptake and storage
YPTB1659 YPO1783 ftnA ferritin 0.180 (< 0.001) 0.341 (0.001)
YPTB0336 YPO0279 hmuV ABC hemin transporter, ATP-binding subunit HmuV 1.665 (0.003) 1.499 (0.021)
YPTB0338 YPO0281 hmuT ABC transporter, periplasmic hemin-binding protein HmuT 1.684 (0.016) 2.149 (0.001)
YPTB0339 YPO0282 hmuS possible hemin degradation/transport protein HmuS 1.577 (0.022) 1.984 (< 0.001)
YPTB0340 YPO0283 hmuR TonB-dependent outer membrane hemin receptor, HmuR 7.426 (< 0.001) 2.028 (< 0.001)
YPTB0739 YPO3392 fhuC putative ABC type hydroxymate-dependent iron transport ATP binding protein 1.932 (0.047) 1.500 (0.258)
YPTB0740 YPO3391 fhuD putative ABC type hydroxamate-dependent iron uptake ATP binding protein 1.836 (0.021) 1.174 (0.486)
YPTB1341 YPO1310 yiuA putative ABC type periplasmic iron siderophore/cobalamin binding protein 3.085 (< 0.001) 1.737 (0.027)
YPTB1343 YPO1312 yiuC putative siderophore/cobalamin ABC transporter, ATP-binding subunit 2.468 (< 0.001) 1.991 (0.012)
YPTB1512 YPO1496 putative heme-binding protein 2.456 (< 0.001) 0.921 (0.639)
YPTB1513 YPO1497 putative ABC transporter ATP-binding protein 1.877 (0.009) 1.408 (0.113)
YPTB1515 YPO1499 putative membrane protein 1.521 (0.045) 1.018 (0.921)
YPTB1540 YPO1528 ysuF putative ferric iron reductase 4.019 (< 0.001) 3.137 (< 0.001)
YPTB1541 YPO1529 ysuJ putative decarboxylase 2.092 (< 0.001) 1.246 (0.236)
YPTB1543 YPO1531 ysuH putative siderophore biosynthetic enzyme 1.896 (0.021) 1.213 (0.387)
YPTB1544 YPO1532 ysuG putative siderophore biosynthetic enzyme 2.403 (0.005) 1.830 (0.006)
YPTB1549 YPO1537 ysuR putative OMR family iron-siderophore receptor 2.610 (< 0.001) 3.273 (0.001)
YPTB2117 YPO2193 tonB TonB protein 5.464 (< 0.001) 2.563 (0.001)
YPTB2347 YPO2439 yfeA ABC transporter, periplasmic iron siderophore-binding protein YfeA 11.88 (< 0.001) 10.22 (< 0.001)
YPTB2348 YPO2440 yfeB ABC chelated iron transporter, ATP-binding subunit YfeB 3.141 (< 0.001) 2.772 (0.001)
YPTB2349 YPO2441 yfeC ABC chelated iron transporter, permease subunit YfeC 4.375 (< 0.001) 1.817 (0.017)
YPTB2350 YPO2442 yfeD ABC chelated iron transporter, permease subunit YfeD 2.103 (< 0.001) 1.369 (0.195)
YPTB2353 YPO2445 yfeE putative yfeABCD locus regulator 1.527 (0.008) 2.085 (0.001)
YPTB3263 YPO0989 iucA possible siderophore biosynthesis protein, IucA familly 3.789 (< 0.001) 2.059 (0.033)
YPTB3265 YPO0992 iucC putative siderophore biosynthesis protein IucC 2.600 (< 0.001) 0.920 (0.711)
YPTB3266 YPO0993 iucD putative siderophore biosynthesis protein IucD 2.151 (0.002) 0.631 (0.036)
YPTB3298 YPO1011 putative TonB-dependent O-M, iron siderophore receptor/tranporter 2.150 (0.005) 1.845 (0.018)
YPTB3383 YPO0682 exbB possible MotA/TolQ/ExbB proton channel family protein 4.165 (< 0.001) 3.021 (< 0.001)
YPTB3382 YPO0683 exbD pExbD/TolR-family transport protein 9.811 (< 0.001) 3.576 (< 0.001)
YPTB3701 YPO0205 bfd putative bacterioferritin-associated ferredoxin 1.857 (0.002) 3.195 (< 0.001)
YPTB3700 YPO0206 bfr bacterioferritin 1.153 (0.255) 4.483 (< 0.001)
YPTB3767 YPO0133 feoA conserved hypothetical protein 1.510 (0.046) 1.081 (0.648)
YPTB3769 YPO0131 feoC conserved hypothetical protein 1.900 (0.001) 1.964 (0.002)
YPTB3857 YPO4022 putative ABC transporter, periplasmic iron siderophore ferrichrome binding protein 3.127 (< 0.001) 2.157 (< 0.001)
YPTB3858 YPO4023 putative ABC iron siderophore transporter, permease subunit 2.236 (0.001) 1.214 (0.529)
YPTB3860 YPO4025 putative ABC iron siderophore transporter, ATP-binding subunit 2.216 (0.001) 1.417 (0.041)
YPTB1246 YPO1207 katA putative catalase 0.324 (< 0.001) 0.556 (0.002)
YPTB0811 YPO3319 katY putative catalase-hydroperoxidase HPI I 0.603 (0.009) 0.717 (0.342)
Biotin operon
YPTB1181 YPO1150 bioA putative adenosylmethionine-8-amino-7-oxononanoate aminotransferase 3.377 (< 0.001) 2.512 (0.002)
YPTB1183 YPO1152 bioF putative 8-amino-7-oxononanoate synthase 3.800 (< 0.001) 2.595 (< 0.001)
YPTB1184 YPO1153 bioC putative biotin synthesis protein BioC 1.784 (0.004) 1.351 (0.374)
YPTB1185 YPO1154 bioD putative dethiobiotin synthetase 2.499 (0.002) 1.780 (0.026)
Superoxyde dismutases
YPTB3925 YPO4061 sodA putative superoxide dismutase [Mn] 3.101 (< 0.001) 1.796 (0.049)
YPTB2299 YPO2386 sodB superoxide dismutase [Fe] 0.090 (< 0.001) 0.326 (< 0.001)
Ribonucleotides reductases (RNR)
YPTB2956 YPO2650 nrdI probable NrdI protein homologue 2.842 (0.001) 8.784 (< 0.001)
YPTB2957 YPO2649 nrdE putative ribonucleoside-diphosphate reductase 2 alpha chain 4.745 (< 0.001) 9.007 (< 0.001)
YPTB2958 YPO2648 nrdF putative ribonucleoside-diphosphate reductase 2 beta chain 2.672 (0.002) 2.142 (0.011)
YPTB2955 YPO2651 nrdH putative glutaredoxin 1.407 (0.152) 3.439 (< 0.001)
YPTB1254 YPO1214 nrdA putative ribonucleoside-diphosphate reductase 1 alpha chain 0.329 (< 0.001) 0.668 (0.085)
YPTB1253 YPO1213 nrdB putative ribonucleoside-diphosphate reductase 1 beta chain 0.815 (0.351) 0.579 (0.020)
YPTB0519 YPO3454 nrdD putative anaerobic ribonucleoside-triphosphate reductase 0.614 (0.025) 0.373 (< 0.001)
YPTB0518 YPO3455 nrdG putative anaerobic ribonucleotide reductase activating protein 0.440 (0.001) 0.508 (0.019)
Mannose and glucose uptake
YPTB1634 YPO1758 manX probable PTS system, mannose-specific IIAB component 2.673 (< 0.001) 3.234 (< 0.001)
YPTB1633 YPO1757 manY probable PTS system, mannose-specific IIC component 1.991 (0.006) 2.201 (< 0.001)
YPTB1632 YPO1756 manZ probable PTS system, mannose-specific IID component 3.084 (< 0.001) 3.676 (< 0.001)
YPTB2463 YPO1608 ptsG, putative PTS system, glucose-specific IIBC component 4.033 (< 0.001) 1.708 (0.027)
YPTB2715 YPO2993 ptsH probable PTS system, phosphocarrier protein 1.697 (0.002) 1.422 (0.109)
YPTB2716 YPO2994 ptsI putative PTS sytem, enzyme I component 1.946 (< 0.001) 1.351 (0.038)
YPTB2717 YPO2995 crr putative PTS system, glucose-specific IIA component, permease 1.611 (0.002) 1.440 (0.117)
Sugar metabolism
YPTB0074 YPO0078 pfkA putative 6-phosphofructokinase 1.594 (0.017) 1.430 (0.073)
YPTB3195 YPO0920 fbaA, fba, fda possible fructose-bisphosphate aldolase class II 1.325 (0.049) 1.504 (0.104)
YPTB3196 YPO0921 pgk putative phosphoglycerate kinase 1.365 (0.024) 1.365 (0.099)
YPTB1166 YPO1133 gpmA, gpm putative phosphoglycerate mutase 1 3.179 (< 0.001) 3.650 (< 0.001)
YPTB2047 YPO2064 pykA putative pyruvate kinase II 0.486 (0.001) 0.604 (0.013)
YPTB2306 YPO2393 pykF probable pyruvate kinase I 2.282 (< 0.001) 1.322 (0.185)
YPTB3762 YPO0138 pck putative phosphoenolpyruvate carboxykinase [ATP] 0.395 (0.001) 1.213 (0.460)
YPTB2103 YPO2180 adhE, ana putative aldehyde-alcohol dehydrogenase 2.116 (0.001) 3.383 (< 0.001)
YPTB0460 YPO3516 mdh putative malate dehydrogenase 0.665 (0.010) 0.394 (< 0.001)
YPTB0796 YPO3335 fumA, fumB putative fumarase A fumarate hydratase class I, aerobic isozyme 0.351 (< 0.001) 0.501 (0.020)
YPTB0413 YPO0360 frdA putative fumarate reductase flavoprotein subunit 0.156 (< 0.001) 0.299 (< 0.001)
YPTB0412 YPO0359 frdB putative fumarate reductase iron-sulfur protein 0.127 (< 0.001) 0.217 (< 0.001)
YPTB0411 YPO0358 frdC putative fumarate reductase hydrophobic protei 0.248 (< 0.001) 0.403 (< 0.001)
YPTB0410 YPO0357 frdD putative fumarate reductase hydrophobic protein 0.393 (0.001) 0.372 (< 0.001)
YPTB1145 YPO1111 sdhA putative succinate dehydrogenase flavoprotein subunit 0.497 (< 0.001) 0.124 (< 0.001)
YPTB1144 YPO1110 sdhD putative succinate dehydrogenase hydrophobic membrane anchor protein 0.501 (< 0.001) 0.165 (< 0.001)
YPTB1143 YPO1109 sdhC putative succinate dehydrogenase cytochrome b-556 subunit 0.553 (0.016) 0.241 (0.001)
YPTB1146 YPO1112 sdhB putative succinate dehydrogenase iron-sulfur protein 0.592 (0.004) 0.196 (< 0.001)
YPTB1149 YPO1115 sucC putative succinyl-CoA synthetase beta chain 0.419 (< 0.001) 0.205 (< 0.001)
YPTB1150 YPO1116 sucD putative succinyl-CoA synthetase alpha chain 0.525 (< 0.001) 0.236 (0.001)
YPTB1148 YPO1114 sucB putative dihydrolipoamide succinyltransferase component 0.610 (0.014) 0.267 (0.003)
YPTB1147 YPO1113 sucA putative 2-oxoglutarate dehydrogenase E1 component 0.516 (0.007) 0.193 (< 0.001)
YPTB0716 YPO3415 acnB putative aconitate hydratase 2 0.510 (< 0.001) 0.319 (< 0.001)
YPTB3656 YPO3725 aceA, icl isocitrate lyase 2.068 (0.003) 1.298 (0.319)
YPTB3657 YPO3726 aceB, mas malate synthase A 1.875 (0.053) 1.089 (0.710)
YPTB2222 YPO2300 fnr, nirR putative fumarate and nitrate reduction regulatory protein 0.699 (0.002) 0.877 (0.621)
YPTB0601 YPO0458 arcA probable response regulator (OmpR family) 0.464 (0.001) 0.705 (0.036)
Porins
YPTB1964 YPO1411 ompC2 putative outer membrane protein C2, porin 0.835 (0.447) 1.827 (0.001)
YPTB1261 YPO1222 ompC putative outer membrane protein C, porin 0.285 (< 0.001) 0.659 (0.013)
YPTB1453 YPO1435 ompA putative outer membrane porin A protein 1.085 (0.372) 0.587 (0.070)
Chromosomal virulence factors
YPTB1668 YPO3944 inv putative invasin 0.501 (< 0.001) 0.993 (0.976)
YPTB1334 YPO1303 psaA pH 6 antigen precursor (< 0.001) 0.367 (0.154)
YPTB1335 YPO1304 psaB chaperone protein PsaB precursor 0.216 (< 0.001) 0.700 (0.214)
YPTB1332 YPO1301 psaE putative regulatory protein 1.987 (0.002) 2.619 (< 0.001)
pYV-encoded virulence factors – Type Three Secretion System
pYV0062 YPCD1.36c yscX YscX, putative type III secretion protein 1.629 (0.009) 0.873 (0.444)
pYV0014 YPCD1.89 possible transposase remnant (pseudogene) 1.789 (0.025) 0.786 (0.899)
pYV0076 YPCD1.49 lcrF LcrF, VirF; putative thermoregulatory protein 1.441 (0.042) 1.311 (0.216)
pYV0058 YPCD1.32c lcrG LcrG, putative Yop regulator 1.713 (0.014) 0.941 (0.853)
pYV0056 YPCD1.30c lcrH, sycD LcrH, SycD; low calcium response protein H 3.522 (< 0.001) 0.898 (0.480)
pYV0059 YPCD1.33c lcrR LcrR, hypothetical protein 1.469 (0.001) 0.700 (0.129)
pYV0057 YPCD1.31c lcrV LcrV, putative V antigen, antihost protein/regulator 1.904 (< 0.001) 1.302 (0.051)
pYV0024 YPCD1.05c sycE SycE, yerA; putative yopE chaperone 5.781 (< 0.001) 1.344 (0.165)
pYV0020 YPCD1.95c sycH SycH, putative yopH targeting protein 5.088 (< 0.001) 2.029 (0.002)
pYV0017 YPCD1.91 putative resolvase 0.341 (< 0.001) 1.152 (0.705)
pYV0075 YPCD1.48 virG VirG; putative Yop targeting lipoprotein 1.957 (0.015) 1.544 (0.023)
pYV0055 YPCD1.29c yopB YopB, putative Yop targeting protein 2.816 (< 0.001) 0.956 (0.758)
pYV0054 YPCD1.28c yopD YopD, putative Yop negative regulation/targeting component 2.933 (< 0.001) 0.950 (0.833)
pYV0047 YPCD1.26c yopM YopM, putative targeted effector protein 3.467 (< 0.001) 1.044 (0.845)
pYV0065 YPCD1.39c yopN YopN, LcrE; putative membrane-bound Yop targeting protein 2.612 (< 0.001) 0.878 (0.475)
pYV0078 YPCD1.51 hypothetical protein 3.037 (0.002) 1.056 (0.716)
pYV0079 YPCD1.52 yscC YscC, putative type III secretion protein 2.383 (0.001) 0.715 (0.221)
pYV0080 YPCD1.53 yscD YscD, putative type III secretion protein 2.541 (< 0.001) 0.715 (0.095)
pYV0081 YPCD1.54 yscE YscE, putative type III secretion protein 2.710 (0.001) 0.543 (0.056)
pYV0082 YPCD1.55 yscF YscF, putative type III secretion protein 2.116 (0.017) 0.616 (0.135)
pYV0083 YPCD1.56 yscG YscG, putative type III secretion protein 2.462 (< 0.001) 0.905 (0.595)
pYV0085 YPCD1.58 yscI YscI, LcrO; putative type III secretion protein 1.864 (0.003) 1.024 (0.906)
pYV0089 YPCD1.62 yscM, lcrQ YscM, LcrQ, putative type III secretion regulatory 0.678 (0.036) 0.755 (0.052)
pYV0067 YPCD1.40 putative Yops secretion ATP synthase 2.855 (< 0.001) 0.971 (0.886)
pYV0068 YPCD1.41 yscO YscO, putative type III secretion protein 3.087 (< 0.001) 0.974 (0.913)
pYV0070 YPCD1.43 yscQ YscQ, putative type III secretion protein 1.635 (0.026) 1.214 (0.430)
pYV0071 YPCD1.44 yscR YscR, putative Yop secretion membrane protein 1.948 (0.012) 1.296 (0.269)
pYV0072 YPCD1.45 yscS YscS, putative type III secretion protein 2.331 (< 0.001) 1.218 (0.280)
pYV-encoded virulence factors – Others
pYV0013 YPCD1.88c yadA YadA, Yersinia adhesion 13.52 (< 0.001) 1.040 (0.861)
Open in a new tab

Table 2.

Y. pseudotuberculosis IP32953 chromosomal genes (sorted by COG class [28]) that are transcriptionally regulated by growth medium and/or temperature.

COG class Gene designation Genoscript spot ID Gene product/function Fold ratio in gene transcription (p-value)
Human plasma/Luria Bertani Broth 37°C/28°C
C: energy production and conversion
YPTB0086 (glpK) YPO0090 glycerol kinase 0.437 (0.002)
YPTB0108 (ppc) YPO3929 phosphoenolpyruvate carboxylase 0.678 (0.045)
YPTB0118 YPO3917 putative pyridine nucleotide-disulphide oxidoreductase 1.559 (0.016)
YPTB0211 (glpC) YPO3824 anaerobic glycerol-3-phosphate dehydrogenase subunit C 0.49 (0.003)
YPTB0374 (qor) YPO0319 quinone oxidoreductase 1.393 (0.04)
YPTB0410 (frdD) YPO0357 fumarate reductase hydrophobic protein 0.393 (0.001)
YPTB0411 (frdC) YPO0358 fumarate reductase hydrophobic protein 0.248 (< 0.001)
YPTB0412 (frdB) YPO0359 fumarate reductase iron-sulfur protein 0.128 (< 0.001)
YPTB0413 (frdA) YPO0360 fumarate reductase flavoprotein subunit 0.157 (< 0.001)
YPTB0460 (mdh) YPO3516 malate dehydrogenase 0.665 (0.01) 0.543 (< 0.001)
YPTB0714 (aceF) YPO3418 pyruvate dehydrogenase. dihydrolipoyltransacetylase component 0.676 (0.03)
YPTB0715 (lpdA) YPO3417 dihydrolipoamide dehydrogenase component of pyruvate dehydrogenase complex 0.657 (0.01)
YPTB0716 (acnB) YPO3415 aconitate hydratase 2 0.51 (< 0.001) 0.492 (< 0.001)
YPTB0796 (fumA) YPO3335 fumarate hydratase. class I 0.351 (< 0.001) 1.518 (0.049)
YPTB0887 (nqrA) YPO3240 NADH-ubiquinone oxidoreductase subunit A 0.328 (< 0.001)
YPTB0888 (nqrB) YPO3239 NADH-ubiquinone oxidoreductase subunit B 0.58 (0.002)
YPTB0889 (nqrC) YPO3238 Na+-translocating NADH-quinone reductase subunit c 0.551 (0.021)
YPTB0892 (nqrF) YPO3235 NADH-uniquinone oxidoreductase subunit F 0.661 (0.044)
YPTB0895 YPO3232 putative exported protein 0.6 (0.008)
YPTB0949 (cyoD) YPO3167 cytochrome O ubiquinol oxidase subunit CyoD 0.534 (0.001)
YPTB0952 (cyoA) YPO3164 cytochrome O ubiquinol oxidase subunit II 0.537 (< 0.001) 0.516 (< 0.001)
YPTB1125 (fldA) YPO2635 flavodoxin 1 0.722 (0.033)
YPTB1143 (sdhC) YPO1109 succinate dehydrogenase cytochrome b-556 subunit 0.552 (0.015) 0.622 (0.045)
YPTB1144 (sdhD) YPO1110 succinate dehydrogenase hydrophobic membrane anchor protein 0.5 (< 0.001) 0.654 (0.014)
YPTB1145 (sdhA) YPO1111 succinate dehydrogenase flavoprotein subunit 0.497 (< 0.001)
YPTB1146 (sdhB) YPO1112 succinate dehydrogenase iron-sulfur protein 0.592 (0.003)
YPTB1147 (sucA) YPO1113 2-oxoglutarate dehydrogenase E1 component 0.515 (0.006)
YPTB1148 (sucB) YPO1114 dihydrolipoamide succinyltransferase component of 2-oxoglutarate dehydro 0.61 (0.013) 0.671 (0.04)
YPTB1149 (sucC) YPO1115 succinyl-CoA synthetase beta chain 0.419 (< 0.001)
YPTB1150 (sucD) YPO1116 succinyl-CoA synthetase alpha chain 0.524 (< 0.001)
YPTB1151 (cydA) YPO1117 cytochrome D ubiquinol oxidase subunit I 0.442 (< 0.001)
YPTB1152 (cydB) YPO1118 cytochrome D ubiquinol oxidase subunit II 0.565 (0.004)
YPTB1408 (pflB) YPO1383 formate acetyltransferase 1 0.462 (< 0.001) 1.911 (< 0.001)
YPTB1723 (putA) YPO1851 bifunctional PutA protein [includes: proline dehydrogenase and delta-1-p 0.643 (< 0.001) 0.642 (< 0.001)
YPTB1945 YPO1947 putative thioredoxin 1.646 (0.002)
YPTB2012 YPO2028 putative exported protein 0.6 (0.008)
YPTB2017 YPO2035 hypothetical protein 1.694 (0.045)
YPTB2089 YPO2163 putative nitroreductase 2.095 (< 0.001)
YPTB2103 (adhE) YPO2180 aldehyde-alcohol dehydrogenase 2.115 (< 0.001)
YPTB2165 YPO2244 Fe-S binding NADH dehydrog. (pseudogene. F/S) 2.157 (< 0.001)
YPTB2224 (pntB) YPO2302 NAD(P) transhydrogenase subunit beta 1.502 (0.037)
YPTB2248 (ldhA) YPO2329 D-lactate dehydrogenase 0.615 (0.006)
YPTB2253 (nifJ) YPO2334 putative pyruvate-flavodoxin oxidoreductase 1.697 (0.014)
YPTB2427 (icdA) YPO1641 isocitrate dehydrogenase [NADP] 0.632 (0.013)
YPTB2529 YPO2492 putative dioxygenase beta subunit 0.535 (0.02)
YPTB2578 (nuoK) or3622 NADH dehydrogenase i chain k 0.642 (0.001)
YPTB2581 (nuoH) YPO2549 NADH dehydrogenase I chain H 0.745 (0.023)
YPTB2585 (nuoD) YPO2553 NADH dehydrogenase I chain C/D 0.573 (0.003)
YPTB2587 (nuoA) YPO2555 NADH dehydrogenase I chain A 0.62 (< 0.001)
YPTB2597 (ackA) YPO2566 acetate kinase 0.652 (0.001)
YPTB2598 (pta) YPO2567 phosphate acetyltransferase 0.667 (0.017)
YPTB2689 (dmsB) YPO2966 putative dimethyl sulfoxide reductase chain B protein 0.598 (0.031)
YPTB2703 YPO2980 putative ion channel protein 0.565 (0.01)
YPTB2758 (napC) YPO3036 cytochrome C-type protein NapC 0.636 (0.015)
YPTB3469 (fadH) YPO0589 2.4-dienoyl-CoA reductase 0.465 (0.002) 1.713 (0.024)
YPTB3539 YPO3694 putative cytochrome 0.544 (< 0.001)
YPTB3592 YPO3637 putative carbohydrate kinase 1.585 (0.031)
YPTB3656 (aceA) YPO3725 isocitrate lyase 2.069 (0.002) 1.963 (0.004)
YPTB3762 (pckA) YPO0138 phosphoenolpyruvate carboxykinase [ATP] 0.395 (0.001)
YPTB3782 (glpD) YPO3937 aerobic glycerol-3-phosphate dehydrogenase 0.409 (0.02)
YPTB3927 (fdoG) or2536 formate dehydrogenase-O. major subunit 0.208 (< 0.001) 0.712 (0.029)
YPTB3928 (fdoH) YPO4057 formate dehydrogenase-O. iron-sulfur subunit 0.187 (< 0.001) 0.698 (0.03)
YPTB3929 (fdoI) YPO4056 formate dehydrogenase. cytochrome b556 protein 0.372 (< 0.001) 0.551 (< 0.001)
YPTB3967 (atpD) YPO4121 ATP synthase beta subunit protein 0.679 (0.025)
YPTB3968 (atpG) YPO4122 ATP synthase gamma subunit protein 0.658 (0.011)
YPTB3970 (atpH) or2565 ATP synthase delta subunit protein 0.7 (0.005)
YPTB3971 (atpF) YPO4125 ATP synthase subunit B protein 0.616 (0.002)
YPTB3972 (atpE) or2563 ATP synthase subunit C protein 0.656 (0.037)
YPTB3973 (atpB) YPO4127 ATP synthase subunit B protein 0.667 (0.004) 0.732 (0.021)
D: cell division and chromosome partitioning
YPTB0222 (ftsE) YPO3813 cell division ATP-binding protein 0.595 (0.019)
YPTB1430 (mukB) YPO1405 cell division protein 0.62 (0.006)
YPTB2923 YPO2686 putative membrane protein 0.358 (< 0.001)
YPTB3126 or3195 possible bacteriophage protein 1.616 (0.029)
YPTB3976 (gidA) YPO4130 glucose inhibited division protein A 0.607 (0.007) (0.007)
E: amino acid transport and metabolism
YPTB0003 (asnA) YPO0003 aspartate-ammonia ligase 1.531 (0.042)
YPTB0024 (glnA) YPO0024 glutamine synthetase 0.49 (< 0.001) 0.448 (< 0.001)
YPTB0057 (tdh) YPO0060 threonine 3-dehydrogenase 0.663 (0.041)
YPTB0066 (cysE) YPO0070 serine acetyltransferase 1.669 (0.016)
YPTB0106 (metL) YPO0116 bifunctional aspartokinase/homoserine dehydrogenase II 1.565 (0.045)
YPTB0111 (argB) YPO3925 acetylglutamate kinase 1.495 (0.016)
YPTB0112 (argH) YPO3924 putative argininosuccinate lyase 1.779 (0.007)
YPTB0134 (ilvG) YPO3901 acetolactate synthase isozyme II large subunit 0.627 (0.039)
YPTB0203 (rhtC) YPO3832 threonine efflux protein 0.597 (0.024)
YPTB0210 (glpB) YPO3825 putative anaerobic glycerol-3-phosphate dehydrogenase subunit B 0.554 (0.01)
YPTB0226 (livK) YPO3808 branched-chain amino acid-binding protein 1.49 (0.032)
YPTB0245 or0170 conserved hypothetical protein 0.662 (0.031)
YPTB0248 (metE) YPO3788 5-methyltetrahydropteroyltriglutamate – homocystei ne methyltransferase 2.813 (0.001)
YPTB0345 YPO0287 putative methylenetetrahydrofolate reductase 2.947 (< 0.001)
YPTB0402 (aspA) YPO0348 aspartate ammonia-lyase 0.224 (< 0.001)
YPTB0407 YPO0353 conserved hypothetical protein 0.687 (0.03)
YPTB0521 YPO3452 putative ABC transporter transporter. ATP-binding protein 1.679 (0.029)
YPTB0524 YPO3448 (7G) putative extracellular solute-binding protein (pseudogene. F/S) 1.553 (0.046)
YPTB0557 or0391 possible conserved cysteine desulfurase (< 0.001)
PTB0602 (arcA) YPO0459 aerobic respiration control protein 0.465 (0.001)
YPTB0604 (thrB) YPO0461 homoserine kinase 1.411 (0.03)
YPTB0623 (carA) YPO0481 carbamoyl-phosphate synthase small chain 0.609 (< 0.001) 0.747 (0.028)
YPTB0624 (carB) YPO0482 carbamoyl-phosphate synthase large chain 0.621 (0.022) 0.546 (0.005)
YPTB0676 (ilvH) YPO0540 acetolactate synthase isozyme III small subunit 1.68 (0.006)
YPTB0711 (aroP) YPO3421 aromatic amino acid transport protein 1.68 (0.006)
YPTB0761 (cysH) YPO3370 phosphoadenosine phosphosulfate reductase (pseudogene. F/S) 1.593 (0.002)
YPTB0789 YPO3343 probable extracellular solute-binding protein 0.462 (0.001)
YPTB0911 (aroL) YPO3215 shikimate kinase II 0.601 (0.03)
YPTB0920 (brnQ) YPO3202 branched-chain amino acid transport system II carrier protein 1.481 (0.033)
YPTB1108 (glnH) YPO2615 putative amino acid-binding protein precursoR 0.564 (0.005)
YPTB1186 YPO1155 putative amino acid transporteR 1.736 (0.017)
YPTB1240 YPO1200 putative amino acid permease 0.637 (0.025)
YPTB1241 YPO1201 putative amino acid decarboxylase 0.557 (0.024)
YPTB1346 YPO1315 putative hydrolase (pseudogene. stop) 1.578 (< 0.001) 0.669 (0.001)
YPTB1352 (sdaC) YPO1321 serine transporteR 0.526 (0.028)
YPTB1362 (potG) YPO1332 putrescine transport ATP-binding protein 0.728 (0.035)
YPTB1375 (artM) YPO1349 arginine transport system permease protein 1.648 (0.014) 0.572 (0.007)
YPTB1384 (poxB) YPO1358 pyruvate dehydrogenase [cytochrome] 1.521 (0.009)
YPTB1411 (ansB) YPO1386 putative L-asparaginase II precursoR 1.869 (0.013)
YPTB1434 (aspC) YPO1410 aspartate aminotransferase 1.447 (0.004)
YPTB1438 (pepN) YPO1414 putative aminopeptidase N 1.432 (0.041)
YPTB1541 (ysuJ) YPO1529 putative decarboxylase 2.092 (< 0.001)
YPTB1621 (aroP) YPO1743 aromatic amino acid transport protein 1.68 (0.006)
YPTB1641 (hpaF) YPO1765 5-carboxymethyl-2-hydroxymuconate delta-isomerase 1.812 (0.015)
YPTB1656 (ptrB) YPO1780 oligopeptidase B 1.695 (0.006)
YPTB1889 (lysA) or1363 possible diaminopimelate decarboxylase 1.621 (0.01) 0.45 (< 0.001)
YPTB2001 (prsA) YPO2013 ribose-phosphate pyrophosphokinase 0.55 (< 0.001)
YPTB2019 YPO2037 conserved hypothetical protein 1.56 (0.021)
YPTB2067 YPO2138 putative aminotransferase 1.978 (< 0.001)
YPTB2105 (oppA) YPO2182 periplasmic oligopeptide-binding protein precursoR 0.466 (< 0.001)
YPTB2108 (oppD) YPO2185 oligopeptide transport ATP-binding protein (< 0.001)
YPTB2126 (trpB) YPO2204 tryptophan synthase beta chain 2.22 (< 0.001)
YPTB2258 (mppA) YPO2339 putative periplasmic murein peptide-binding protein 1.376 (0.039)
YPTB2262 (tyrR) YPO2344 transcriptional regulatory protein 0.486 (< 0.001)
YPTB2295 (gloA) YPO2381 lactoylglutathione lyase 1.666 (< 0.001) 1.229 (0.042)
YPTB2437 (pepT) YPO1631 peptidase T 0.488 (0.007)
YPTB2548 (glnH) YPO2511 putative glutamine-binding periplasmic protein 1.797 (0.014)
YPTB2549 (glnP) YPO2512 putative glutamine transport system permease 1.704 (0.024)
YPTB2550 (glnQ) YPO2513 putative glutamine transport ATP-binding protein 1.56 (0.027)
YPTB2632 (aroC) YPO2751 chorismate synthase 0.675 (0.031)
YPTB2698 YPO2975 putative aminotransferase 2.151 (< 0.001)
YPTB2714 (cysK) YPO2992 cysteine synthase A 2.108 (0.005)
YPTB2723 YPO3002 putative permease 1.328 (0.036)
YPTB2725 YPO3004 putative aminopeptidase (pseudogene. F/S) 1.526 (0.022) 1.685 (0.006)
YPTB2784 (gcvR) YPO3063 glycine cleavage system transcriptional repressoR 2.302 (<0.001)
YPTB2869 (glyA) YPO2907 serine hydroxymethyltransferase 1.783 (0.001)
YPTB2882 (yfhB) YPO2924 putative membrane protein 1.737 (0.006)
YPTB2909 YPO2699 conserved hypothetical protein 1.513 (0.017)
YPTB2942 (ureC) YPO2667 urease alpha subunit 0.333 (<0.001)
YPTB2943 (ureB) YPO2666 urease beta subunit 0.2 (<0.001)
YPTB2944 (ureA) YPO2665 urease gamma subunit 0.324 (<0.001)
YPTB2961 (proX) YPO2645 glycine betaine-binding periplasmic protein 0.637 (0.009)
YPTB2986 YPO1061 conserved hypothetical protein 0.551 (0.031)
YPTB3006 (dapD) YPO1041 2.3.4.5-tetrahydropyridine-2-carboxylate N-succinyltransferase 0.398 (< 0.001) 1.445 (0.005)
YPTB3181 (gcsH) YPO0906 glycine cleavage system H protein 0.377 (< 0.001)
YPTB3182 (gcvT) YPO0907 aminomethyltransferase 0.526 (0.022)
YPTB3189 (serA) YPO0914 D-3-phosphoglycerate dehydrogenase 1.582 (0.04) 0.517 (0.005)
YPTB3214 (proC) YPO0942 putative pyrroline-5-carboxylate reductase 0.647 (0.038)
YPTB3474 YPO0584 putative symporter protein 0.61 (0.007)
YPTB3570 (aroQ) YPO3660 putative class II dehydroquinase 0.721 (0.036)
YPTB3658 (metA) YPO3727 homoserine O-succinyltransferase 1.776 (0.018)
YPTB3749 (aroB) YPO0152 3-dehydroquinate synthase 0.612 (0.039)
YPTB3813 (gdhA) YPO3971 NADP-specific glutamate dehydrogenase 1.671 (0.005)
YPTB3853 (cysM) or2495 pyridoxal-phosphate dependent protein (pseudogene. partial) 0.415 (< 0.001)
YPTB3957 YPO4111 putative periplasmic solute-binding protein 1.59 (0.006)
F: nucleotide transport and metabolism
YPTB0250 (udp) YPO3786 uridine phosphorylase 0.486 (0.005)
YPTB0519 (nrdD) YPO3454 anaerobic ribonucleoside-triphosphate reductase 0.614 (0.024)
YPTB0584 (deoD) YPO0440 purine nucleoside phosphorylase 0.607 (0.025)
YPTB0623 (carA) YPO0481 carbamoyl-phosphate synthase small chain 0.609 (< 0.001) 0.747 (0.028)
YPTB0624 (carB) YPO0482 carbamoyl-phosphate synthase large chain 0.621 (0.022) 0.546 (0.005)
YPTB0754 (pyrG) YPO3377 CTP synthase 0.469 (< 0.001)
YPTB0901 (gpt) YPO3225 xanthine-guanine phosphoribosyltransferase 0.68 (0.035)
YPTB0991 (apt) YPO3123 adenine phosphoribosyltransferase 1.447 (0.042)
YPTB1253 (nrdB) YPO1213 ribonucleoside-diphosphate reductase 1 beta chain 0.489 (0.003)
YPTB1254 (nrdA) YPO1214 ribonucleoside-diphosphate reductase 1 alpha chain 0.328 (< 0.001) 0.707 (0.014)
YPTB1439 (pyrD) YPO1415 dihydroorotate dehydrogenase 1.331 (0.037)
YPTB2001 (prsA) YPO2013 ribose-phosphate pyrophosphokinase 0.55 (< 0.001)
YPTB2102 (tdk) YPO2176 thymidine kinase 0.75 (0.034)
YPTB2706 (nupC) YPO2983 nucleoside permease 1.674 (0.018)
YPTB2781 (purC) YPO3059 phosphoribosylaminoimidazole-succinocarboxamide synthase (pseudogene. IS 0.598 (0.009)
YPTB2794 (upp) YPO2827 uracil phosphoribosyltransferase 0.515 (0.002)
YPTB2796 (purN) YPO2829 putative phosphoribosylglycinamide formyltransferase 1.842 (0.038)
YPTB2803 (ppx) YPO2837 putative exopolyphosphatase 0.564 (< 0.001)
YPTB2956 (nrdI) YPO2650 NrdI protein homologue 2.842 (< 0.001)
YPTB2957 (nrdE) YPO2649 ribonucleoside-diphosphate reductase 2 alpha chain 4.745 (< 0.001)
YPTB2958 (nrdF) YPO2648 ribonucleoside-diphosphate reductase 2 beta chain 2.671 (0.002)
YPTB3544 YPO3689 putative ribonuclease 1.543 (0.022)
YPTB3854 YPO4019 putative phosphoribosyl transferase protein 0.487 (0.001)
G: carbohydrate transport and metabolism
YPTB0074 (pfkA) YPO0078 6-phosphofructokinase 1.593 (0.017)
YPTB0087 (glpF) YPO0091 glycerol uptake facilitator protein 0.488 (0.041)
YPTB0241 (ugpC) YPO3793 sn-glycerol-3-phosphate transport. ATP-binding protein 1.725 (0.001)
YPTB0542 YPO0402 PTS system. IIB component 0.565 (0.023)
YPTB0548 YPO0408 putative aldolase 1.968 (0.021)
YPTB0550 YPO0410 putative ABC transporter permease protein 0.573 (0.033)
YPTB0569 YPO0424 putative pectinesterase 0.268 (< 0.001)
YPTB0583 (deoB) YPO0439 phosphopentomutase 1.651 (0.03)
YPTB0782 (dhaK) YPO3350 putative dihydroxyacetone kinase 0.683 (0.028)
YPTB0799 YPO3332 putative sugar ABC transporter. permease protein 1.787 (0.018) 1.912 (0.01)
YPTB0803 (fucR) YPO3327 putative deoR-family regulatory protein 0.435 (< 0.001) 1.521 (0.007)
YPTB0804 (araD) YPO3326 L-ribulose-5-phosphate 4-epimerase 0.537 (< 0.001)
YPTB0874 or0625 probable sugar aldolase 1.455 (0.042) 1.627 (0.011)
YPTB1079 YPO2586 conserved hypothetical protein 0.559 (0.025)
YPTB1080 YPO2587 conserved hypothetical protein 0.644 (0.026)
YPTB1119 (nagB) YPO2627 putative glucosamine-6-phosphate isomerase 0.654 (0.027)
YPTB1140 YPO1106 conserved hypothetical protein 0.705 (0.034)
YPTB1166 (gpmA) YPO1133 phosphoglycerate mutase 1 3.178 (< 0.001)
YPTB1290 (bglA) YPO1254 6-phospho-beta-glucosidase 1.802 (0.008)
YPTB1327 YPO1295 putative ABC transport integral membrane subunit 1.976 (0.009)
YPTB1381 YPO1355 conserved hypothetical protein 0.683 (0.031)
YPTB1522 (mglB) YPO1507 galactose-binding protein 0.56 (0.002) 1.47 (0.029)
YPTB1581 YPO1572 putative sugar transporteR 0.587 (0.023)
YPTB1600 (ybtX) YPO1915 putative signal transduceR 1.766 (0.003)
YPTB1632 (manZ) YPO1756 PTS system. mannose-specific IID component 3.084 (< 0.001)
YPTB1633 (manY) YPO1757 PTS system. mannose-specific IIC component 1.991 (0.005)
YPTB1634 (manX) YPO1758 PTS system. mannose-specific IIAB component 2.674 (< 0.001)
YPTB1687 YPO1814 putative sugar ABC transporter. ATP-binding protein 1.865 (0.016)
YPTB1930 YPO1932 putative sugar transporteR 1.963 (0.002)
YPTB1975 YPO1982 putative dehydrogenase 0.63 (0.012)
YPTB2047 (pykA) YPO2064 pyruvate kinase II 0.486 (< 0.001)
YPTB2082 YPO2156 conserved hypothetical protein 0.538 (0.002) 1.487 (0.03)
YPTB2083 (gapA) YPO2157 glyceraldehyde 3-phosphate dehydrogenase A 0.712 (0.027)
YPTB2147 YPO2225 conserved hypothetical protein 1.297 (0.041)
YPTB2190 (mlc) YPO2268 putative ROK family transcriptional regulatory protein 1.417 (0.037)
YPTB2205 or3894 ABC sugar/ribose transporter. permease subunit 1.61 (0.036)
YPTB2306 (pykF) YPO2393 pyruvate kinase I 2.282 (< 0.001)
YPTB2318 (ppsA) YPO2409 phosphoenolpyruvate synthase 0.463 (0.008)
YPTB2356 (kduI) YPO1725 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase 1.444 (0.047)
YPTB2360 YPO1721 putative sugar ABC transporter (permease) 1.901 (0.032)
YPTB2463 (ptsG) YPO1608 PTS system. glucose-specific IIBC component 4.033 (< 0.001) 1.607 (0.002)
YPTB2515 YPO2474 conserved hypothetical protein 0.593 (0.036)
YPTB2518 YPO2477 putative solute-binding protein 0.62 (0.029)
YPTB2535 (rbsC) YPO2499 putative sugar transport system. permease protein 1.7 (0.013)
YPTB2715 (ptsH) YPO2993 PTS system. phosphocarrier protein 1.697 (0.001)
YPTB2716 (ptsI) YPO2994 PTS sytem. enzyme I component 1.945 (< 0.001)
YPTB2717 (crr) YPO2995 PTS system. glucose-specific IIA component 1.611 (0.002) 0.731 (0.028)
YPTB2962 YPO2644 conserved hypothetical protein (pseudogene. IS100) 2.68 (< 0.001)
YPTB3078 YPO0834 putative PTS transport protein 1.742 (0.025)
YPTB3190 (rpiA) YPO0915 ribose 5-phosphate isomerase A 0.601 (0.021) 0.641 (0.039)
YPTB3195 (fbaA) YPO0920 fructose-bisphosphate aldolase class II 1.325 (0.048) 0.699 (0.015)
YPTB3196 (pgk) YPO0921 phosphoglycerate kinase 1.366 (0.024)
YPTB3229 YPO0957 putative sugar transport system permease protein 0.626 (0.018)
YPTB3230 (mglA) YPO0958 putative sugar transport ATP-binding protein 0.624 (0.005)
YPTB3262 YPO0988 putative membrane protein 2.167 (< 0.001)
YPTB3268 YPO0995 Sodium:galactoside symporter family protein 1.764 (0.014)
YPTB3479 (exuT) YPO0577 ExuT transport protein 1.866 (0.001)
YPTB3495 YPO3550 probable phosphosugar isomerase 0.736 (0.042)
YPTB3536 (treB) YPO3697 PTS system. trehalose-specific IIBC component 0.34 (< 0.001) 1.832 (0.015)
YPTB3537 (treC) YPO3696 putative trehalose-6-phosphate hydrolase 0.279 (< 0.001)
YPTB3609 YPO3620 putative carbohydrate transport protein 1.459 (0.02)
YPTB3642 (lamB) YPO3711 maltoporin 0.419 (< 0.001)
YPTB3779 (glpR) YPO0120 glycerol-3-phosphate repressor protein 1.398 (0.043)
YPTB3783 (glgP) YPO3938 glycogen phosphorylase 1.516 (0.021) 1.484 (0.028)
YPTB3787 (glgB) YPO3942 1.4-alpha-glucan branching enzyme 0.603 (0.001)
H: coenzyme metabolism
YPTB0014 (mobA) or5120 molybdopterin-guanine dinucleotide biosynthesis protein A 0.703 (0.032)
YPTB0056 (kbl) YPO0059 2-amino-3-ketobutyrate coenzyme A ligase 0.639 (0.02)
YPTB0134 (ilvG) YPO3901 acetolactate synthase isozyme II large subunit 0.627 (0.039)
YPTB0182 (hemX) YPO3851 putative uroporphyrin-III C-methyltransferase 0.695 (0.033)
YPTB0264 YPO3769 conserved hypothetical protein 0.695 (0.01)
YPTB0290 (thiC) YPO3739 thiamine biosynthesis protein ThiC 2.329 (0.012)
YPTB0344 YPO0286 putative coproporphyrinogen III oxidase 1.636 (0.015)
YPTB0463 (ispB) YPO3513 octaprenyl-diphosphate synthase 0.731 (0.03) 0.614 (0.002)
YPTB0559 or0393 hypothetical protein 1.723 (0.007) (< 0.001)
YPTB0561 or0395 putative protein involved in molybdopterin biosynthesis 1.802 (0.004) (< 0.001)
YPTB0616 (rpsT) YPO0474 30S ribosomal protein S20 0.59 (0.002)
YPTB0664 or0477 hypothetical protein 0.754 (0.035) 1.423 (0.01)
YPTB0731 (folK) YPO3400 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase 0.572 (0.009)
YPTB0739 (fhuC) YPO3392 ferrichrome transport ATP-binding protein FhuC 1.932 (0.046)
YPTB0758 (ygcM) YPO3373 putative 6-pyruvoyl tetrahydrobiopterin synthase family protein 0.556 (0.002) 0.629 (0.011)
YPTB0761 (cysH) YPO3370 phosphoadenosine phosphosulfate reductase (pseudogene. F/S) 1.593 (0.002)
YPTB0935 (ribH) YPO3182 6.7-dimethyl-8-ribityllumazine synthase 0.695 (0.01)
YPTB0940 (ispA) YPO3176 geranyltranstransferase 0.635 (0.026)
YPTB1003 (wbyH) YPO3111 putative exported protein 0.727 (0.039)
YPTB1091 (lipA) YPO2598 lipoic acid synthetase 0.558 (0.002)
YPTB1163 (pnuC) YPO1128 intergral membrane NMN transport protein PnuC 1.675 (0.004)
YPTB1181 (bioA) YPO1150 adenosylmethionine-8-amino-7-oxononanoate aminotransferase 3.377 (< 0.001) 1.592 (0.038)
YPTB1183 (bioF) YPO1152 8-amino-7-oxononanoate synthase 3.799 (< 0.001)
YPTB1184 (bioC) YPO1153 biotin synthesis protein BioC 1.784 (0.004) 1.636 (0.011)
YPTB1185 (bioD) YPO1154 dethiobiotin synthetase 2.499 (0.002)
YPTB1343 YPO1312 putative siderophore ABC transporter. ATP-binding subunit 2.467 (< 0.001)
YPTB1384 (poxB) YPO1358 pyruvate dehydrogenase [cytochrome] 1.521 (0.009)
YPTB1885 or1359 possible ThiF family (< 0.001)
YPTB1886 or1360 conserved hypothetical protein (< 0.001)
YPTB1888 or1362 conserved hypothetical protein 1.886 (0.001) 0.314 (< 0.001)
YPTB2033 YPO2050 conserved hypothetical protein 0.542 (0.002)
YPTB2136 (btuR) YPO2214 cob(I)alamin adenosyltransferase 1.975 (0.002)
YPTB2191 YPO2269 putative dethiobiotin synthetase 0.3 (< 0.001)
YPTB2304 (ribE) YPO2391 riboflavin synthase alpha chain 1.44 (0.012)
YPTB2459 or3719 hypothetical 0.379 (< 0.001)
YPTB2561 (menF) YPO2528 menaquinone-specific isochorismate synthase 0.522 (0.011)
YPTB3574 YPO3657 putative sodium/panthothenate symporter 0.634 (0.01)
I: lipid metabolism
YPTB0416 (psd) YPO0364 phosphatidylserine decarboxylase proenzyme 1.846 (0.024)
YPTB0434 (aidB) YPO0383 putative acyl-CoA dehydrogenase 1.613 (0.049)
YPTB0558 or0392 possible acyl-CoA dehydrogenase 1.628 (0.042) (< 0.001)
YPTB0674 YPO0537 putative AMP-binding enzyme-family protein 0.616 (0.047)
YPTB0883 (yafH) YPO3244 probable acyl-CoA dehydrogenase 2.292 (< 0.001)
YPTB1355 YPO1324 putative permease 0.499 (< 0.001)
YPTB1450 (fabA) YPO1430 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase 0.685 (0.033)
YPTB1480 YPO1462 putative acyl carrier protein 1.669 (0.048)
YPTB2242 (acpD) YPO2323 acyl carrier protein phosphodiesterase 0.703 (0.013)
YPTB2470 (acpP) YPO1600 acyl carrier protein 0.661 (0.002)
YPTB2473 (fabH) YPO1597 3-oxoacyl-[acyl-carrier-protein] synthase III 0.757 (0.047) 0.708 (0.017)
YPTB2626 (fabB) YPO2757 3-oxoacyl-[acyl-carrier-protein] synthase I 0.605 (0.009)
YPTB2993 (lpxD) YPO1054 UDP-3-o-[3-hydroxymyristoyl] glucosamine N-acyltransferase 1.258 (0.018) 0.761 (0.007)
YPTB3849 YPO4014 putative membrane protein 1.549 (0.012)
YPTB3856 YPO4021 hypothetical protein 0.58 (0.012)
J: translation, ribosomal structure and biogenesis
YPTB0034 (trmH) YPO0037 tRNA (guanosine-2'-O-)-methyltransferase 1.673 (0.023)
YPTB0041 (rph) YPO0044 ribonuclease PH 0.667 (0.005)
YPTB0276 (tufA) or0197 elongation factor Tu 0.624 (0.001)
YPTB0279 (rplK) YPO3751 50S ribosomal protein L11 0.703 (0.027) 0.682 (0.018)
YPTB0280 (rplA) YPO3750 50S ribosomal protein L1 0.681 (0.027) 0.689 (0.031)
YPTB0281 (rplJ) YPO3749 50S ribosomal protein L10 0.612 (0.017)
YPTB0282 (rplL) YPO3748 50S ribosomal protein L7/L12 0.58 (0.014)
YPTB0408 (efp) YPO0354 elongation factor P 1.7 (0.018)
YPTB0438 (rpsF) YPO3539 30S ribosomal protein S6 0.597 (0.018) 0.501 (0.003)
YPTB0441 (rplI) YPO3536 50S ribosomal protein L9 0.476 (< 0.001)
YPTB0464 (rplU) YPO3512 50S ribosomal protein L21 0.539 (0.006)
YPTB0465 (rpmA) YPO3511 50S ribosomal protein L27 0.538 (0.002) 0.66 (0.026)
YPTB0480 (infB) YPO3496 translation initiation factor IF2-2 (pseudogene. inframe deletion) 0.598 (< 0.001) 0.661 (< 0.001)
YPTB0483 (rpsO) YPO3493 30S ribosomal protein S15 0.647 (0.004)
YPTB0484 (pnp) YPO3490 polyribonucleotide nucleotidyltransferase 0.642 (0.006)
YPTB0529 (valS) YPO3443 valyl-tRNA synthetase 0.648 (0.004)
YPTB0575 (prfC) YPO0430 peptide chain release factor 3 0.536 (0.014) 0.611 (0.046)
YPTB0732 (pcnB) YPO3399 poly(A) polymerase 0.74 (0.025)
YPTB0794 (map) YPO3337 methionine aminopeptidase 3.582 (< 0.001)
YPTB0834 (rpsP) YPO3295 30S ribosomal protein S16 0.682 (0.044)
YPTB0835 (rimM) YPO3294 16S rRNA processing protein 0.628 (0.003) 0.68 (0.011)
YPTB0836 (trmD) YPO3293 tRNA (guanine-N1)-methyltransferase 0.596 (0.004)
YPTB0844 (yfiA) YPO3279 putative sigma 54 modulation protein 0.141 (< 0.001) 2.388 (0.03)
YPTB0846 (rluD) YPO3277 ribosomal large subunit pseudouridine synthase d 0.718 (0.04)
YPTB1058 or0769 conserved hypothetical protein 1.626 (0.021)
YPTB1138 YPO1104 conserved hypothetical protein 1.634 (0.005)
YPTB1366 YPO1336 putative RNA methyltransferase 0.588 (0.018)
YPTB1411 (ansB) YPO1386 putative L-asparaginase II precursoR 1.869 (0.013)
YPTB1417 (rpsA) YPO1392 30S ribosomal protein S1 0.427 (< 0.001)
YPTB1436 (asnS) YPO1412 asparaginyl-tRNA synthetase 1.628 (0.022)
YPTB1953 YPO1955 putative acetyltransferase 0.594 (0.017)
YPTB2005 (prfA) YPO2017 peptide chain release factor 1 0.665 (0.008) 0.733 (0.035)
YPTB2135 YPO2213 putative RNA pseudouridylate synthase-family protein 0.691 (0.032)
YPTB2150 YPO2228 translation initiation factor SUI1 family protein 1.574 (0.008)
YPTB2328 YPO2420 probable formyl transferase 0.578 (0.015)
YPTB2336 (pheT) YPO2428 phenylalanyl-tRNA synthetase beta chain 1.646 (0.003)
YPTB2337 (pheS) YPO2429 phenylalanyl-tRNA synthetase alpha chain 0.615 (0.016)
YPTB2339 (rplT) or3807 50S ribosomal protein L20 0.719 (0.017)
YPTB2618 (truA) YPO2766 tRNA pseudouridine synthase A 0.52 (0.01)
YPTB2861 YPO2898 putative SpoU-family rRNA methylase 0.586 (< 0.001)
YPTB3000 (frr) YPO1047 ribosome recycling factoR 0.609 (0.026)
YPTB3002 (tsf) YPO1045 elongation factor Ts 0.611 (0.047)
YPTB3003 (rpsB) YPO1044 30S ribosomal protein S2 0.464 (< 0.001)
YPTB3009 YPO1038 Conserved hypothetical protein 0.761 (0.039)
YPTB3126 or3195 Possible bacteriophage protein 1.616 (0.029)
YPTB3507 (rpsI) YPO3562 30S ribosomal protein S9 0.723 (0.037) 0.582 (0.001)
YPTB3674 (rpsD) YPO0233 30S ribosomal protein S4 0.576 (0.002)
YPTB3675 (rpsK) YPO0232 30S ribosomal protein S11 0.594 (0.017)
YPTB3676 (rpsM) YPO0231 30S ribosomal protein S13 0.518 (0.005)
YPTB3679 (rplO) YPO0228 50S ribosomal protein L15 0.593 (0.008)
YPTB3682 (rplR) YPO0225 50S ribosomal protein L18 0.563 (0.005)
YPTB3684 (rpsH) or2793 30S ribosomal protein S8 0.638 (0.042) 0.619 (0.032)
YPTB3687 (rplX) YPO0221 50S ribosomal protein L24 0.574 (0.005)
YPTB3688 (rplN) YPO0220 50S ribosomal protein L14 0.634 (0.015)
YPTB3689 (rpsQ) YPO0219 30S ribosomal protein S17 0.58 (0.016)
YPTB3691 (rplP) YPO0217 50S ribosomal protein L16 0.511 (< 0.001)
YPTB3692 (rpsC) YPO0216 30S ribosomal protein S3 0.642 (0.028)
YPTB3693 (rplV) YPO0215 50S ribosomal protein L22 0.466 (0.003)
YPTB3694 (rpsS) YPO0214 30S ribosomal protein S19 0.612 (0.013)
YPTB3695 (rplB) YPO0213 50S ribosomal protein l2 0.555 (< 0.001) 0.596 (< 0.001)
YPTB3696 (rplW) YPO0212 50S ribosomal protein L23 0.509 (0.001)
YPTB3698 (rplC) YPO0210 50S ribosomal protein L3 0.465 (0.001)
YPTB3699 (rpsJ) YPO0209 30S ribosomal protein S10 0.654 (0.049) 0.579 (0.014)
YPTB3702 (tufA,tufB) or2775 elongation factor EF-Tu 0.672 (0.003)
YPTB3703 (fusA) YPO0202 elongation factor G 0.536 (0.002)
YPTB3946 (rnpA) YPO4101 ribonuclease P protein 0.58 (0.005)
K: transcription
YPTB0035 (spoT) YPO0038 guanosine-3'.5'-bisbis(diphosphate) 3'-pyrophosphydrolase 0.684 (0.011)
YPTB0100 (cytR) YPO0108 transcriptional repressoR 0.572 (0.014)
YPTB0167 (rho) YPO3867 transcription termination factoR 0.467 (< 0.001)
YPTB0263 (rfaH) YPO3770 putative regulatory protein 0.552 (0.001)
YPTB0278 (nusG) YPO3752 transcription antitermination protein 0.57 (0.001)
YPTB0284 (rpoC) YPO3746 DNA-directed RNA polymerase beta' chain 0.556 (0.019)
YPTB0291 (rsd) YPO3737 regulator of sigma D 1.963 (< 0.001) 0.632 (0.002)
YPTB0333 YPO0276 putative LysR-family transcriptional regulatoR 0.62 (0.044)
YPTB0387 (rhaR) YPO0333 L-rhamnose operon transcriptional activatoR 0.546 (0.025)
YPTB0479 (nusA) YPO3497 N utilization substance protein A 0.653 (0.006) 0.595 (0.001)
YPTB0599 (rob) YPO0456 putative right origin-binding protein 0.588 (0.012)
YPTB0601 (arcA) YPO0458 aerobic respiration control protein 0.465 (0.001)
YPTB0658 (rapA) YPO0517 RNA polymerase associated helicase 0.547 (0.004)
YPTB0712 (pdhR) YPO3420 pyruvate dehydrogenase complex repressoR 0.808 (0.004) 0.695 (< 0.001)
YPTB0776 (rpoS) YPO3355 RNA polymerase sigma factor RpoS 0.559 (0.001)
YPTB0803 (fucR) YPO3327 putative deoR-family regulatory protein 0.435 (< 0.001) 1.521 (0.007)
YPTB0820 YPO3310 putative transcriptional regulatory protein 0.712 (0.022)
YPTB0857 (emrR) YPO3266 MarR-family transcriptional regulatory protein 0.662 (0.029)
YPTB1088 (cspE) YPO2595 putative cold shock protein 0.579 (0.005)
YPTB1258 (rcsB) YPO1218 probable two component response regulator component B 0.693 (0.016)
YPTB1332 (psaE) YPO1301 putative regulatory protein 1.986 (0.001) 0.474 (< 0.001)
YPTB1392 (cspD) YPO1366 cold shock-like protein 0.46 (0.008)
YPTB1423 (cspE) YPO1398 putative cold shock protein 0.579 (0.005)
YPTB1610 (thuR) or1188 putative ThuR. regulatory protein for trehalosemaltose transp... 1.403 (0.025)
YPTB1721 YPO1849 conserved hypothetical (pseudogene. F/S) 1.366 (0.025)
YPTB1967 (hutC) YPO1973 putative GntR-family transcriptional regulatory protein 0.739 (0.018)
YPTB2048 (hexR) YPO2065 hex regulon repressoR 1.51 (0.013)
YPTB2072 (fadR) YPO2144 fatty acid metabolism regulatory protein 1.494 (0.01)
YPTB2177 (araC) YPO2258 arabinose operon regulatory protein 1.591 (0.002)
YPTB2190 (mlc) YPO2268 putative ROK family transcriptional regulatory protein 1.417 (0.037)
YPTB2230 (rstA) YPO2308 two-component regulatory system. response regulator protein 0.658 (0.024)
YPTB2262 (tyrR) YPO2344 transcriptional regulatory protein 0.486 (< 0.001)
YPTB2288 (rovA) YPO2374 MarR-family transcriptional regulatory protein 0.415 (< 0.001)
YPTB2367 (kdgR) YPO1714 IclR-family transcriptional regulatory protein 0.75 (0.029)
YPTB2414 (cspC) or3750 cold shock protein 0.685 (0.014)
YPTB2418 YPO1651 AsnC-family transcriptional regulatory protein 0.435 (< 0.001)
YPTB2534 YPO2498 putative LacI-family transcriptional regulatory protein 2.012 (0.005)
YPTB2737 YPO3017 putative rpiR-family transcriptional regulatory protein 1.601 (0.036)
YPTB2763 (narP) YPO3041 nitrate/nitrite response regulator protein NarP 0.715 (0.043)
YPTB2860 YPO2897 conserved hypothetical protein 1.578 (0.011) 0.632 (0.01)
YPTB2865 YPO2903 putative RNA-binding protein 0.652 (0.035)
YPTB2890 (rnc) YPO2718 ribonuclease III 0.673 (0.013)
YPTB2897 (rpoE) YPO2711 RNA polymerase sigma E factoR 1.827 (< 0.001)
YPTB2939 (ureG) YPO2670 urease accessory protein 0.293 (< 0.001)
YPTB3017 (gcvA) YPO1029 glycine cleavage system transcriptional activatoR 1.634 (0.049)
YPTB3490 YPO3545 lysR-family transcriptional regulatory protein 1.503 (0.036) 1.518 (0.032)
YPTB3514 YPO3570 BolA-like protein 1.315 (0.035)
YPTB3538 (rnk) YPO3695 regulator of nucleoside diphosphate kinase 0.564 (0.016)
YPTB3577 (fiS) or2359 DNA-binding protein Fis 0.611 (0.034) 0.58 (0.02)
YPTB3579 YPO3651 Transcriptional regulator (pseudogene. inframe deletion) 0.675 (0.017)
YPTB3764 (greB) YPO0136 transcription elongation factor 0.69 (0.004)
YPTB3779 (glpR) YPO0120 glycerol-3-phosphate repressor protein 1.398 (0.043)
YPTB3798 (gntR) YPO3955 gluconate utilization system Gnt-I transcriptional repressoR 1.589 (0.042)
YPTB3847 (uhpA) YPO4012 two-component system response regulatoR 2.004 (0.006)
YPTB3887 YPO4034 putative AraC-family transcriptional regulatory protein 1.495 (0.04)
L: DNA replication, recombination and repair
YPTB0046 (radC) YPO0049 putative DNA repair protein 1.544 (0.026) 0.575 (0.006)
YPTB0261 or0185 cytoplasmic Dnase (function similar to TatD) 0.569 (< 0.001)
YPTB0292 YPO3736 conserved hypothetical protein 1.453 (0.017)
YPTB0297 (hupA) YPO3731 DNA-binding protein HU-alpha 0.455 (< 0.001)
YPTB0302 (or0218) or0218 putative transposase 1.478 (0.046) 1.834 (0.004)
YPTB0439 (priB) YPO3538 primosomal replication protein n 0.557 (0.045)
YPTB0498 YPO3475 conserved hypothetical protein 0.554 (0.013)
YPTB0579 YPO0434 putative metalloenzyme 0.64 (0.023)
YPTB0658 (rapA) YPO0517 RNA polymerase associated helicase 0.547 (0.004)
YPTB0913 (rdgC) YPO3212 possible recombination associated protein RdgC 1.82 (0.047)
YPTB0941 (xseB) YPO3175 exodeoxyribonuclease VII small subunit 0.647 (0.044)
YPTB0962 (hupB) YPO3154 DNA-binding protein HU-beta 1.674 (< 0.001) 0.727 (0.015)
YPTB0964 (ybaV) YPO3152 putative exported protein 0.625 (0.02)
YPTB1418 (ihfB) YPO1393 integration host factor beta-subunit 0.46 (0.003)
YPTB1799 or1306 putative modification methylase 1.94 (0.026)
YPTB2040 (ruvA) YPO2057 Holliday junction DNA helicase 1.225 (0.04)
YPTB2140 (topA) YPO2218 DNA topoisomerase I 1.654 (0.012) 0.548 (0.004)
YPTB2221 (ogt) YPO2299 putative methylated-DNA – protein-cysteine methyltransferase 0.611 (0.017)
YPTB2335 (ihfA) YPO2427 integration host factor alpha-subunit 1.626 (0.001) 0.623 (0.001)
YPTB2458 or3720 hypothetical 0.501 (< 0.001)
YPTB2792 YPO3071 conserved hypothetical protein 1.337 (0.026)
YPTB2834 (xseA) YPO2872 exodeoxyribonuclease VII large subunit 0.639 (0.01)
YPTB3389 YPO0674 putative MutT-family protein 1.299 (0.044)
YPTB3577 (fiS) or2359 DNA-binding protein Fis 0.611 (0.034) 0.58 (0.02)
YPTB3757 YPO0144 putative hydrolase 1.58 (0.013)
M: cell envelope biogenesis, outer membrane
YPTB0051 (kdtX) YPO0054 lipopolysaccharide core biosynthesis glycosyl transferase 0.592 (0.001)
YPTB0173 (rffH) YPO3861 glucose-1-phosphate thymidylyltransferase 1.604 (0.028)
YPTB0415 YPO0363 putative membrane transport protein 1.853 (0.003)
YPTB0491 YPO3483 multidrug efflux protein 1.833 (0.032)
YPTB0493 (ibeB) YPO3481 probable outer membrane efflux lipoprotein 1.863 (0.015)
YPTB0694 (lpxC) YPO0561 UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase 0.787 (0.04)
YPTB0775 (nlpD) YPO3356 lipoprotein 1.345 (0.019) 0.732 (0.015)
YPTB0906 YPO3220 conserved hypothetical protein 0.651 (0.038)
YPTB0955 (yajG) YPO3161 putative lipoprotein 1.48 (0.021)
YPTB0987 (kefA) YPO3129 putative potassium efflux system 0.626 (0.001)
YPTB1002 (prt) YPO3112 paratose synthase 0.706 (0.013)
YPTB1008 (wbyK) YPO3104 putative mannosyltransferase 0.527 (0.001) 0.669 (0.03)
YPTB1014 (wzz) YPO3096 O-antigen chain length determinant 0.577 (0.019)
YPTB1109 (cutE) YPO2616 putative apolipoprotein N-acyltransferase 0.669 (0.029)
YPTB1160 (pal) YPO1125 peptidoglycan-associated lipoprotein Pal 1.649 (< 0.001) 0.553 (< 0.001)
YPTB1217 (pbpG) YPO1176 penicillin-binding protein 7 precursoR 0.565 (0.009)
YPTB1261 (ompC) YPO1222 outer membrane protein C. porin 0.284 (< 0.001) 1.371 (0.034)
YPTB1266 (pla2) YPO1231 putative outer membrane-associated protease 0.569 (0.015)
YPTB1309 (spr) YPO1275 putative lipoprotein 0.499 (< 0.001) 0.646 (0.002)
YPTB1381 YPO1355 conserved hypothetical protein 0.683 (0.031)
YPTB1435 YPO1411 putative outer membrane porin C protein (< 0.001)
YPTB1453 (ompA) YPO1435 putative outer membrane porin A protein 0.355 (< 0.001)
YPTB1514 YPO1498 putative exported protein 0.301 (< 0.001)
YPTB1528 (yohK) YPO1513 putative membrane protein 1.513 (0.043)
YPTB1731 YPO1860 attachment invasion locus protein 1.634 (< 0.001)
YPTB1819 or1328 hypothetical phage protein 1.902 (0.025)
YPTB1964 or1419 putative outer membrane porin C protein (< 0.001)
YPTB1975 YPO1982 putative dehydrogenase 0.63 (0.012)
YPTB2081 YPO2155 putative exported protein 0.796 (0.009)
YPTB2113 YPO2190 attachment invasion locus protein precursoR 1.511 (0.012) (< 0.001)
YPTB2117 (tonB) YPO2193 TonB 5.465 (< 0.001)
YPTB2123 (ompW) YPO2201 putative exported protein 0.165 (< 0.001)
YPTB2233 (sepC) YPO2312 insecticidal toxin (pseudogene. inframe insertion) 1.424 (0.045)
YPTB2294 (sepC) YPO2380 insecticidal toxin (pseudogene. inframe insertion) 1.424 (0.045)
YPTB2323 (nlpC) YPO2415 putative lipoprotein 1.388 (0.025)
YPTB2979 (cutF) YPO1067 putative copper homeostasis lipoprotein 1.794 (0.001)
YPTB2994 (ompH) YPO1053 cationic 19 kDa outer membrane protein precursoR 1.69 (< 0.001) 0.538 (< 0.001)
YPTB2995 YPO1052 putative surface antigen 0.745 (0.016)
YPTB2996 YPO1051 putative membrane protein 1.531 (0.03)
YPTB3194 YPO0919 putative membrane protein 1.569 (0.024)
YPTB3277 or3091 Conserved hypothetical protein 1.57 (0.026)
YPTB3282 or3086 Conserved hypothetical protein (partial. c-term) 1.529 (0.025)
YPTB3285 or3082 Putative autotransporter secreted protein 1.593 (0.028)
YPTB3313 (slyB) YPO0752 putative lipoprotein 1.452 (0.003)
YPTB3407 (rfaE) YPO0654 ADP-heptose synthase 0.709 (0.042)
YPTB3438 YPO0617 putative membrane protein 1.993 (0.004)
YPTB3497 (mtgA) YPO3552 monofunctional biosynthetic peptidoglycan transglycosylase 1.736 (0.008)
YPTB3513 (murA) YPO3569 UDP-N-acetylglucosamine1-carboxyvinyltransferase 0.775 (0.034)
YPTB3717 YPO0187 putative glycosyl transferase 0.657 (0.013)
YPTB3958 YPO4112 putative membrane protein 1.69 (0.004)
YPTB3965 (glmU) YPO4119 UDP-N-acetylglucosamine pyrophosphorylase 1.572 (0.042)
N: cell motility and secretion
YPTB0071 (cpxP) YPO0075 putative exported protein 0.337 (< 0.001)
YPTB0156 YPO3881 putative chaperone protein 0.657 (0.01)
YPTB0158 YPO3879 putative outer membrane usher protein 1.626 (0.016)
YPTB0359 YPO0302 putative outer membrane fimbrial usher protein 1.398 (0.049)
YPTB0706 (hofB) YPO3426 putative type II secretion system protein 0.711 (0.043)
YPTB1335 (psaB) YPO1304 chaperone protein PsaB precursoR 0.216 (< 0.001)
YPTB1680 (flgJ) YPO1807 flagellar protein FlgJ 1.906 (0.01)
YPTB1681 (flgK) YPO1808 flagellar hook-associated protein 1 0.616 (0.01) 0.682 (0.034)
YPTB1682 (flgL) YPO1809 flagellar hook-associated protein 3 1.514 (0.041)
YPTB1693 YPO1820A 2.053 (0.011)
YPTB1695 (fliN) YPO1822 flagellar motor switch protein FliN 1.79 (0.021)
YPTB1698 (fliK) YPO1825 flagellar hook-length control protein FliK 1.941 (0.006)
YPTB1919 YPO1920 probable fimbrial usher protein 1.461 (0.019)
YPTB2396 (cheZ) YPO1681 chemotaxis protein CheZ 1.477 (0.027)
YPTB2405 (cheA) YPO1666 chemotaxis protein CheA 1.725 (0.015)
YPTB2843 YPO2881 putative fimbrial biogenesis protein 0.686 (0.022)
YPTB3347 (fliG) YPO0715 puative flagellar motor switch protein 1.68 (0.03) 1.722 (0.024)
YPTB3357 YPO0704 flagellar assembly protein 0.611 (0.049)
YPTB3896 YPTB3896 fimbrial protein 1.644 (0.021)
No COG
YPTB0092 YPO0100 hypothetical protein 1.623 (0.025) 0.434 (< 0.001)
YPTB0094 YPO0102 putative exported protein 0.503 (< 0.001)
YPTB0123 (yijD) YPO3912 putative membrane protein 0.669 (0.033)
YPTB0139 YPO3895 putative membrane protein 0.717 (0.036)
YPTB0141 YPTB0141 putative membrane protein 1.774 (0.026)
YPTB0148 or0096 colicin (pseudogene. partial) 1.493 (0.013)
YPTB0149 or0097 putative colicin immunity protein 1.605 (0.045)
YPTB0151 (imm2) or0099 pyocin S2 immunity protein 1.549 (0.013) 0.486 (< 0.001)
YPTB0212 (dcrB) YPO3823 putative lipoprotein 0.758 (0.028)
YPTB0237 or5000 putative exported protein 1.357 (0.048)
YPTB0244 or0169 hypothetical 0.517 (< 0.001)
YPTB0362 YPO0306 conserved hypothetical protein (pseudogene. F/S) 0.66 (0.036)
YPTB0391 YPO0337 putative exported protein 0.527 (< 0.001)
YPTB0406 YPO0352 putative lipoprotein 1.294 (0.042)
YPTB0449 YPO3527 conserved hypothetical protein 2 (< 0.001)
YPTB0499 YPO3474 hypothetical protein 1.509 (0.036)
YPTB0505 YPO3468 hypothetical protein 1.632 (0.026)
YPTB0546 YPO0406 putative exported protein 2.397 (< 0.001)
YPTB0560 or0394 hypothetical protein 1.636 (0.028) 0.271 (< 0.001)
YPTB0593 YPO0450 putative membrane protein 0.736 (0.025) 1.464 (0.007)
YPTB0651 YPO0511 hypothetical protein 0.576 (0.02)
YPTB0657 YPO0516 hypothetical protein 0.457 (0.001)
YPTB0666 or4788 putative IS1400 transposase B 2.101 (< 0.001)
YPTB0678 YPO0544 putative membrane protein 0.631 (0.009)
YPTB0768 (ygbE) YPO3363 putative membrane protein 1.735 (0.007)
YPTB0793 YPO3339 hypothetical protein 1.679 (0.023) 1.94 (0.005)
YPTB0795 YPO3336 conserved hypothetical protein 3 (< 0.001)
YPTB0903 (crl) YPO3223 curlin genes regulatory protein 2.098 (< 0.001)
YPTB0957 YPO3159 hypothetical protein 1.521 (0.034)
YPTB0978 (ymoA) YPO3138 modulating protein YmoA (histone-like protein) 0.509 (< 0.001)
YPTB0979 YPO3137 conserved hypothetical protein 0.469 (< 0.001)
YPTB0980 YPO3136 hypothetical protein 0.587 (0.01)
YPTB1004 (wzx) or0734 putative O-unit flippase 0.642 (0.007)
YPTB1018 (ushB) or0747 5'-nucleotidase/UDP-sugar diphosphatase 1.34 (0.031)
YPTB1041 YPO2820 hypothetical protein 1.394 (0.029)
YPTB1042 (int) or4598 phage integrase (pseudogene. Partial) 1.483 (0.046)
YPTB1043 or0754 hypothetical 0.569 (0.002)
YPTB1130 (trp1400A) or4531 IS1400 transposase A 2.136 (< 0.001)
YPTB1167 (psiF) YPO1134 putative starvation-inducible protein 2.04 (0.014)
YPTB1202 (xapB) YPO1172 xanthosine permease (pseudogene. IS1541) 1.381 (0.03) 1.499 (0.009)
YPTB1220 YPO1179 conserved hypothetical protein 0.702 (0.038)
YPTB1287 or0929 putative bacteriophage tail fiber protein 1.853 (0.01)
YPTB1291 YPO1255 hypothetical protein 0.361 (< 0.001)
YPTB1303 YPO1269 conserved hypothetical protein 1.754 (0.008)
YPTB1334 (psaA) YPO1303 pH 6 antigen precursor (antigen 4) (adhesin) (< 0.001)
YPTB1359 YPO1328 putative membrane protein 1.723 (0.003)
YPTB1515 YPO1499 putative membrane protein 1.521 (0.045)
YPTB1543 (ysuH) YPO1531 putative siderophore biosynthetic enzyme 1.896 (0.02)
YPTB1583 YPO1574 putative exported protein 0.605 (< 0.001)
YPTB1602 (int) or4274 integrase 0.592 (0.026)
YPTB1616 or1193 conserved hypothetical protein 0.677 (0.016) 1.488 (0.014)
YPTB1619 YPO1741 hypothetical protein 1.496 (0.025)
YPTB1622 YPO1744 putative exported protein 1.671 (0.019)
YPTB1663 YPO1788 putative acyl carrier protein 1.57 (0.049)
YPTB1664 YPO1789 putative membrane protein 1.638 (0.031)
YPTB1668 (invA) or1234 putative invasin 0.5 (< 0.001) 0.397 (< 0.001)
YPTB1705 YPTB1705 putative phage minor tail protein 1.794 (0.002)
YPTB1722 YPO1850 hypothetical protein 1.593 (0.045)
YPTB1734 YPO1864 conserved hypothetical protein 0.679 (0.003)
YPTB1752 or4178 O protein [Enterobacteria phage 186] gb|AAC34159.1| (U32222)... 0.49 (0.01)
YPTB1785 or4145 hypothetical protein 0.453 (< 0.001)
YPTB1786 or4144 hypothetical protein 1.605 (0.042)
YPTB1798 (yfdM) or1305 conserved hypothetical protein 1.506 (0.043)
YPTB1801 or1309 hypothetical protein 0.279 (< 0.001)
YPTB1802 or1310 hypothetical protein 0.449 (0.01)
YPTB1815 or1324 putative phage protein 1.57 (0.037)
YPTB1821 YPTB1821 putative acyl carrier protein 1.57 (0.049)
YPTB1822 or4135 putative membrane protein 1.638 (0.031)
YPTB1826 or1333 bacteriophage hypothetical protein 1.754 (0.04)
YPTB1850 or4114 gpR [Enterobacteria phage P2] sp|P36933|VPR_BPP2 tAIL COMPLE... 1.779 (0.024)
YPTB1858 or4106 similar to V protein phage 186 1.743 (0.024)
YPTB1862 or4102 putative phage replication protein 0.536 (0.011)
YPTB1884 or1358 possible MFS Superfamliy multidrug-efflux transporter (< 0.001)
YPTB1887 or1361 hypothetical protein (< 0.001)
YPTB1893 YPO1874 conserved hypothetical protein 1.593 (0.034)
YPTB1980 YPO1987 hypothetical protein (pseudogene. IS285) 1.485 (0.047)
YPTB1986 YPO1994 hypothetical protein 0.649 (0.039)
YPTB1987 YPO1995 hypothetical protein 0.57 (0.047)
YPTB1996 YPO2004 putative membrane protein 2.041 (0.002)
YPTB2000 YPO2012 putative membrane protein 0.256 (< 0.001)
YPTB2092 YPO2166 putative exported protein 0.671 (0.027)
YPTB2114 YPO2191 hypothetical protein 0.28 (< 0.001)
YPTB2148 YPO2226 hypothetical protein 1.855 (0.007)
YPTB2151 (osmB) YPO2229 osmotically inducible lipoprotein B precursoR 2.229 (< 0.001) 1.413 (0.032)
YPTB2219 YPO2297 hypothetical protein 1.576 (0.031)
YPTB2227 YPO2305 putative exported protein 1.37 (0.015) 0.774 (0.042)
YPTB2229 YPO2307 conserved hypothetical protein 0.708 (0.026)
YPTB2237 (asr) YPO2318 putative acid shock protein 0.654 (0.022)
YPTB2269 (pspB) YPO2350 phage shock protein B 1.983 (0.018)
YPTB2334 YPO2426 putative exported protein 1.628 (0.015)
YPTB2353 (yfeE) YPO2445 putative yfeABCD locus regulatoR 1.526 (0.008)
YPTB2358 (pelY) YPO1723 periplasmic pectate lyase precursoR 2.081 (0.001)
YPTB2363 YPO1718 putative exported protein 1.804 (0.038)
YPTB2387 YPO1694 conserved hypothetical protein 1.794 (0.008)
YPTB2393 YPO1686 putative exported protein 1.442 (0.019)
YPTB2417 (ylaC) YPO1652 putative membrane protein 1.559 (0.003)
YPTB2419 YPO1650 hypothetical protein 0.6 (0.026)
YPTB2420 YPO1649 conserved hypothetical protein 1.758 (0.004) 2.658 (< 0.001)
YPTB2421 YPO1648 probable histidine acid phosphatase 1.474 (0.045)
YPTB2425 YPO1643 hypothetical protein 1.662 (0.01)
YPTB2446 YPO1619 hypothetical protein 1.504 (0.019)
YPTB2483 (dinI) YPO1586 DNA-damage-inducible protein I 1.646 (0.006)
YPTB2495 or1732 glucans biosynthesis protein (pseudogene. deletions) 1.503 (0.024)
YPTB2496 or1737 hypothetical 0.433 (0.001)
YPTB2540 or3654 conserved hypothetical protein 2.145 (0.008)
YPTB2552 YPO2515 hypothetical 1.46 (0.023) 1.396 (0.042)
YPTB2554 YPO2521 putative exported protein 0.648 (0.044)
YPTB2562 YPO2530 conserved hypothetical protein 0.527 (0.026)
YPTB2623 (flk) YPO2760 putative flagellar assembly regulatory protein. flk 0.549 (0.008)
YPTB2699 YPO2976 conserved hypothetical protein 4.448 (< 0.001) 1.458 (0.016)
YPTB2704 YPO2981 putative exported protein 1.628 (0.015)
YPTB2744 (yfeY) YPO3026 putative lipoprotein 1.604 (0.019)
YPTB2753 YPO3031 putative acetyltransferase 1.391 (0.02)
YPTB2750 or3477 hypothetical 0.688 (0.006)
YPTB2787 YPO3066 hypothetical protein 1.504 (0.019)
YPTB2822 YPO2857 putative exported protein 1.718 (0.031)
YPTB2877 YPO2918 putative exported protein 0.542 (0.024)
YPTB2893 YPO2715 putative membrane protein 1.565 (0.011)
YPTB2922 or3339 hypothetical 1.886 (0.001)
YPTB2935 YPO2674 putative exported protein (< 0.001)
YPTB2951 YPO2657 putative mobilization protein 0.566 (< 0.001)
YPTB2953 YPO2653 conserved hypothetical protein 0.639 (0.027)
YPTB2954 (asr) YPO2652 putative acid shock protein 1.815 (0.033)
YPTB3007 YPO1040 conserved hypothetical protein 0.728 (0.024) 0.73 (0.025)
YPTB3039 YPO0791 hypothetical protein 0.545 (0.007)
YPTB3041 (ygeD) YPO0792 putative membrane protein 0.617 (0.015)
YPTB3071 YPO0822 putative exported protein 0.51 (0.002)
YPTB3111 YPO0867 putative membrane protein 0.675 (0.027)
YPTB3177 YPO0901 putative exported protein 1.442 (0.019)
YPTB3179 YPO0904 hypothetical protein 1.708 (0.002)
YPTB3220 YPO0948 conserved hypothetical protein 1.56 (0.021)
YPTB3256 (insA) or3105 insertion element protein 1.939 (< 0.001)
YPTB3257 YPO0983 putative lipoprotein 2.06 (0.001)
YPTB3280 or3088 Hypothetical 0.606 (0.009)
YPTB3305 YPO1002 hypothetical protein 1.679 (0.023) 1.94 (0.005)
YPTB3342 YPO0720 putative flagellar regulatory protein 1.492 (0.007)
YPTB3343 YPO0719 hypothetical protein 1.563 (0.038)
YPTB3371 YPO0694 Putative membrane protein (pseudogene. inframe deletion) 0.653 (0.049)
YPTB3421 YPO0640 hypothetical protein 0.716 (0.028)
YPTB3454 or2954 Fragment of hemagglutinin/hemolysin-related protein 0.653 (0.025)
YPTB3458 or2950 hypothetical 1.92 (0.005)
YPTB3504 YPO3559 putative exported protein 0.483 (< 0.001)
YPTB3534 YPO3699 putative exported protein 0.676 (0.038)
YPTB3551 YPO3681 Insecticidal toxin TcaA 0.619 (0.047)
YPTB3556 YPO3675 putative exported protein 0.637 (0.043)
YPTB3627 YPO3601 conserved hypothetical protein 0.595 (0.006)
YPTB3641 (malM) YPO3710 maltose operon periplasmic protein 0.379 (< 0.001)
YPTB3769 (feoC) YPO0131 ferrous iron transport protein C 1.899 (< 0.001)
YPTB3770 YPO0130 putative exported protein 0.43 (< 0.001)
YPTB3781 YPO3935 putative membrane protein 0.717 (0.036)
YPTB3789 or2712 putative invasin 0.614 (0.01)
YPTB3811 (uspB) YPO3969 universal stress protein B 0.665 (0.04)
YPTB3834 (pelY) YPO3994 periplasmic pectate lyase precursoR 2.081 (0.001)
YPTB3835 YPO3995 putative exported protein 1.804 (0.038)
YPTB3855 YPO4020 putative membrane protein 0.422 (< 0.001)
YPTB3893 YPO4040 putative exported protein 0.487 (< 0.001)
YPTB3908 YPO4081 putative membrane protein 1.408 (0.01)
YPTB3917 (yiaF) YPO4070 putative exported protein 1.554 (0.016) 0.701 (0.047)
YPTB3922 YPO4064 hypothetical protein 1.409 (0.046)
YPTB3923 YPO4063 putative membrane protein 1.53 (0.041)
YPTB3944 or2545 hypothetical protein_ 0.593 (0.016)
O: posttranslational modification, protein turnover, chaperones
YPTB0404 (groES) YPO0350 10 kDa chaperonin 0.683 (0.029) 1.445 (0.035)
YPTB0427 (hflK) YPO0375 putative membrane protein (pseudogene. inframe deletion) 0.619 (0.033)
YPTB0494 YPO3480 conserved hypothetical protein 0.444 (< 0.001)
YPTB0495 YPO3479 putative protease 0.328 (< 0.001)
YPTB0518 (nrdG) YPO3455 anaerobic ribonucleoside-triphosphate reductase Activating protein 0.439 (0.001)
YPTB0612 (dnaK) YPO0469 chaperone protein DnaK 0.73 (0.049) 0.693 (0.025)
YPTB0647 (clpB) YPO0506 putative Clp ATPase 1.481 (0.047) 0.402 (< 0.001)
YPTB0774 (pcm) YPO3357 protein-L-isoaspartate O-methyltransferase 0.62 (0.014)
YPTB0925 (ahpC) YPO3194 putative alkyl hydroperoxide reductase subunit c 0.545 (< 0.001)
YPTB0948 (cyoE) YPO3168 protoheme IX farnesyltransferase 1.422 (0.039)
YPTB0958 (tig) YPO3158 Trigger factoR 0.607 (0.008)
YPTB0995 (htpG) YPO3119 heat shock protein HtpG 0.569 (0.004)
YPTB1025 YPO3083 conserved hypothetical protein 0.66 (0.014)
YPTB1026 (ybbN) YPO3082 putative thioredoxin 0.715 (0.019)
YPTB1034 (ppiB) YPO3074 peptidyl-prolyl cis-trans isomerase B 1.419 (0.013)
YPTB1141 YPO1107 heat shock protein GrpE 1.442 (0.048)
YPTB1406 (pflA) YPO1381 pyruvate formate-lyase 1 activating enzyme 0.578 (0.004)
YPTB1871 or1348 similar to hypothetical bacteriophage P27 protein 0.58 (0.001)
YPTB1945 YPO1947 putative thioredoxin 1.646 (0.002)
YPTB2070 (dsbB) YPO2141 disulfide bond formation protein B 1.636 (< 0.001) 0.757 (0.023)
YPTB2084 YPO2158 conserved hypothetical protein 0.683 (0.003)
YPTB2261 (tpx) YPO2342 thiol peroxidase 2.414 (< 0.001) 0.527 (< 0.001)
YPTB2297 YPO2383 conserved hypothetical protein 0.741 (0.025)
YPTB2311 YPO2401 conserved hypothetical protein 1.822 (0.001)
YPTB2312 YPO2402 putative ATP-dependent transporteR 2.036 (0.006)
YPTB2313 YPO2403 conserved hypothetical protein 2.213 (0.002)
YPTB2734 (cysT) YPO3014 sulfate transport system permease protein CysT 0.714 (0.029)
YPTB2785 (bcp) YPO3064 bacterioferritin comigratory protein 1.417 (0.033)
YPTB2806 YPO2840 putative heat shock protein 0.674 (0.027)
YPTB2905 (pcp) YPO2703 putative pyrrolidone-carboxylate peptidase 1.608 (0.016)
YPTB2938 (ureD) YPO2671 urease accessory protein 0.377 (< 0.001)
YPTB2939 (ureG) YPO2670 urease accessory protein 0.293 (< 0.001)
YPTB2940 (ureF) YPO2669 urease accessory protein 0.268 (< 0.001)
YPTB2941 (ureE) YPO2668 urease accessory protein 0.347 (< 0.001)
YPTB3408 (glnE) YPO0653 glutamate-ammonia-ligase adenylyltransferase 1.792 (0.046)
YPTB3415 (gcp) YPO0646 putative glycoprotease 0.568 (0.009)
YPTB3710 (fkpA) YPO0195 peptidyl-prolyl cis-trans isomerase 0.571 (0.007)
YPTB3728 YPO0176 conserved hypothetical protein 1.988 (0.002)
YPTB3734 (ppiA) YPO0167 peptidyl-prolyl cis-trans isomerase A 0.757 (0.015) 0.61 (< 0.001)
YPTB3930 (fdhE) YPO4055 putative formate dehydrogenase formation protein 0.556 (< 0.001) 0.798 (0.031)
P: inorganic ion transport and metabolism
YPTB0071 (cpxP) YPO0075 putative exported protein 0.337 (< 0.001)
YPTB0270 (trkH) YPO3762 Trk system potassium uptake protein TrkH 0.634 (0.018)
YPTB0336 (hmuV) YPO0279 hemin transport system ATP-binding protein 1.666 (0.003) 0.652 (0.01)
YPTB0338 (hmuT) YPO0281 hemin-binding periplasmic protein 1.684 (0.015) 0.605 (0.019)
YPTB0339 (hmuS) YPO0282 hemin transport protein 1.577 (0.021) 0.666 (0.038)
YPTB0340 (hmuR) YPO0283 hemin receptor precursoR 7.426 (< 0.001)
YPTB0343 YPO0285 conserved hypothetical protein 1.774 (0.009)
YPTB0354 (terB) YPO0296 tellurite resistance protein 0.504 (0.002)
YPTB0371 YPO0315 putative regulatory protein 0.409 (< 0.001)
YPTB0516 (phnG) YPO3457 PhnG protein 1.713 (0.016)
YPTB0521 YPO3452 putative ABC transporter transporter. ATP-binding protein 1.679 (0.029)
YPTB0594 YPO0451 putative cation-transporting P-type ATPase 0.653 (0.046)
YPTB0662 (thiP) YPO0521 thiamine transport system permease protein 1.973 (0.003) 1.574 (0.035)
YPTB0739 (fhuC) YPO3392 ferrichrome transport ATP-binding protein FhuC 1.932 (0.046)
YPTB0740 (fhuD) YPO3391 ferrichrome-binding periplasmic protein precursoR 1.835 (0.021)
YPTB0790 (yhjA) YPO3342 putative cytochrome C peroxidase 0.479 (< 0.001)
YPTB0811 (katY) YPO3319 catalase-peroxidase 0.602 (0.008) 2.344 (< 0.001)
YPTB0986 YPO3130 conserved hypothetical protein 1.749 (0.003)
YPTB1246 (katA) YPO1207 catalase 0.324 (< 0.001)
YPTB1341 YPO1310 putative periplasmic substrate-binding transport protein 3.085 (< 0.001)
YPTB1343 (yiuC) YPO1312 putative siderophore ABC transporter. ATP-binding subunit 2.467 (< 0.001)
YPTB1409 (focA) YPO1384 putative formate transporter 1 0.563 (0.005) 1.638 (0.013)
YPTB1549 (ysuR) YPO1537 putative iron-siderophore receptoR 2.609 (< 0.001) 0.669 (0.039)
YPTB1659 (ftnA) YPO1783 ferritin 0.18 (< 0.001)
YPTB1725 YPO1854 putative membrane protein 2.084 (0.013)
YPTB1939 YPO1941 putative membrane protein 0.549 (< 0.001)
YPTB1940 YPO1942 putative exported protein 1.776 (0.003)
YPTB1947 (tehB) YPO1949 putative tellurite resistance protein 1.722 (0.025)
YPTB2044 (znuA) YPO2061 exported high-affinity zinc uptake system protein 1.693 (0.009)
YPTB2052 YPO2069 putative integral membrane protein 1.506 (0.041)
YPTB2108 (oppD) YPO2185 oligopeptide transport ATP-binding protein (< 0.001)
YPTB2299 (sodB) YPO2386 superoxide dismutase [Fe] (< 0.001)
YPTB2347 (yfeA) YPO2439 periplasmic-binding protein 11.88 (< 0.001)
YPTB2348 (yfeB) YPO2440 ATP-binding transport protein 3.141 (< 0.001)
YPTB2349 (yfeC) YPO2441 chelated iron transport system membrane protein 4.375 (< 0.001)
YPTB2350 (yfeD) YPO2442 chelated iron transport system membrane protein 2.104 (< 0.001)
YPTB2546 (dps) YPO2509 putative DNA-binding protein 0.566 (< 0.001)
YPTB2682 (yfuA) YPO2958 iron(III)-binding periplasmic protein 2.387 (< 0.001)
YPTB2743 YPO3025 conserved hypothetical protein 1.598 (0.049)
YPTB2769 (ydeN) YPO3047 putative sulfatase 0.382 (< 0.001)
YPTB2771 YPO3049 putative binding protein-dependent transport system. inner-membrane comp 0.592 (0.026)
YPTB2803 (ppx) YPO2837 putative exopolyphosphatase 0.564 (< 0.001)
YPTB2934 YPO2675 putative potassium channel protein 0.236 (< 0.001)
YPTB2936 YPO2673 putative nickel transport protein 0.398 (< 0.001)
YPTB2974 YPO1072 ABC transporter permease protein 1.328 (0.027)
YPTB2979 (cutF) YPO1067 putative copper homeostasis lipoprotein 1.794 (0.001)
YPTB3068 YPO0819 putative carbonic anhydrase 0.344 (< 0.001)
YPTB3074 YPO0829 putative sulfatase 1.622 (0.023)
YPTB3227 YPO0955 putative periplasmic substrate-binding transport protein 3.085 (< 0.001)
YPTB3298 YPO1011 putative TonB-dependent outer membrane receptoR 2.15 (0.004) 0.554 (0.022)
YPTB3605 (ssuA) YPO3624 aliphatic sulfonates binding protein (pseudogene. insertion) 1.534 (0.048)
YPTB3700 (bfr) YPO0206 bacterioferritin 0.66 (0.003)
YPTB3701 (bfd) or2776 putative bacterioferritin-associated ferredoxin 1.856 (0.002)
YPTB3706 YPO0199 conserved hypothetical protein 1.467 (0.009)
YPTB3737 YPO0164 putative membrane receptor protein (pseudogene. inframe insertion) 0.568 (0.001)
YPTB3767 (feoA) YPO0133 hypothetical ferrous iron transport protein A 1.509 (0.045) 0.624 (0.025)
YPTB3857 YPO4022 putative iron transport protein 3.127 (< 0.001)
YPTB3858 YPO4023 putative iron transport permease 2.236 (< 0.001)
YPTB3860 YPO4025 putative iron ABC transporter. ATP-binding protein 2.216 (< 0.001)
YPTB3925 (sodA) YPO4061 superoxide dismutase [Mn] 3.101 (< 0.001) 0.613 (0.017)
YPTB3963 (pstS) YPO4117 putative phosphate-binding periplasmic protein 1.741 (< 0.001)
Q: secondary metabolite biosynthesis, transport and catabolism
YPTB1030 (ybbP) YPO3078 putative permease 1.661 (0.022) 1.756 (0.012)
YPTB1480 YPO1462 putative acyl carrier protein 1.669 (0.048)
YPTB1544 (ysuG) YPO1532 putative siderophore biosynthetic enzyme 2.403 (0.005)
YPTB1550 YPO1538 putative siderophore biosynthetic enzyme 8.255 (< 0.001) 0.649 (0.048)
YPTB1596 (irp2) YPO1911 yersiniabactin biosynthetic protein 1.526 (0.029)
YPTB1966 (hutI) YPO1972 imidazolonepropionase 0.632 (0.004)
YPTB2064 YPO2082 putative fumarylacetoacetate hydrolase family protein 0.73 (0.018)
YPTB2470 (acpP) YPO1600 acyl carrier protein 0.661 (0.002)
YPTB2471 (fabG) YPO1599 3-oxoacyl-[acyl-carrier protein] reductase 0.573 (0.002)
YPTB2561 (menF) YPO2528 menaquinone-specific isochorismate synthase 0.522 (0.011)
YPTB2626 (fabB) YPO2757 3-oxoacyl-[acyl-carrier-protein] synthase I 0.605 (0.009)
YPTB3258 (yspI) YPO0984 N-acylhomoserine lactone synthase YspI 0.494 (0.032)
YPTB3263 (iucA) YPO0989 aerobactin synthetase (subunit alpha) 3.789 (< 0.001)
YPTB3265 (iucC) YPO0992 aerobactin synthetase (subunit beta) 2.601 (< 0.001)
YPTB3266 (iucD) YPO0993 putative siderophore biosynthesis protein IucD 2.151 (0.002)
YPTB3297 YPO0777 putative peptide/polyketide synthase subunit 2.142 (< 0.001)
R: general function prediction only
YPTB0026 YPO0027 conserved hypothetical protein 0.616 (0.018)
YPTB0057 (tdh) YPO0060 threonine 3-dehydrogenase 0.663 (0.041)
YPTB0063 (secB) YPO0067 protein-export protein 0.683 (0.012)
YPTB0071 (cpxP) YPO0075 putative exported protein 0.337 (< 0.001)
YPTB0156 YPO3881 putative chaperone protein 0.657 (0.01)
YPTB0158 YPO3879 putative outer membrane usher protein 1.626 (0.016)
YPTB0221 (ftsY) YPO3814 cell division protein (pseudogene. inframe deletion) 0.71 (0.035)
YPTB0257 (aarF) YPO3779 ubiquinone biosynthesis protein 0.68 (0.048)
YPTB0258 (tatA) YPO3778 Sec-independent protein translocase protein tatA 0.685 (0.003)
YPTB0327 YPO0270 putative type III secretion apparatus protein 0.658 (0.014)
YPTB0331 YPO0274 putative integral membrane protein 2.083 (< 0.001)
YPTB0353 (terA) YPO0295 putative tellurite resistance protein 0.565 (< 0.001)
YPTB0359 YPO0302 putative outer membrane fimbrial usher protein 1.398 (0.049)
YPTB0374 (qor) YPO0319 quinone oxidoreductase 1.393 (0.04)
YPTB0448 YPO3528 putative exported protein 0.451 (< 0.001)
YPTB0466 YPO3510 putative membrane protein 1.768 (0.019)
YPTB0493 (ibeB) YPO3481 probable outer membrane efflux lipoprotein 1.863 (0.015)
YPTB0576 (osmY) YPO0431 osmotically inducible protein Y 3.79 (< 0.001) 0.421 (0.001)
YPTB0706 (hofB) YPO3426 putative type II secretion system protein 0.711 (0.043)
YPTB0808 YPO3322 conserved hypothetical protein 0.555 (0.031)
YPTB0832 (corE) YPO3297 putative membrane protein 1.401 (0.011)
YPTB0839 (dcuB) YPO3288 anaerobic C4-dicarboxylate transporter (pseudogene. F/S) 0.442 (0.001)
YPTB0878 or0629 5-methylthioribose kinase 1.955 (0.029)
YPTB0929 (yajC) YPO3190 putative membrane protein 1.526 (0.047)
YPTB0965 YPO3151 conserved hypothetical protein 1.553 (0.047)
YPTB1061 (yapC) YPO2796 putaive autotransporter protein 1.82 (0.003)
YPTB1111 YPO2618 conserved hypothetical protein 0.577 (0.001)
YPTB1155 YPO1120 conserved hypothetical protein 1.404 (0.003)
YPTB1159 (tolB) YPO1124 TolB colicin import protein 1.46 (0.025)
YPTB1194 YPO1163 putative membrane protein 0.678 (< 0.001)
YPTB1210 or4494 possible ABC transporter multidrug efflux pump. permease subunit 0.669 (0.03)
YPTB1321 YPO1289 conserved hypothetical protein 1.662 (0.026)
YPTB1335 (psaB) YPO1304 chaperone protein PsaB precursoR 0.216 (< 0.001)
YPTB1512 YPO1496 putative heme-binding protein 2.456 (< 0.001)
YPTB1513 YPO1497 ABC transporter ATP-binding protein 1.878 (0.009) 0.453 (0.001)
YPTB1540 (ysuF) YPO1528 putative ferric iron reductase 4.019 (< 0.001)
YPTB1646 (hpaC) YPO1770 4-hydroxyphenylacetate 3-monooxygenase coupling protein 1.613 (0.023)
YPTB1660 YPO1784 putative copper resistance protein 3.934 (< 0.001) 0.703 (0.017)
YPTB1680 (flgJ) YPO1807 flagellar protein FlgJ 1.906 (0.01)
YPTB1693 YPO1820A 2.053 (0.011)
YPTB1695 (fliN) YPO1822 flagellar motor switch protein FliN 1.79 (0.021)
YPTB1728 (wrbA) YPO1857 trp repressor binding protein 1.401 (0.006)
YPTB1733 (ydgC) YPO1863 putative membrane protein 0.626 (0.001)
YPTB1919 YPO1920 probable fimbrial usher protein 1.461 (0.019)
YPTB1944 YPO1946 ABC transporter. ATP-binding protein 1.957 (0.003) 1.588 (0.03)
YPTB1985 YPO1993 putative dehydrogenase 1.586 (0.007)
YPTB2019 YPO2037 conserved hypothetical protein 1.56 (0.021)
YPTB2101 (hns) YPO2175 Hns DNA binding protein 0.405 (0.001)
YPTB2169 or1554 putative toxin transport protein (pseudogene. F/S) 1.549 (0.027)
YPTB2289 YPO2375 putative aldo/keto reductase 1.508 (0.006)
YPTB2291 YPO2377 putative membrane protein 0.607 (0.018) 1.529 (0.038)
YPTB2345 (marC) YPO2437 multiple antibiotic resistance protein 1.771 (0.022)
YPTB2368 (ogl) YPO1713 oligogalacturonate lyase 0.699 (0.045)
YPTB2390 YPO1689 putative lipoprotein 1.312 (0.032)
YPTB2452 (ycfL) YPO1612 putative lipoprotein 1.45 (0.046)
YPTB2459 or3719 hypothetical 0.379 (< 0.001)
YPTB2471 (fabG) YPO1599 3-oxoacyl-[acyl-carrier protein] reductase 0.573 (0.002)
YPTB2488 YPO2451 conserved hypothetical protein 0.671 (0.026)
YPTB2492 or3693 conserved hypothetical protein 0.602 (0.009)
YPTB2553 or3647 conserved hypothetical protein 0.573 (0.006)
YPTB2604 or3598 conserved hypothetical (pseudogene. F/S) 1.86 (0.004)
YPTB2646 (ccmD) or3557 putative heme exporter protein D 0.36 (< 0.001)
YPTB2722 YPO3001 putative pyridine nucleotide-disulphide oxidoreductase 1.897 (0.04)
YPTB2723 YPO3002 putative permease 1.328 (0.036)
YPTB2727 YPO3007 putative membrane protein 1.932 (0.008)
YPTB2753 YPO3031 putative acetyltransferase 1.391 (0.02)
YPTB2837 (engA) YPO2875 putative GTP-binding protein 0.573 (0.015)
YPTB2843 YPO2881 putative fimbrial biogenesis protein 0.686 (0.022)
YPTB2891 (lepB) YPO2717 signal peptidase I 1.527 (0.032) 1.518 (0.035)
YPTB2902 YPO2706 conserved hypothetical protein 0.549 (0.026) 1.898 (0.018)
YPTB3116 or3203 hypothetical protein 0.556 (0.022)
YPTB3176 YPO0900 putative hemolysin III 1.415 (0.038)
YPTB3223 YPO0951 Putative methyltransferase 0.612 (0.023)
YPTB3238 YPO0966 putative kinase 0.505 (0.032)
YPTB3285 or3082 Putative autotransporter secreted protein 1.593 (0.028)
YPTB3291 YPO0771 ABC-transporter transmembrane protein 1.705 (0.014)
YPTB3357 YPO0704 flagellar assembly protein 0.611 (0.049)
YPTB3381 YPO0684 putative membrane protein 1.67 (0.014)
YPTB3382 (exbD) YPO0683 ExbD/TolR-family transport protein 9.812 (< 0.001)
YPTB3383 (exbB) YPO0682 MotA/TolQ/ExbB proton channel family protein 4.164 (< 0.001)
YPTB3388 YPO0676 putative aldo/keto reductase family protein 1.632 (0.042)
YPTB3438 YPO0617 putative membrane protein 1.993 (0.004)
YPTB3464 YPO0595 conserved hypothetical protein 0.528 (0.005)
YPTB3493 YPO3548 putative exported protein 0.602 (0.005)
YPTB3496 YPO3551 putative exported protein 0.553 (< 0.001)
YPTB3558 (tldD) YPO3672 putative modulator of DNA gyrase 0.702 (0.025)
YPTB3568 YPO3662 conserved hypothetical protein 1.489 (0.008)
YPTB3659 YPO0247 putative transferase 1.289 (0.029)
YPTB3745 (gph) YPO0156 phosphoglycolate phosphatase 0.596 (0.022)
YPTB3757 YPO0144 putative hydrolase 1.58 (0.013)
YPTB3879 or2640 possible type I restriction enzyme (restriction subunit) 1.554 (0.044)
YPTB3896 YPO4044 fimbrial protein 1.644 (0.021)
YPTB3939 YPO4093 putative haloacid dehalogenase-like hydrolase 1.753 (0.02)
YPTB3948 (yidC) YPO4102 probable membrane protein 0.666 (0.024) 0.645 (0.016)
YPTB3953 (yieG) YPO4107 Xanthine/uracil permeases family protein 0.638 (0.046) 1.583 (0.042)
S: function unknown
YPTB0015 (mobA) YPO0013A molybdopterin-guanine dinucleotide biosynthesis protein A 0.703 (0.032)
YPTB0020 YPO0020 conserved hypothetical protein 0.493 (< 0.001)
YPTB0040 YPO0043 conserved hypothetical protein 0.705 (0.029) 0.656 (0.011)
YPTB0089 YPO0093 conserved hypothetical protein 1.682 (< 0.001) 0.681 (0.008)
YPTB0196 or0133 conserved hypothetical protein 3.061 (< 0.001)
YPTB0219 YPO3816A 1.383 (0.046)
YPTB0296 YPO3732 conserved hypothetical protein 0.558 (< 0.001)
YPTB0378 YPO0323 conserved hypothetical protein 1.483 (0.016)
YPTB0454 YPO3522 conserved hypothetical protein 1.472 (0.03)
YPTB0478 YPO3498 conserved hypothetical protein 0.734 (0.038)
YPTB0506 or0367 conserved hypothetical protein 0.541 (0.013)
YPTB0547 YPO0407 conserved hypothetical protein 1.999 (< 0.001)
YPTB0589 YPO0445 conserved hypothetical protein 1.579 (0.007)
YPTB0600 (creA) YPO0457 putative exported protein 1.924 (< 0.001)
YPTB0627 YPO0485 putative membrane protein 1.523 (0.018)
YPTB0639 YPO0498 hypothetical protein 0.302 (< 0.001)
YPTB0640 YPO0499 hypothetical protein (< 0.001)
YPTB0641 YPO0500 conserved hypothetical protein (< 0.001)
YPTB0642 YPO0501 conserved hypothetical protein 0.346 (< 0.001)
YPTB0643 YPO0502 conserved hypothetical protein (< 0.001)
YPTB0644 YPO0503 conserved hypothetical protein 0.702 (0.012)
YPTB0646 YPO0505 conserved hypothetical protein 0.355 (< 0.001)
YPTB0648 YPO0507 conserved hypothetical protein 0.679 (0.044)
YPTB0649a YPO0508 hypothetical protein 0.56 (0.031)
YPTB0650 YPO0510 hypothetical protein 1.447 (0.043) 0.368 (< 0.001)
YPTB0653 YPO0512 putative lipoprotein 1.45 (0.035) 0.618 (0.009)
YPTB0654 YPO0513 conserved hypothetical protein 0.364 (0.002)
YPTB0655 YPO0514 putative OmpA-family membrane protein 0.383 (< 0.001)
YPTB0679 YPO0546 conserved hypothetical protein 1.35 (0.036)
YPTB0701 YPO3431 conserved hypothetical protein 0.663 (< 0.001)
YPTB0744 YPO3387 conserved hypothetical protein 2.792 (< 0.001)
YPTB0876 or0627 methionine salvage pathway enzyme E-2/E-2' 1.533 (0.007)
YPTB0976 (ybaY) YPO3140 putative lipoprotein 1.504 (0.043)
YPTB1021 YPO3087 conserved hypothetical protein 1.394 (0.029)
YPTB1057 YPO2801 putative membrane protein 1.682 (0.044)
YPTB1078 YPO2585 putative carbohydrate kinase 1.704 (0.035)
YPTB1085 YPO2592 putative membrane protein 0.609 (0.015)
YPTB1161 YPO1126 putative exported protein 0.596 (0.004)
YPTB1215 YPO1174 hypothetical protein 1.527 (0.047)
YPTB1222 YPO1181 putative membrane protein 0.697 (0.032)
YPTB1227 YPO1186 conserved hypothetical protein 0.634 (0.005)
YPTB1297 YPO1261 conserved hypothetical protein 0.659 (0.014)
YPTB1387 YPO1361 putative membrane protein 1.593 (0.003)
YPTB1389 YPO1363 putative virulence factoR 0.632 (0.043)
YPTB1422 YPO1397 conserved hypothetical protein (pseudogene. inframe deletion) 1.803 (0.012)
YPTB1432 YPO1408 putative exported protein 0.671 (0.044)
YPTB1499 YPO1483 hypothetical protein 1.491 (0.029)
YPTB1504 YPO1487 conserved hypothetical protein 2.062 (0.005)
YPTB1571 YPO1560 conserved hypothetical protein 1.34 (0.036)
YPTB1640 (hpaD) YPO1764 3.4-dihydroxyphenylacetate 2.3-dioxygenase 0.625 (0.046)
YPTB1729 YPO1858 putative exported protein 0.704 (0.037)
YPTB1901 or1366 conserved hypothetical protein 1.511 (0.01)
YPTB1902 YPO1882 conserved hypothetical protein 1.552 (< 0.001)
YPTB1941 YPO1943 putative membrane protein 2.118 (0.004)
YPTB2085 YPO2159 conserved hypothetical protein 0.606 (0.032)
YPTB2146 YPO2224 putative membrane protein 1.568 (0.018)
YPTB2214 YPO2291 putative virulence factoR 0.638 (0.023)
YPTB2234 YPO2315 putative exported protein 1.503 (0.008)
YPTB2265 YPO2347 putative membrane protein 1.284 (0.04)
YPTB2314 YPO2404 conserved hypothetical protein 2.602 (< 0.001)
YPTB2352 YPO2444 conserved hypothetical protein 0.704 (0.017)
YPTB2388 YPO1693 conserved hypothetical protein 1.569 (0.038)
YPTB2444 (ycfJ) YPO1624 putative exported protein 2.296 (0.001)
YPTB2481 YPO1588 conserved hypothetical protein 0.759 (0.035)
YPTB2526 YPO2489 conserved hypothetical protein 1.361 (0.02)
YPTB2547 YPO2510 putative exported protein 0.31 (< 0.001)
YPTB2594 YPO2563 conserved hypothetical protein 0.563 (< 0.001)
YPTB2638 YPO2745 conserved hypothetical protein 0.483 (0.001)
YPTB2651 (lemA) YPO2732 putative exported protein 0.381 (< 0.001)
YPTB2660 YPO2724 putative membrane protein 1.486 (0.038)
YPTB2661 YPO2723 possible OmpA family (pseudogene. IS100 insertion) 1.796 (0.048)
YPTB2674 YPO2949 hypothetical protein 1.753 (0.045)
YPTB2693 YPO2970 putative lipoprotein 0.65 (0.049)
YPTB2694 YPO2971 putative lipoprotein 0.454 (< 0.001)
YPTB2745 (ygiW) YPO3027 putative exported protein 0.648 (0.002)
YPTB2907 YPO2701 putative membrane protein 0.658 (0.038)
YPTB2981 YPO1065 conserved hypothetical protein 0.721 (0.035)
YPTB3117 YPO0874 hypothetical protein 0.675 (0.039)
YPTB3161 or2087 Hypothetical bacteriophage protein. 0.64 (0.033)
YPTB3186 YPO0911 putative exported protein 1.578 (0.023)
YPTB3187 YPO0912 conserved hypothetical protein 0.612 (0.006)
YPTB3206 YPO0934 conserved hypothetical protein 0.69 (0.039)
YPTB3222 YPO0950 conserved hypothetical protein 0.547 (0.006)
YPTB3301 or2158 putative antigenic leucine-rich repeat protein 0.581 (0.004)
YPTB3403 YPO0659 conserved hypothetical protein 0.768 (0.028) 0.753 (0.019)
YPTB3429 YPO0626 Conserved hypothetical 0.619 (0.034)
YPTB3468 (hdeD) YPO0590 putative membrane protein 0.209 (< 0.001)
YPTB3484 YPO0572 putative exported protein 0.533 (0.013)
YPTB3485 (yqjD) YPO0570 putative membrane protein 0.674 (0.02) 0.576 (0.002)
YPTB3486 YPO0569A 0.606 (0.026)
YPTB3510 YPO3565 putative membrane protein 0.745 (0.02)
YPTB3573 (panF) YPO3657A sodium/pantothenate symporteR 0.732 (0.028)
YPTB3581 YPO3649 putative gamma carboxymuconolactone decarboxylase 0.573 (0.01)
YPTB3617 or2852 putative Rhs accessory genetic element 0.632 (0.037)
YPTB3622 YPO3607 conserved hypothetical protein 0.589 (0.014)
YPTB3748 YPO0153 conserved hypothetical membrane protein 0.614 (0.033)
YPTB3773 YPO0127 conserved hypothetical protein 2.928 (< 0.001)
YPTB3897 YPO4045 putative membrane protein 0.609 (0.015)
T: signal transduction mechanisms
YPTB0022 (ntrC) YPO0022 nitrogen regulation protein 0.723 (0.037)
YPTB0035 (spoT) YPO0038 guanosine-3'.5'-bisbis(diphosphate) 3'-pyrophosphydrolase 0.684 (0.011)
YPTB0071 (cpxP) YPO0075 putative exported protein 0.337 (< 0.001)
YPTB0356 (terD) YPO0298 tellurium resistance protein 1.485 (0.034)
YPTB0357 (terE) YPO0299 tellurium resistance protein 1.501 (0.005) 0.72 (0.019)
YPTB0468 (basS) YPO3508 two-component system sensor protein 2.184 (0.001)
YPTB0541 YPO0401 putative transcriptional regulatoR 0.652 (0.035)
YPTB0570 (hmsT) YPO0425 HmsT protein 0.574 (0.014) 1.64 (0.026)
YPTB0592 YPO0449 putative exported protein 0.591 (0.022)
YPTB0601 (arcA) YPO0458 aerobic respiration control protein 0.465 (0.001)
YPTB0734 (dksA) YPO3397 DnaK suppressor protein homologue 0.508 (< 0.001)
YPTB0789 YPO3343 probable extracellular solute-binding protein 0.462 (0.001)
YPTB1108 (glnH) YPO2615 putative amino acid-binding protein precursoR 0.564 (0.005)
YPTB1258 (rcsB) YPO1218 probable two component response regulator component B 0.693 (0.016)
YPTB1259 YPO1219 putative two component sensor kinase 0.696 (0.041)
YPTB1922 YPO1923 Putative sensor protein 1.451 (0.044)
YPTB1957 (narX) YPO1959 nitrate/nitrite sensor protein 1.83 (0.031)
YPTB2099 YPO2173 probable response regulatoR 1.533 (0.043)
YPTB2156 (cstA) YPO2234 putative carbon starvation protein A 0.544 (0.012) 0.624 (0.045)
YPTB2222 (fnr) YPO2300 fumarate and nitrate reduction regulatory protein 0.699 (0.001) 1.584 (< 0.001)
YPTB2230 (rstA) YPO2308 two-component regulatory system. response regulator protein 0.658 (0.024)
YPTB2378 YPO1703 conserved hypothetical protein 0.711 (0.022)
YPTB2396 (cheZ) YPO1681 chemotaxis protein CheZ 1.477 (0.027)
YPTB2405 (cheA) YPO1666 chemotaxis protein CheA 1.725 (0.015)
YPTB2435 (phoQ) YPO1633 sensor protein kinase 0.527 (< 0.001)
YPTB2548 (glnH) YPO2511 putative glutamine-binding periplasmic protein 1.797 (0.014)
YPTB2635 (sixA) YPO2748 putative phosphohistidine phosphatase 1.508 (0.002)
YPTB2763 (narP) YPO3041 nitrate/nitrite response regulator protein NarP 0.715 (0.043)
YPTB2894 (rseC) YPO2714 sigma E factor regulatory protein 1.431 (0.034)
YPTB2895 (rseB) YPO2713 sigma E factor regulatory protein 1.466 (0.04)
YPTB2896 (rseA) YPO2712 sigma E factor negative regulatory protein 1.652 (< 0.001)
YPTB3350 (fleR) YPO0712 sigma-54 transcriptional regulatory protein 2.134 (0.004)
YPTB3408 (glnE) YPO0653 glutamate-ammonia-ligase adenylyltransferase 1.792 (0.046)
YPTB3410 YPO0651 putative exported protein 1.988 (< 0.001)
YPTB3463 (terX) YPO0596 putative tellurium resistance protein 0.522 (< 0.001)
YPTB3500 (arcB) YPO3555 aerobic respiration control sensor/response regulatory protein 0.674 (0.012)
YPTB3566 (yhdA) YPO3664 putative exported protein 1.836 (< 0.001)
YPTB3729 (crp) YPO0175 cAMP-regulatory protein 0.641 (< 0.001)
YPTB3812 (uspA) YPO3970 universal stress protein A 0.291 (< 0.001) 1.554 (0.038)
YPTB3847 (uhpA) YPO4012 two-component system response regulatoR 2.004 (0.006)
YPTB3957 YPO4111 putative periplasmic solute-binding protein 1.59 (0.006)
YPTB2341 (infC) YPO2432 translation initiation factor IF-3 0.539 (< 0.001)
Open in a new tab

Table 3.

Y. pseudotuberculosis IP32953 pYV plasmid-harbored genes that are transcriptionally regulated by growth medium and/or temperature.

Fold ratio in gene transcription (p-value)
Gene designation Genoscript spot ID Gene product/function Human plasma/Luria Bertani Broth 37°C/28°C
pYV0013 pCD1-yadA hypothetical protein 13.528 (< 0.001) 1.577 (0.046)
pYV0014 pCD1-AAC62595 possible transposase remnant 1.789 (0.025) 1.884 (0.016)
pYV0017 pCD1-tnpR putative resolvase 0.341 (< 0.001)
pYV0020 pCD1-sycH putative YopH targeting protein 5.088 (< 0.001) 2.715 (< 0.001)
pYV0024 pCD1-sycE putative YopE chaperone 5.781 (< 0.001) 2.403 (0.005)
pYV0040 pCD1-yopK/yopQ Yop targeting protein YopK, YopQ 1.666 (0.019)
pYV0047 pCD1-yopM putative targeted effector protein 3.468 (< 0.001) 2.252 (0.002)
pYV0054 pCD1-yopD putative Yop negative regulation/targeting component 2.933 (< 0.001) 2.211 (0.004)
pYV0055 pCD1-yopB putative Yop targeting protein 2.816 (< 0.001) 2.196 (< 0.001)
pYV0056 pCD1-lcrH low calcium response protein H 3.522 (< 0.001) 1.851 (0.021)
pYV0057 pCD1-lcrV putative V antigen, antihost protein/regulator 1.904 (< 0.001) 1.637 (0.003)
pYV0058 pCD1-lcrG putative Yop regulator 1.713 (0.014)
pYV0059 pCD1-lcrR hypothetical protein LcrR 1.469 (0.001) 1.849 (< 0.001)
pYV0062 pCD1-yscX putative type III secretion protein 1.629 (0.009) 1.533 (0.020)
pYV0065 pCD1-yopN putative membrane-bound Yop targeting protein 2.612 (< 0.001) 1.549 (0.049)
pYV0067 pCD1-yscN putative Yops secretion ATP synthase 2.856 (< 0.001) 1.717 (0.002)
pYV0068 pCD1-yscO putative type III secretion protein 3.088 (< 0.001)
pYV0069 pCD1-yscP putative type III secretion protein 1.593 (0.018)
pYV0070 pCD1-yscQ putative type III secretion protein 1.635 (0.026)
pYV0071 pCD1-yscR putative Yop secretion membrane protein 1.949 (0.012)
pYV0072 pCD1-yscS putative type III secretion protein 2.331 (< 0.001) 1.897 (0.002)
pYV0075 pCD1-virG putative Yop targeting lipoprotein 1.957
pYV0076 pCD1-lcrF/virF putative thermoregulatory protein 1.441 (0.042)
pYV0078 pCD1-yscB hypothetical protein 3.038 (0.002)
pYV0079 pCD1-yscC putative type III secretion protein 2.384 (0.001) 2.713 (< 0.001)
pYV0080 pCD1-yscD putative type III secretion protein 2.542 (< 0.001) 1.990 (0.005)
pYV0081 pCD1-yscE putative type III secretion protein 2.711 (0.001) 1.809 (0.032)
pYV0082 pCD1-yscF putative type III secretion protein 2.117 (0.017)
pYV0083 pCD1-yscG putative type III secretion protein 2.463 (< 0.001)
pYV0085 pCD1-yscI putative type III secretion protein 1.864 (0.003)
pYV0089 pCD1-yscM putative type III secretion regulatory protein 0.679 (0.036)
Open in a new tab

Free iron limitation is a well-known stimulus encountered by bacteria in plasma [10,11]. As expected, IP32953 genes required for iron storage (such as the ferritin-encoding gene ftnA [12] (Fig. 1)) were found to be downregulated in plasma. Transcriptional upregulation of most iron uptake systems (along with accessory protein-encoding genes tonB, exbB and exbD) (Fig. 1) is also consistent with this condition and is in agreement with the recent findings in Y. pestis [8]. As iron is used as a cofactor by numerous enzymes (mostly when complexed with sulfur), the metal is essential for a broad range of metabolic processes. Besides activation of iron homeostasis systems, lack of iron is also expected to be associated with a dramatic decrease in the transcription of genes encoding such enzymes, with the underlying goal of lowering iron consumption. This situation is exemplified by the katA gene that encodes catalase (a ferric enzyme involved in oxidative stress defense), whose transcription is decreased in both Y. pestis and Y. pseudotuberculosis during growth in plasma (Fig. 1). However, the increase in transcription of the bio locus (required for biotin synthesis [13]) and observed in both species) suggests that differential genetic control of a subset of iron-dependent enzymes may favor supply of this metal to the pathways that are most important for bacterial survival (and thus presumably at the expense of other, less critical ones). Furthermore, the impact of transcriptional downregulation on reorientation of metabolic fluxes may be minimized by the concomitant activation of genes coding for isoenzymes that are better suited to this situation.

Figure 1.

Figure 1

Open in a new tab

Medium- and temperature-dependent differential expression of Y. pseudotuberculosis chromosomal genes involved in virulence and/or iron uptake & storage. Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels when bacteria were grown in human plasma versus LB (triangles) and/or at 37°C versus 28°C (squares) are indicated by the color scale bar. Genes encoding iron uptake/storage systems, virulence factors and their regulators are symbolized by gray, white and black arrows, respectively. Nomenclature used for gene designation correspond to the Y. pseudotuberculosis IP32953 genome annotation. Mean fold changes in transcription and p-values are indicated in Table 2.

One example is that of the manganese- and iron-dependent superoxide dismutase genes (i.e sodA and sodB), which are Fur-activated and -repressed, respectively (Fig. 1) in both Y. pestis and Y. pseudotuberculosis. Similarly, the class Ib ribonucleotide reductase (RNR)-encoding genes (nrdHIEF) are probably important for bacterial life in plasma, since they were found to be upregulated at the expense of those in classes III (nrdDG) and Ia (nrdAB) (Table 2) – even though all three classes are equally involved in generating the synthetic precursors for DNA. The fact that only the first class is Fur-activated [14] is consistent with this observation. Similar variations have also been recorded in Y. pestis [8]. However, whereas purine/pyrimidine metabolism has been shown to be essential for Y. pestis virulence [15], the role of this metabolic pathway in the physiopathology of Y. pseudotuberculosis has not yet been investigated. Along with class 1b RNRs, more than half of the enzymes in the tricarboxylic acid cycle (TCA) are known to be catalytically iron-dependent and/or believed to be transcriptionally activated by Fur [16]. Accordingly, and in line with transcriptome data from Y. pestis, we observed that transcription of these genes fell significantly when Y. pseudotuberculosis was grown in plasma.

In contrast to the low availability of iron in blood, glucose is readily available in this biological fluid and at a higher concentration (approx. 7 mM) than in LB broth. When Y. pseudotuberculosis was cultured in plasma, genes involved in glycolysis and the upstream, sugar-supplying, phosphoenolpyruvate-dependent systems were found to be upregulated, as depicted in Fig. 2. This finding is reminiscent of an aerobic phenomenon referred to as "glucose overflow metabolism"; this consists in channeling the carbon flow towards acetate formation instead of citrate formation, in order to prevent the excessive accumulation of NADH that would otherwise result from very high glucose consumption rates [17]. However, one main feature of glucose overflow in E. coli is acetate accumulation due to a strong transcriptional repression of the glyoxylate shunt aceBAK operon [18]. Interestingly, at least the first two of these genes are not down- but are up-regulated in Y. pseudotuberculosis (Fig. 2, Additional file 1), suggesting a need for this species to limit acetate overloads. The continuous de-repression of these genes (due to inactivation of the IclR repressor) suggests that this might also be the case in Y. pestis. These pathways are controlled by complex and finely balanced networks involving numerous pleiotropic regulators, including Fur, Crp, Fnr and ArcA [16,19]. This unexpected upregulation may well result from the combination of both high glucose and low iron levels in plasma. Whether this occurs through the strong transcriptional repression observed with both fnr and arcA remains to be addressed in future experiments.

Figure 2.

Figure 2

Open in a new tab

Medium-dependent differential expression of genes coding for enzymes putatively involved in Y. pseudotuberculosis glycolysis and the tricarboxylic acid cycle (TCA cycle). Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels in human plasma versus LB is indicated by the color scale bar. Open boxes indicate genes whose expression levels did not vary significantly (p > 0.05). Although considered as not significant by statistical analysis of macroarray data (p = 0.053), transcriptional upregulation of aceB in human plasma was confirmed by qRT-PCR. Abbreviations: Ac-CoA: acetyl coenzyme A; PEP: phosphoenolpyruvate. Mean fold changes in transcription and p-values are indicated in Table 2.

Temperature upshift is typically considered to be the main signal indicating to bacteria that they have entered the host; this hypothesis is supported by the thermal dependency of almost all Y. pseudotuberculosis virulence genes and also many of the latter's regulators [3]. Several of these genes were also found to be influenced by growth in plasma and the changes were sometimes in the opposite direction to those seen with temperature upshifts: whereas expression of the invasin-encoding gene inv was significantly repressed during bacterial growth under both conditions, transcription of psaA (coding for the pH6 antigen) was promoted by temperature upshifts [6,20], but was one of the most strongly repressed in plasma. Interestingly, the impact of this medium on psaA transcription was not considered to be significant in Y. pestis and suggests that the pH6 antigen does not have the same importance in blood dissemination in the two species. In contrast to the latter two adhesins, transcriptional activation of yadA (harbored by the pYV plasmid and involved in adhesion) was found to be the highest of all the Y. pseudotuberculosis genes induced under plasma growth conditions. This observation is consistent with YadA's involvement in microbial resistance to complement [21,22]. Similarly, ompC whose product is believed to be targeted by lactoferricin [23], a bactericidal peptide derived from lactoferrin by enzymatic cleavage [24], is strongly repressed, whilst no significant modification was observed for the outer membrane-encoding genes ompA and ompC2.

Lastly, an essential determinant of bacterial virulence is the plasmid-encoded type III secretion system (TTSS) which performs intracellular delivery of a set of Yersinia outer proteins (Yops) that subvert the host's defenses [25]. Interestingly, Y. pseudotuberculosis growth in plasma induced the upregulation of 25 genes required for secretion, translocation and chaperoning of the Yop effector proteins in a similar fashion to that observed upon temperature upshift (Fig. 3). Furthermore, the apparently coordinated regulation of yadA and the TTSS-encoding genes by temperature and growth in plasma suggests the involvement of a common means of genetic control. YmoA (a chromatin-associated (histone-like) protein which is very similar in structure and function to the haemolysin expression modulating protein Hha from Escherichia coli) was shown to negatively influence YadA and Yop expression by favoring supercoiling of the pYV plasmid [26]. A two-fold reduction in ymoA transcription in plasma may be enough to contribute to the TTSS upregulation recorded in Y. pseudotuberculosis. Strikingly, this plasma-induced TTSS activation was not observed in Y. pestis, since only 3 out of the 25 genes mentioned above were found to be upregulated (in line with the statistically non-significant downregulation of ymoA); this raises the possibility that these two pathogenic Yersinia species may differ in their transcriptional regulation of pYV-harbored virulence genes.

Figure 3.

Figure 3

Open in a new tab

Medium- and temperature-dependent differential expression of genes harbored by the Y. pseudotuberculosis virulence plasmid pYV. Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels when bacteria were grown in human plasma versus LB (triangles) and/or at 37°C versus 28°C (squares) are indicated by the color scale bar. Only genes spotted on the macroarray (56 out of 99 pYV-borne genes) are shown and those encoding the secretion apparatus and Yop effectors are represented by grey and black boxes, respectively. Mean fold changes in transcription and p-values are indicated in Table 3.

Conclusion

Overall transcription profiling of Y. pseudotuberculosis grown in an environment mimicking the blood stage of the infectious process revealed gene regulations that could not be anticipated from the results of previously reported single-stimulus studies. Our findings thus provide insight into how a number of simultaneously sensed environmental cues may be taken into account by the bacterium in a hierarchical manner. Furthermore, comparison of our analyses with those previously performed in Y. pestis suggests that transcription of common critical virulence factors may be differently influenced (at least in part) by the plasma environment in these two species.

Methods

DNA macroarray construction

Pairs of specific oligonucleotide primers were designed with the Primer 3 software for each of the 3,951 Y. pseudotuberculosis IP32953 CDSs. In order to avoid cross-hybridization, the specificity of the PCR products relative to the complete genome sequence was tested with CAAT-box software [27]. Primers purchased from Eurogentec were chosen in order to specifically amplify a ≈ 400 to 500 base pair (bp) fragment of each open reading frame (ORF), with a melting temperature of 51 to 60°C. Amplification reactions were performed in 96-well plates (Perkin-Elmer) in a 100 μl reaction volume containing 100 ng of Y. pseudotuberculosis IP32953 DNA, DNA polymerase (Dynazyme, New England Biolabs), 10 μM of each primer and 2 mM dNTPs (Perkin-Elmer). Reactions were cycled 45 times (94°C for 30 s; 60°C for 30 s; 72°C for 60 s) with a final cycle of 72°C for 7 min in a thermocycler. Each PCR product was checked by agarose gel electrophoresis and when DNA amplification was unsuccessful, PCR was repeated with another primer set. Overall, 3,951 of the 3,994 CDSs (98%) identified in the Y. pseudotuberculosis IP32953 genome were successfully amplified under our experimental conditions. ORF-specific PCR products, luciferase DNA (10 to 100 ng) and total genomic DNA from strain IP32953 were spotted onto 22 × 7-cm nylon membranes (Genetix) using a Qpix robot (Genetix). Immediately following spot deposition, membranes were immersed for 15 min in 0.5 M NaOH and 1.5 M NaCl, washed three times with distilled water and stored at -20°C until use. To ensure that DNA samples were successfully deposited on the membranes, 33P-labeled genomic DNA was hybridized to the macroarray before transcriptome analysis.

Bacterial culture

The Y. pseudotuberculosis transcriptome was studied in three independent cultures of strain IP32953 in media aliquoted from a single batch. After storage in Luria-Bertani (LB) broth with 40% glycerol at -80°C, the strain was thawed and then grown on LB agar supplemented with 20 μg ml-1 hemin for 48 h at 28°C. From this culture, 8 × 106 cells were inoculated into 40 ml of either LB broth or pooled human plasma from healthy donors (heated at 56°C for 30 min to ensure complement inactivation). Media were then incubated at 28°C or 37°C with shaking and Yersinia growth was monitored by absorbance at 600 nm.

RNA and cDNA probe preparation

Cells were harvested from exponential-phase cultures (A600 of 0.2–0.4 and 0.1–0.2 for LB and human plasma, respectively) by centrifugation at 4°C and the pelleted bacteria were disrupted with RNAwiz reagent (Ambion). After mixing the lysate with chloroform (0.2 v), total RNA was precipitated from the aqueous phase with glycogen (1/50 v) and isopropanol (1 v). The RNA pellet was washed with 70% ethanol and then dissolved in sterile, DNase- and RNase-free water. Contaminating DNA was removed using the DNA-free kit from Ambion. Nucleic acid purity and integrity was checked with a BioAnalyzer 2100 (Agilent) according to the supplier's instructions. After quantification by spectrophotometry at 260 and 280 nm, the RNA solution was stored at -80°C until use. cDNA was further generated from 10 μg of total RNA incubated (in a total volume reaction of 45 μl) for 3 h at 42°C with 50 U AMV reverse transcriptase (Roche), 0.35 pmol. of each amplified CDS-specific 3' oligonucleotide primer, 222 μM dATP, dGTP & dTTP, 2.2 μM dCTP and 50 μCi 33P-labelled dCTP (Amersham Biosciences). Labeled cDNA was purified to remove unincorporated nucleotides using DyeEx 2.0 spin column (Qiagen).

DNA macroarray hybridization

Macroarrays were prewetted in 2 × SSPE (0.18 M NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH 7.7) and prehybridized for 1 h in 13 ml of hybridization solution (5 × SSPE, 2% SDS, 1× Denhardt's reagent, 0.1 mg of sheared salmon sperm DNA ml-1) at 65°C in roller bottles. Hybridization was carried out for 20 h at 65°C with 15 ml of hybridization solution containing the purified cDNA probe. After hybridization, membranes were washed three times at room temperature and three times at 65°C for 20 min in 0.5 × SSPE and 0.2% SDS. Probed macroarrays were exposed to a phosphor screen (Molecular Dynamics) for 24–72 h and imaged using a STORM 860 phosphorimager (Amersham Biosciences). The intensity of all of the pixels associated with each spot was further quantified using ArrayVision software (Imaging Research, Grinnel, IA, USA). The experiment design included three biological replicates for each combination of conditions. Data were analyzed using the SAS software (SAS Institute Inc, Cary, NC, USA). They were first log-transformed and normalized with a median normalization. A linear model was then applied on each gene with the temperature, phase and growth medium as fixed effects. The significance level alpha was set to 0.05.

Real-Time Quantitative PCR

Messenger RNAs (mRNAs) were reverse transcribed from 1 μg of nucleic acid by using the High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The resulting cDNA was amplified by the SYBR Green Real-Time PCR Kit and detected on a Prism 7000 detection system (Applied Biosystems). The forward and reverse primers used were as follows: 5'CGCCATCAAATGCGCTAAT3' and 5'TGAGCGGGATCGTGTTCAA3' for yfeA, 5'TCAAGCAGGGAAACACATTCC3' and 5'GGCTGTTTACCCGCAAAAATC3' for psaA, 5'GGTTAGCCGCGAACAGGATA3' and 5'CGCTCGCCAGAACAAGGTT3' for aceB, 5'TCGATGCTCGCGCTAAGG3' and 5'GCTGGTTTCGCTGCTTCAG3' for yadA, 5'GATCCTGGTTCCATAAAAATTATTCAC3' and 5'ATTGTTCGCCTGGATTACCAA3' for yopJ, 5'GAGAATCCCAGTCGGGTGTTAA3' and 5'TCACTGCATCGCGGTAGGT3' for yopN, 5'GACACCAGTGGGACGCAACT3' and 5'GGGTTCACAAGAAAGAGTAACAGCTT3' for sycH, 5'GGTTACGCGCGGGTATCA3' and 5'CCGCGTCTTTGAGTGTTTTG3' for tnpR, 5'TTCTCGTGGGCAACCTATCC3' and 5'TGCGTTCCCAGCATACACAA3' for nlpD. On completion of the PCR amplification, a DNA melting curve analysis was performed to confirm the presence of a single amplicon. Relative mRNA levels (2ΔΔC) were determined by comparing the PCR cycle thresholds (Ct) for the gene of interest and the constitutively expressed YPTB0775 gene (spot ID YPO3356) coding for the outer membrane lipoprotein NlpD.

Abbreviations

qRT-PCR: quantitative Real Time Reverse Transcription PCR.

Authors' contributions

MLR performed the macroarray hybridizations and participated to the critical proofreading of the manuscript. SC contributed to the experiment set-up and was responsible for bacterial cultures and RNA extractions; she participated in statistical analyses and critical proofreading of the manuscript. RD performed the qPCR experiments. CL, LF, CL, AS, J-YC and CM were involved in the macroarray design and construction. MAD contributed to the experiment design and performed the statistical analyses. JF contributed to the bacterial cultures. EC participated in experimental design and, as the main project coordinator, in critical proofreading of the manuscript. MM contributed to the experimental set-up, performed the spot intensity quantification and the biological interpretation of the results; he wrote this manuscript with assistance of MS, who was also involved in coordination of the project. All the authors have read and approved the content of this article.

Supplementary Material

Additional file 1

Validation of macroarray hybridization data. Transcriptional changes for three chromosomal (yfeA, psaA and aceB) and five plasmid-borne (yadA, yopJ, yopN, sycH and tnpR) genes (assessed using macroarray hybridization and qRT-PCR assays) are shown.

Click here for file (55.5KB, pdf)

Acknowledgments

Acknowledgements

This work was funded by grant 02 34 021 from the "Délégation Générale pour l'Armement" and grant PTR88 from the Institut Pasteur and the Institut Pasteur de Lille. We gratefully thank Sandrine Rousseau-Moreira (Plate-Forme 4, Institut Pasteur, Paris, France) for technical assistance during the Genoscript data upload process.

Contributor Information

Marie-Laure Rosso, Email: mlrosso@pasteur.fr.

Sylvie Chauvaux, Email: chauvaux@pasteur.fr.

Rodrigue Dessein, Email: r-dessein@chru-lille.fr.

Caroline Laurans, Email: caroline.laurans@ch-roubaix.fr.

Lionel Frangeul, Email: lfrangeu@pasteur.fr.

Céline Lacroix, Email: clacroix@pasteur.fr.

Angèle Schiavo, Email: angsch@pasteur.fr.

Marie-Agnès Dillies, Email: mdillies@pasteur.fr.

Jeannine Foulon, Email: chauvaux@pasteur.fr.

Jean-Yves Coppée, Email: jycoppee@pasteur.fr.

Claudine Médigue, Email: cmedigue@genoscope.cns.fr.

Elisabeth Carniel, Email: carniel2@pasteur.fr.

Michel Simonet, Email: michel.simonet@ibl.fr.

Michaël Marceau, Email: michael.marceau@ibl.fr.

References

  1. Vincent P, Leclerc A, Martin L, Yersinia Surveillance Network. Duez J-M, Simonet M, Carniel E. Sudden onset of pseudotuberculosis in humans, France, 2004–05. Emerg Infect Dis. 2008 doi: 10.3201/eid1407.071339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Putzker M, Sauer H, Sobe D. Plague and other human infections caused by Yersinia species. Clin Lab. 2001;47:453–466. [PubMed] [Google Scholar]
  3. Marceau M. Transcriptional regulation in Yersinia: an update. Curr Issues Mol Biol. 2005;7:151–177. [PubMed] [Google Scholar]
  4. Darwin AJ. Genome-wide screens to identify genes of human pathogenic Yersinia species that are expressed during host infection. Curr Issues Mol Biol. 2005;7:135–149. [PubMed] [Google Scholar]
  5. Revell PA, Miller VL. Yersinia virulence: more than a plasmid. FEMS Microbiol Lett. 2001;205:159–164. doi: 10.1111/j.1574-6968.2001.tb10941.x. [DOI] [PubMed] [Google Scholar]
  6. Price SB, Freeman MD, Yeh KS. Transcriptional analysis of the Yersinia pestis pH 6 antigen gene. J Bacteriol. 1995;177:5997–6000. doi: 10.1128/jb.177.20.5997-6000.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Collyn F, Lety MA, Nair S, Escuyer V, Ben Younes A, Simonet M, Marceau M. Yersinia pseudotuberculosis harbors a type IV pilus gene cluster that contributes to pathogenicity. Infect Immun. 2002;70:6196–6205. doi: 10.1128/IAI.70.11.6196-6205.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chauvaux S, Rosso ML, Frangeul L, Lacroix C, Labarre L, Schiavo A, Marceau M, Dillies MA, Foulon J, Coppée JY, Médigue C, Simonet M, Carniel E. Transcriptome analysis of Yersinia pestis in human plasma: an approach for discovering bacterial genes involved in septicaemic plague. Microbiology. 2007;153:3112–3124. doi: 10.1099/mic.0.2007/006213-0. [DOI] [PubMed] [Google Scholar]
  9. Chain PS, Carniel E, Larimer FW, Lamerdin J, Stoutland PO, Regala WM, Georgescu AM, Vergez LM, Land ML, Motin VL, Brubaker RR, Fowler J, Hinnebusch J, Marceau M, Médigue C, Simonet M, Chenal-Francisque V, Souza B, Dacheux D, Elliott JM, Derbise A, Hauser LJ, Garcia E. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc Natl Acad Sci USA. 2004;101:13826–13831. doi: 10.1073/pnas.0404012101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Andrews SC, Robinson AK, Rodriguez-Quinones F. Bacterial iron homeostasis. FEMS Microbiol Rev. 2003;27:215–237. doi: 10.1016/S0168-6445(03)00055-X. [DOI] [PubMed] [Google Scholar]
  11. Schaible UE, Kaufmann SH. Iron and microbial infection. Nat Rev Microbiol. 2004;2:946–953. doi: 10.1038/nrmicro1046. [DOI] [PubMed] [Google Scholar]
  12. Abdul-Tehrani H, Hudson AJ, Chang YS, Timms AR, Hawkins C, Williams JM, Harrison PM, Guest JR, Andrews SC. Ferritin mutants of Escherichia coli are iron deficient and growth impaired, and fur mutants are iron deficient. J Bacteriol. 1999;181:1415–1428. doi: 10.1128/jb.181.5.1415-1428.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Sanyal I, Cohen G, Flint DH. Biotin synthase: purification, characterization as a [2Fe-2S]cluster protein, and in vitro activity of the Escherichia coli bioB gene product. Biochemistry. 1994;33:3625–3631. doi: 10.1021/bi00178a020. [DOI] [PubMed] [Google Scholar]
  14. Nordlund P, Reichard P. Ribonucleotide reductases. Annu Rev Biochem. 2006;75:681–706. doi: 10.1146/annurev.biochem.75.103004.142443. [DOI] [PubMed] [Google Scholar]
  15. Munier-Lehmann H, Chenal-Francisque V, Ionescu M, Chrisova P, Foulon J, Carniel E, Barzu O. Relationship between bacterial virulence and nucleotide metabolism: a mutation in the adenylate kinase gene renders Yersinia pestis avirulent. Biochem J. 2003;373:515–522. doi: 10.1042/BJ20030284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Zhang Z, Gosset G, Barabote R, Gonzalez CS, Cuevas WA, Saier MH., Jr Functional interactions between the carbon and iron utilization regulators, Crp and Fur, in Escherichia coli. J Bacteriol. 2005;187:980–990. doi: 10.1128/JB.187.3.980-990.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Vemuri GN, Altman E, Sangurdekar DP, Khodursky AB, Eiteman MA. Overflow metabolism in Escherichia coli during steady-state growth: transcriptional regulation and effect of the redox ratio. Appl Environ Microbiol. 2006;72:3653–3661. doi: 10.1128/AEM.72.5.3653-3661.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Veit A, Polen T, Wendisch VF. Global gene expression analysis of glucose overflow metabolism in Escherichia coli and reduction of aerobic acetate formation. Appl Microbiol Biotechnol. 2007;74:406–421. doi: 10.1007/s00253-006-0680-3. [DOI] [PubMed] [Google Scholar]
  19. Perrenoud A, Sauer U. Impact of global transcriptional regulation by ArcA, ArcB, Cra, Crp, Cya, Fnr, and Mlc on glucose catabolism in Escherichia coli. J Bacteriol. 2005;187:3171–3179. doi: 10.1128/JB.187.9.3171-3179.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lindler LE, Klempner MS, Straley SC. Yersinia pestis pH 6 antigen: genetic, biochemical, and virulence characterization of a protein involved in the pathogenesis of bubonic plague. Infect Immun. 1990;58:2569–2577. doi: 10.1128/iai.58.8.2569-2577.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. El Tahir Y, Skurnik M. YadA, the multifaceted Yersinia adhesin. Int J Med Microbiol. 2001;291:209–218. doi: 10.1078/1438-4221-00119. [DOI] [PubMed] [Google Scholar]
  22. China B, Sory MP, Nguyen BT, Debruyere M, Cornelis GR. Role of the YadA protein in prevention of opsonization of Yersinia enterocolitica by C3b molecules. Infect Immun. 1993;61:3129–3136. doi: 10.1128/iai.61.8.3129-3136.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Sallmann FR, Baveye-Descamps S, Pattus F, Salmon V, Branza N, Spik G, Legrand D. Porins OmpC and PhoE of Escherichia coli as specific cell-surface targets of human lactoferrin. Binding characteristics and biological effects. J Biol Chem. 1999;274:16107–16114. doi: 10.1074/jbc.274.23.16107. [DOI] [PubMed] [Google Scholar]
  24. Orsi N. The antimicrobial activity of lactoferrin: current status and perspectives. Biometals. 2004;17:189–196. doi: 10.1023/B:BIOM.0000027691.86757.e2. [DOI] [PubMed] [Google Scholar]
  25. Cornelis GR. The Yersinia Ysc-Yop 'type III' weaponry. Nat Rev Mol Cell Biol. 2002;3:742–752. doi: 10.1038/nrm932. [DOI] [PubMed] [Google Scholar]
  26. Cornelis GR, Sluiters C, Delor I, Geib D, Kaniga K, Lambert de Rouvroit C, Sory MP, Vanooteghem JC, Michiels T. ymoA, a Yersinia enterocolitica chromosomal gene modulating the expression of virulence functions. Mol Microbiol. 1991;5:1023–1034. doi: 10.1111/j.1365-2958.1991.tb01875.x. [DOI] [PubMed] [Google Scholar]
  27. Frangeul L, Glaser P, Rusniok C, Buchrieser C, Duchaud E, Dehoux P, Kunst F. CAAT-Box, Contigs-Assembly and Annotation Tool-Box for genome sequencing projects. Bioinformatics. 2004;20:790–797. doi: 10.1093/bioinformatics/btg490. [DOI] [PubMed] [Google Scholar]
  28. Tatusov RL, Galperin MY, Natale DA, Koonin EV. The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000;28:33–36. doi: 10.1093/nar/28.1.33. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

Validation of macroarray hybridization data. Transcriptional changes for three chromosomal (yfeA, psaA and aceB) and five plasmid-borne (yadA, yopJ, yopN, sycH and tnpR) genes (assessed using macroarray hybridization and qRT-PCR assays) are shown.

Click here for file (55.5KB, pdf)

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES