Abstract
We previously demonstrated that B-1b cells can undergo differentiation to acquire a mononuclear phagocyte phenotype upon attachment to substrate in vitro. Here we followed the expression of surface markers and transcription factors during this differentiation. B-1b cells spontaneously express both myeloid and lymphoid restricted transcription factors. When induced to differentiate into a phagocyte, the lymphoid genes E box protein (E2A), early B-cell factor (EBF), paired box 5 (Pax5) are down-modulated, while expression of genes related to myeloid commitment is sustained. Furthermore, B-1b cell-derived phagocytes (B-1CDPs) decrease immunoglobulin M (IgM) expression but retain the expression of the heavy chain variable gene VH11 or VH12, an immunoglobulin gene rearrangement predominantly expressed by B-1 cells. The maintenance of lymphoid characteristics in B-1CDPs characterizes a unique type of phagocyte, not related to monocyte-derived macrophages.
Keywords: B-1 cells, differentiation, macrophage, phagocytosis, transcription factors
Introduction
The distinct origins, properties and fates of myeloid and lymphoid cell lineages have been clearly established since the beginning of the 1970s.1,2 Pluripotent haematopoietic stem cells give rise to all mature blood cell types through a stepwise process of binary decisions, in which multipotent progenitors undergo lineage commitment, branching into an intermediate progenitor that develops along a single pathway.1,2 It is hypothesized that the first decision of haematopoietic stem cells determines their fate as either lymphoid or myeloid cells. The lineage commitment is thought to be an irreversible process, restricting the developmental fate of a progenitor cell to a single lineage by mutual antagonism of lineage-specific transcription factors.2 Nevertheless, there is evidence that, in CD5+-derived lymphomas, pre-B cells acquire macrophage characteristics in vitro and ‘monocytoid B lymphocytes’ have also been found to be associated with human diseases such as AIDS, chronic lymphocytic leukaemia, Sjögren's syndrome and Hodgkin's disease.3–6 This bipotential phenotype could be considered a consequence of inadequate gene expression related to malignancy of these cells.
However, the discovery of B-1 cells by Hayakawa et al.7 disproved this hypothesis. B-1 cells were originally identified in the murine peritoneum, as a B-lymphocyte subset that differs from conventional B-2 cells or B lymphocytes in terms of phenotypic, functional and developmental characteristics. These differences have been extensively reviewed.8–12 A striking distinction between these cells is that the immunoglobulin repertoire of B-1 cells is less diverse compared with that of B-2 cells. B-1 cells tend to express B-cell receptors with particular specificities; for example, approximately 10–15% of peritoneal B-1 cells are specific for the membrane phospholipid phosphatidylcholine. This specificity is commonly produced by the heavy chain variable (V) genes VH11 and VH12, which are expressed at high levels in B-1 cells, but not in B-2 cells.13,14
B-1 cells in the peritoneal and pleural cavities can be identified by their CD11b+ IgMhi IgDlow phenotype and can be further subdivided, on the basis of differential expression of the cell-surface antigen CD5, into B-1a (CD5+) and B-1b (CD5−) cells.10
Borrello and Phipps15 demonstrated that splenic B-1a cells when co-cultivated with fibroblasts became phagocytes, which they called B/macrophages.3,15 These authors proposed that macrophages, as defined by the concept of the mononuclear phagocytic system as cells derived from blood monocytes, could also originate from B-1 cells. Conversely, Almeida et al.16 clearly showed that B-1b cells proliferate in cultures of adherent mouse peritoneal cells and can become new mononuclear phagocytic cells with no relation to blood-derived monocytes. Important to note is the fact that, as monocytes migrate from bone marrow, B-1b cells migrate from the peritoneal cavity to non-specific inflammatory lesion sites.
Taking these investigations further, here we describe some molecular aspects of B-1b cell differentiation into mononuclear phagocytes. It is demonstrated that transcription factors related to the lymphoid lineage are decreased, with a concomitant persistence of myeloid gene expression, thus revealing that these cells continue their differentiation towards a myeloid commitment despite preserving the immunoglobulin gene rearrangement.
Methods
Animals
BALB/c, C57BL6 and interleukin (IL)-10 knockout (KO) C57BL/6 male mice 6–8 weeks of age were obtained from CEDEME, Universidade Federal de São Paulo (SP, Brazil).
B-1b cell culture
B-1 cells were obtained as described by Almeida et al.16 Briefly, peritoneal cells were collected from the abdominal cavity of mice by repeated lavage with 2 ml of RPMI-1640 medium (Sigma, St Louis, MO). Cell viability was evaluated using the Trypan blue dye exclusion method. Cells (2 × 105 cells/ml) were dispensed over round glass dishes (60 mm) (Corning Costar, Tokyo, Japan) and the cultures incubated at 37° in 5% CO2 for 60 min. After incubation, non-adherent cells were discarded. Adherent monolayers were rinsed with RPMI. Subsequently, R10 medium (RPMI-1640 containing 10% heat-inactivated fetal bovine serum) was added to the cultures. Cultures were maintained at 37° in 5% CO2 for 5 days, without changing the medium, after which time floating B-1b cells were present in large numbers.
B-1b cell purification
B-1b cells were purified from free-floating cells in the supernatant of the cultures described above, using the magnetic bead system MiniMACS (Miltenyi Biotec, Bergisch Gladbach, Germany). Approximately 107 free-floating cells were incubated with monoclonal anti-mouse CD19 (Pharmingen, San Diego, CA) diluted in saline solution containing 5% bovine serum albumin (BSA) and 2 mm ethylenediaminetetraacetic acid (EDTA). After washing with the same buffer, anti-rat immunoglobulin G (IgG) coupled to iron (Fe) (Miltenyi Biotec) was added to the cell suspension for 45 min at 4°. Cells were passed through a 25MS positive selection column (Miltenyi Biotec), where B-1b cells were retained. By detaching the column from the magnet bar, B-1b cells were collected. The purity of these cell preparations was confirmed using a FACSCalibur flow cytometer (BD Biosciences, Mountain View, CA). Purified B-1b cells were either allowed to differentiate in vitro into phagocytes or processed for RNA extraction.
Differentiation of free-floating B-1b cells into B-1 cell-derived phagocytes
B-1b cells were obtained as described above. Floating cells were harvested, centrifuged (600 g for 4 min) and cultivated in R-10 medium. For microscopy analysis, 2 × 105 cells were dispensed onto glass cover-slips inserted into 24-well tissue culture plates, and for RNA extraction 2 × 106 cells were cultivated in plastic dishes. These cells were maintained in culture for 10 days.
Bone marrow-derived macrophages
Bone marrow-derived macrophages were generated from bone marrow stem cells cultured on plastic dishes for 7 days in RPMI medium supplemented with 20% fetal bovine serum and 30% L929 cell-conditioned medium (LCCM). Differentiated macrophages were removed from the substrate by vigorous pipetting with ice-cold phosphate-buffered saline (PBS) and submitted to purification using the magnetic bead system MiniMACS (Miltenyi Biotech), following the protocol described above. A monoclonal anti-mouse F4/80 (Santa Cruz Biotechnology, Santa Cruz, CA) was used. Purified macrophages were submitted to RNA extraction.
Splenic conventional B cells
Conventional B cells were selected by incubation of total splenic cells for 2 hr at 37° in plastic dishes (Costar, Cambridge, MA). Non-adherent cells were collected, centrifuged and submitted to purification using the magnetic bead system MiniMACS (Miltenyi Biotech), following the protocol described above. A monoclonal anti-mouse CD23 (Pharmingen) was used. Purified B cells were submitted to RNA extraction.
Reverse transcriptase–polymerase chain reaction (RT-PCR) analysis for haematopoietic transcription factors
Total RNA was extracted from each cell population using the Perfect RNA® Mini kit (Eppendorf, Hamburg, Germany). RNA was digested with RNAse-free DNAse I (Roche, Indianapolis, IN) to remove contaminating genomic DNA. First-strand cDNA was synthesized with SuperScript II RNAse H reverse transcriptase using an oligo (dT) primer (Invitrogen, Carlsbad, CA). The concentration of cDNA in different samples was calibrated using GADPH cDNA. For PCR reactions the samples were denatured at 94° for 2 min followed by 30–41 cycles at 94° (30 seconds), at the primer-specific annealing temperature (see Table 1) (30 seconds), and at 72° (30 seconds). PCR products were resolved on agarose gels and visualized by ethidium bromide staining. Images were taken and quantified using Kodak Digital Science – Electrophoresis Documentation and Analysis System 120 (Eastman Kodak Co., Rochester, NY).
Table 1.
Oligonucleotides used for reverse transcriptase–polymerase chain reaction (RT-PCR) analysis
| Gene | Forward | Reverse | T (°) |
|---|---|---|---|
| IL-7Rα | AGCTGTTTCTGGAGAAAGTGG | AACGACTTTCAGGTCAGAGGG | 61·5 |
| VpreB | CGTCTGTCCTGCTCATGCT | ACGGCACAGTAATACACAGCC | 53·8 |
| EBF | CAAGACAAGAACCCTGAAATG | GTAACCTCTGGAAGCCGTAGT | 55·5 |
| E2A | CATCCATGTCCTGCGAAGCCAC | TTCTTGTCCTCTTCGGCGTCGG | 65 |
| Pax5 | GTCATCGGTGAGCACCGACTC | GAAGCCATGGCTGAATACTC | 58·7 |
| Lysozyme M | GTCAGCCTGGCCGACTGGGTG | GACTCCGCAGTTCCGAATATA | 65 |
| M-CSFR | GCGATGTGTGAGCAATGGCAGT | AGACCGTTTTGCGTAAGACCTG | 61·5 |
| PU.1 | CGGATGACTTGGTTACTTACG | GTAGGAAACCTGGTGACTGAG | 55·5 |
| F4/80 | CTTTGGCTATGGGCTTCCAGTC | GCAACGAGGACAGAGTTTATCGTG | 60 |
| G-CSFR | CTCAAACCTATCCTGCCTCATG | TCCAGGCAGAGATGAGCGAATG | 55·5 |
| VH11 | GCAATAAACTACGCACCATCCA | TTCGCACATTGTCCTCCGA | 58 |
| VH12 | CTTCTACAACCCATCCCTCCAG | TACATGGCTGTGTCCTCTGTGG | 58 |
| GADPH | CGCCTGGTCACCAGGGCTGC | CACCACCCTGTTGCTGTAGCC | 55 |
EBF, early B-cell factor; E2A, E box protein; GADPH, glyceraldehyde 3-phosphate dehydrogenase; G-CSFR, granulocyte colony-stimulating factor receptor; IL, interleukin; IL-7Rα, alpha subunit for IL-7 receptor; M-CSFR, macrophage colony-stimulating factor receptor; Pax5, paired box 5; VH, variable heavy chain 11 or 12; VpreB, surrogate light chain.
Analysis of cell phenotype
B-1b cells and B-1 cell-derived phagocytes were stained with monoclonal antibodies and analysed using the FACSCalibur System (BD Biosciences). The following primary antibodies were used: phycoerythrin (PE) rat anti-mouse CD19, fluorescein-isothiocianate (FITC) rat anti-mouse CD5 (Pharmingen), allophycocyanin (APC) rat anti-mouse CD11b, cy-chrome rat anti-mouse CD23 and cy-chrome rat anti-B220. Indirect staining was performed with cy-chrome, PE or APC streptavidin and the following biotin-conjugated antibodies: anti-mouse IgM and anti-mouse F4-80 (Santa Cruz Biotechnology). Cell staining was carried out according to the manufacturer's protocol.
IgM detection
IgM secreted by B-1cells, B-1 cell-derived phagocytes and macrophages was analysed after 3 days of culture using the mouse isotyping panel from Bio-Rad (Hercules, CA). Immunoplates (96-well; Corning Costar, Tokyo, Japan) were coated for 1 hr with culture supernatants and then washed three times in PBS with 0·05% Tween. The remaining binding sites were blocked with PBS/BSA 1% for 1 hr at room temperature. Rabbit anti-mouse IgM was added, and after 1 hr at room temperature plates were washed with PBS/Tween 0·05%. The presence of IgM was detected with anti-rabbit horseradish peroxidase at 1 : 3000 dilution. Absorbance at 405 nm was determined using a Multiskan MCC/340 II reader (MR4000 Dynatech, Saint Cloud, France). The amount of IgM in the supernatants was evaluated using a standard curve with purified mouse IgM.
Single-cell PCR analysis
Single cells were selected using an Axiovert 25 microscope-micromanipulator (Zeiss, Jena, Germany) and a 0·4 × 20 mm sterile needle, as described by Hug et al.,17 and deposited into a reaction tube where cDNA synthesis was performed. The presence of single cells was confirmed by microscopic observation. DNA amplification was carried out using a Superscript Cells Direct cDNA Synthesis System (Invitrogen). The PCR method and the primers used are described above. Approximately 20 single B-1 or B-1b cell-derived phagocyte (B-1CDP) cells were separated in each experiment. The productive cDNAs were selected based on expression of housekeeping genes, and only cDNA with GADPH-positive PCR reactions was selected for VH11, VH12 or paired box 5 (Pax5) expression. It has been demonstrated that VH11 and VH12 rearrangements are predominantly expressed in B-1b cells.14
Results
B-1b cells differentiate into myeloid-like cells
To characterize the differentiation of B-1b cells into mononuclear phagocytes, we used the B-1 cell culture method described by Almeida et al.16 Using this methodology, we investigated the expression of lymphoid and myeloid surface markers during B-1b cell differentiation. The free-floating B-1b cells that appeared after 5 days in cultures of adherent peritoneal cells, as shown in Fig. 1(a) (B-1), were 96% CD19+ CD5− (Fig. 1b). Concomitantly to the expression of CD19, these cells were also IgM+, B220+, CD11b+, F4/80+ and CD23− (Fig. 1b). As demonstrated in our laboratory, B-1a cells (CD5+) do not adhere to plastic surfaces (data not shown).
Figure 1.
Morphological and phenotypic analysis of B-1b cell differentiation into phagocytes. (a) B-1b cells floating in adherent peritoneal cell culture (B-1), and B-1b cells after transference to new culture medium, where they spread and differentiate into B-1b cell-derived phagocytes (B-1CDP). (b) Dot plot showing the expression of surface markers by B-1b cells (left column) and B-1CDPs (right column). B-1b cells were purified by expression of CD19. After purification these cells were submitted to fluorescence-activated cell sorting (FACS) analysis or induced to differentiate in vitro. After differentiation, B-1CDPs were also submitted to FACS analysis. Gates were set based on isotype control staining.
As described by Almeida, when floating B-1b cells are re-cultivated they adhere to plastic and differentiate into bipolar mononuclear cells (Fig. 1a; B-1CDP). As previously described, these cells are highly phagocytic and were named ‘B-1 cell-derived phagocytes’ (B-1CDPs) by Almeida et al.16 After 5 days in new culture medium, they lose B-lymphocyte markers (IgM, CD19 and B220) but retain expression of myeloid markers (CD11b and F4/80) (Fig. 1b).
Gene profiling reveals both lymphoid and myeloid gene expression by B-1b cells
The biphenotypic characteristics of B-1b cells as identified by surface markers, and the changes in expression of these markers to a myeloid pattern during differentiation, led us to investigate the expression of transcription factors known to be involved in determining haematopoietic lineages. RNA purified from B-1b cells was analysed by semiquantitative RT-PCR and compared with RNA from splenic B conventional cells and bone marrow macrophages. B-1b cells were purified based on expression of CD19, as shown in Fig. 2(a). Concomitantly to expression of CD19, these cells are also IgM+, B220+, CD11b+ and CD5− (Fig. 2a). As seen in Fig. 2(b), the transcription factor genes early B-cell factor (EBF), E box protein (E2A) and Pax5 are expressed by B-1b cells. Accordingly, however, B-1b cells also express the E2A/EBF target gene surrogate light chain (VpreB). Interestingly, IL-7Rα expression by B-1b cells seems to be lower than in B conventional cells. B-1b cells express higher levels of PU.1 (myeloid transcription factor) than that detected in macrophages and B lymphocytes. In terms of their myeloid commitment, the high levels of PU.1 could be responsible for the induction of the expression of other myeloid genes by B-1 cells, such as lysozyme and F4/80. Although B-1b cells express high levels of PU.1, they do not express macrophage colony-stimulating factor (M-CSFR) [gene codes M-CSFR (c-fms)], a PU.1 target gene. Alternatively, c-fms gene silencing could be produced by expression of Pax5 by B-1 cells. Curiously, B-1b cells also express the G-CSFR gene, which was not detected in macrophages or B lymphocytes (Fig. 2b). The results obtained with bone marrow macrophages were also obtained when peritoneal macrophages were analysed (data not shown).
Figure 2.
Promiscuous lineage gene expression in B-1b cells. (a) Fluorescence-activated cell sorting (FACS) profile of CD19+ purified B-1 cells induced to differentiate in vitro. The expression of CD19, CD11b, B220 and CD5 or CD19, CD11b, immunoglobulin M (IgM) and CD5 was analysed. Gates were set based on isotype control staining. Results are representative of eight independent experiments. (b) Reverse transcriptase–polymerase chain reaction (RT-PCR) analysis of the indicated transcripts in purified B lymphocytes, macrophages and B-1b cells, using primers that detected the indicated lymphoid (left column) or myeloid (right column) genes. The PCR products were visualized on agarose gels by ethidium bromide staining. The amount of cDNA input was normalized by analysing control GADPH transcripts. Results are representative of three independent experiments. EBF, early B-cell factor; E2A, E box protein; GADPH, glyceraldehyde 3-phosphate dehydrogenase; G-CSFR, granulocyte colony-stimulating factor receptor; IL, interleukin; IL-7Rα, alpha subunit for IL-7 receptor; lys, lysozyme; M-CSFR, macrophage colony-stimulating factor receptor; Pax5, paired box 5; VH, variable heavy chain 11 or 12; VpreB, surrogate light chain.
B-1CDPs lose lymphoid transcription factors
Myeloid and lymphoid transcription factor expression was investigated during the B-1 cell differentiation that occurred upon cell attachment. As expected, specific mRNA for transcription factor PU.1 and its related genes (lysozyme and F4/80) was detected in B-1CDPs (Fig. 3a). Nevertheless, the expression of lymphoid restricted transcription factors was decreased or abolished during cell differentiation. These cells also acquired M-CSFR gene expression, and silenced the expression of granulocyte-CSFR (G-CSFR). It is remarkable that the acquisition of M-CSFR expression was followed by silencing of Pax5 in B-1CDPs (Fig. 3a). Amplifications using a small number of cycles indicated that the experiments were in the linear range of amplification (Fig. 3b). It is interesting to note, however, that VpreB expression remained constant during differentiation of B-1b cells into B-1 cell-derived phagocytes. This observation indicates that, although B-1CDPs acquired a typical myeloid pattern, they still retained lymphoid markers.
Figure 3.
Myeloid and lymphoid gene expression by B-1 cell-derived mononuclear phagocytes. Purified B-1b cells were transferred to new medium and differentiated into mononuclear phagocytes. After 1, 5 and 10 days these cells were collected and submitted to RNA extraction. (a) Reverse transcriptase–polymerase chain reaction (RT-PCR) analysis of the indicated transcripts in B-1 cells and B-1 cell-derived phagocytes (B-1CDPs) cultivated for 1, 5 and 10 days. The PCR products amplified using primers that detected myeloid and lymphoid genes were visualized on agarose gels by ethidium bromide staining. The amount of cDNA input was normalized by analysing the control GADPH transcripts. (b) Quantitative PCR analysis of lymphoid and myeloid genes amplified after 32, 35, 38 and 41 cycles. Each point represents the relative mean values of three independent experiments. EBF, early B-cell factor; E2A, E box protein; GADPH, glyceraldehyde 3-phosphate dehydrogenase; G-CSFR, granulocyte colony-stimulating factor receptor; IL, interleukin; IL-7Rα, alpha subunit for IL-7 receptor; M-CSFR, macrophage colony-stimulating factor receptor; Pax5, paired box 5; VH, variable heavy chain 11 or 12; VpreB, surrogate light chain.
IgM expression by B-1CDPs
In experiments shown in Fig. 4, we further confirmed that B-1CDPs retained some lymphoid characteristics. These cells maintained IgM secretion for at least 3 days in culture (Fig. 4a). Cells with lymphoid ancestry would be expected to have undergone immunoglobulin gene rearrangements. In order to confirm that these phagocytes originated from B-1 cells, we analysed immunoglobulin gene rearrangements. It is known that VH11 and VH12, the heavy chain variable (V) genes specific for the membrane phospholipid phosphatidylcholine, occur frequently in B-1 cells.14,18–20 As shown in Fig. 4(b), we found VH11 and VH12 expression in B-1 cells and B-1CDPs. Furthermore, these V genes were continuously expressed by B-1CDPs throughout their differentiation (after 1–10 days; Fig. 4c). In order to exclude the possibility that B-1CDPs could be derived from other cell types such as monocytes, macrophages or other non-characterized precursors in the culture model used here, V-gene expression analyses at the single-cell level were performed. As expected, all B-1CDPs analysed expressed the V gene (Fig. 4d). VH11 was found more abundantly than VH12 in both B-1CDPs and B-1 cells. Therefore, B-1CDPs share V-gene usage with B-1 cells, supporting the notion that this phagocyte is derived from B-1 cells.
Figure 4.
Immunoglobulin M (IgM) expression by B-1 cell-derived phagocytes (B-1CDPs). (a) Measurement of IgM secreted in culture supernatants of B-1b cells, B-1CDPs and bone marrow-derived macrophages (MΦ). Cells were cultivated for 3 days. Mean values of three independent representative experiments are shown. P < 0·001 for comparisons of groups with each other. Mean values of three independent representative experiments are shown. (b) Analysis of heavy chain variable gene VH11 or VH12 expression by macrophages, B-1 cells and B-1CDPs. (c) Analysis of V-gene expression (VH11 or VH12) by B-1CDPs 10 days after B-1 cell differentiation. (d) Products detected by single-cell PCR analyses of the V gene. All single cells sorted were submitted to PCR analysis of GADPH. Only GADPH-positive PCR reactions were selected and the related cDNAs were subjected to PCR analysis using VH11, VH12 and paired box 5 (Pax5) primers. In each experiment, 10 single cells per group were submitted to PCR analyses. The PCR products were visualized on agarose gels by ethidium bromide staining. The amount of cDNA input was normalized by analysing the control GADPH transcripts. Results are representative of three or four independent experiments.
Discussion
The discovery that B-1b cells can be obtained in cultures of adherent mouse peritoneal cells, and that these cells can spontaneously differentiate into mononuclear phagocytes16 unrelated to monocytes, introduced a new candidate for the mononuclear phagocytic system. It is important to note that, in the in vitro system used here, B-1a cells were not able to undergo this differentiation (data not shown), thus indicating a peculiar physiological distinction between B-1a and B-1b cells. Borrello and Phipps,3 however, reported that splenic CD5+ B cells are able to differentiate into phagocytes in the presence of fibroblasts. Nevertheless, they were unable to demonstrate that these cells could differentiate into phagocytes without co-culturing B-1a cells with fibroblasts.
In this report, it has been clearly demonstrated that B-1b cells are able to advance their differentiation status, posing the question as to whether B-1 cells are fully mature cells. Plytycz and Seljelid21 proposed the hypothesis that B-1 cells are ‘living fossils’, suggesting that they are primordial cells in the phylogenesis of the haematopoietic system that resisted full differentiation into the distinct lineages of T, B and macrophage cells. The data herein presented clearly demonstrate that B-1b cells obtained in vitro express myeloid and lymphoid characteristics, although they have a predominant myeloid committed profile after differentiation into phagocytes.
As far as we know, a spontaneously promiscuous expression of transcription factors has not been shown previously. Here we have provided evidence that B-1b cells are promiscuous not only in their surface marker expression, but also in their lineage ‘restricted’ transcription factors. In addition to B cell-specific transcription factors, B-1 cells also display high expression of PU.1 and its related genes (F4/80 and lysozyme), as myeloid cells do. It remains to be determined which molecular pathways allow the coexistence of both myeloid and lymphoid markers in a single cell. For instance, Mikkola et al.22 demonstrated that reversion of B-cell commitment occurs only upon loss of Pax5 expression. In B-1b cells, at least PU.1, F4/80 and lysozyme are simultaneously expressed with Pax5 and other B-specific genes. In addition, the experiments with single cells revealed that B-1b cells contain and express cell V-gene rearrangement, and that this expression is maintained throughout their differentiation, ruling out the possibility that our RT-PCR results were attributable to the presence of two types of cell population.
Although B-1b cells actively express both myeloid and lymphoid programmes, they are able to progress to become predominantly committed to the myeloid lineage. It was also demonstrated that, during the differentiation process, B-1b cells progressively lose the transcription factors associated with lymphoid differentiation while maintaining expression of the transcription factors associated with a myeloid pattern of differentiation. The mediators of this process remain to be uncovered. Nevertheless, this observation indicates that differentiation of B-1 cells into B-1CDPs is under strict molecular control and calls into question whether these cells could be directed towards either plasmocyte-like or T cell-like differentiation. In this context, Sidman et al.23 have demonstrated that peritoneal B-1 cells migrate to the gut epithelium, transforming into B-like cells with the capacity to secrete IgA. Conversely, Tumang et al.24 have demonstrated that B-1a cells express CD5 and Notch-1 transcription factors, both T-cell markers. It is important to mention that B-1b cells express G-CSFR, which is completely absent during their differentiation into B1-CDPs.
Although our results confirm the existence of a new type of mononuclear phagocyte, it is important to clarify that these cells do not have an ontogenetic relationship with monocyte-derived macrophages. These phagocytes clearly originate from B cells, as they are derived from IgM+ CD19+ B220+ cells that lose these markers during their differentiation in vitro.
There is evidence in the literature that B-1 cells migrate from the peritoneal cavity into the gut epithelium to secrete IgA.25 We have demonstrated that B1b cells can migrate from the peritoneal cavity to non-specific inflammation sites where they acquire similar morphology to that of macrophages.16 Evidence that B-1 cells can also influence the fate of the inflammatory process comes from findings that they are necessary in giant cell formation in vivo, 26 down-regulate macrophage functions in vitro via IL-1027 and exert a tolerogenic function in a model of allergic reaction.28 These observations provide an indication of the complex and as yet unknown mechanisms that govern B-1b cell differentiation, fate and function.
The data presented here open new insights to investigate whether B-1 cell differentiation into a novel phagocyte also occurs in vivo, and also whether B-1 cells can be directed towards differentiation into other cell lineages. The mechanisms that lead B-1 cells to express both myeloid and lymphoid programmes, and how these cells govern the commitment to the myeloid lineage after differentiation, are issues currently being investigated.
Acknowledgments
We are indebted to Professor Joao Bosco Pesquero for providing single-cell experiment facilities. This work was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), grant numbers 04/14837-0 and 04/08506-1.
References
- 1.Akashi K, Traver D, Miyamoto T, Weissman IL. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000;404:193–7. doi: 10.1038/35004599. [DOI] [PubMed] [Google Scholar]
- 2.Warren LA, Rothenberg EV. Regulatory coding of lymphoid lineage choice by hematopoietic transcription factors. Curr Opin Immunol. 2003;15:166–75. doi: 10.1016/s0952-7915(03)00011-6. [DOI] [PubMed] [Google Scholar]
- 3.Borrello MA, Phipps RP. Fibroblasts support outgrowth of splenocytes simultaneously expressing B lymphocyte and macrophage characteristics. J Immunol. 1995;155:4155–61. [PubMed] [Google Scholar]
- 4.Boyd AW, Schrader JW. Derivation of macrophage-like lines from the pre-B lymphoma ABLS 8.1 using 5-azacytidine. Nature. 1982;297:691–3. doi: 10.1038/297691a0. [DOI] [PubMed] [Google Scholar]
- 5.Hanecak R, Zovich DC, Pattengale PK, Fan H. Differentiation in vitro of a leukemia virus-induced B-cell lymphoma into macrophages. Mol Cell Biol. 1989;9:2264–8. doi: 10.1128/mcb.9.5.2264-2268.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Sohn CC, Sheibani K, Winberg CD, Rappaport H. Monocytoid B lymphocytes: their relation to the patterns of the acquired immunodeficiency syndrome (AIDS) and AIDS-related lymphadenopathy. Hum Pathol. 1985;16:979–85. doi: 10.1016/s0046-8177(85)80274-4. [DOI] [PubMed] [Google Scholar]
- 7.Hayakawa K, Hardy RR, Parks DR, Herzenberg LA. The “Ly-1 B” cell subpopulation in normal immunodefective, and autoimmune mice. J Exp Med. 1983;157:202–18. doi: 10.1084/jem.157.1.202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Berland R, Wortis HH. Origins and functions of B-1 cells with notes on the role of CD5. Annu Rev Immunol. 2002;20:253–300. doi: 10.1146/annurev.immunol.20.100301.064833. [DOI] [PubMed] [Google Scholar]
- 9.Hardy RR. B-1 B cell development. J Immunol. 2006;177:2749–54. doi: 10.4049/jimmunol.177.5.2749. [DOI] [PubMed] [Google Scholar]
- 10.Kantor AB, Herzenberg LA. Origin of murine B cell lineages. Annu Rev Immunol. 1993;11:501–38. doi: 10.1146/annurev.iy.11.040193.002441. [DOI] [PubMed] [Google Scholar]
- 11.Martin F, Kearney JF. B1 cells: similarities and differences with other B cell subsets. Curr Opin Immunol. 2001;13:195–201. doi: 10.1016/s0952-7915(00)00204-1. [DOI] [PubMed] [Google Scholar]
- 12.Montecino-Rodriguez E, Dorshkind K. New perspectives in B-1 B cell development and function. Trends Immunol. 2006;27:428–33. doi: 10.1016/j.it.2006.07.005. [DOI] [PubMed] [Google Scholar]
- 13.Mercolino TJ, Arnold LW, Hawkins LA, Haughton G. Normal mouse peritoneum contains a large population of Ly-1+ (CD5) B cells that recognize phosphatidyl choline. Relationship to cells that secrete hemolytic antibody specific for autologous erythrocytes. J Exp Med. 1988;168:687–98. doi: 10.1084/jem.168.2.687. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Mercolino TJ, Locke AL, Afshari A, Sasser D, Travis WW, Arnold LW, Haughton G. Restricted immunoglobulin variable region gene usage by normal Ly-1 (CD5+) B cells that recognize phosphatidyl choline. J Exp Med. 1989;169:1869–77. doi: 10.1084/jem.169.6.1869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Borrello MA, Phipps RP. The B/macrophage cell: an elusive link between CD5+ B lymphocytes and macrophages. Immunol Today. 1996;17:471–5. doi: 10.1016/0167-5699(96)20031-b. [DOI] [PubMed] [Google Scholar]
- 16.Almeida SR, Aroeira LS, Frymuller E, Dias MA, Bogsan CS, Lopes JD, Mariano M. Mouse B-1 cell-derived mononuclear phagocyte, a novel cellular component of acute non-specific inflammatory exudate. Int Immunol. 2001;13:1193–201. doi: 10.1093/intimm/13.9.1193. [DOI] [PubMed] [Google Scholar]
- 17.Hug A, Storch-Hagenlocher B, Haas J, Vogt-Schaden ME, Goldschmidt H, Wildemann B. Single-cell PCR analysis of the immunoglobulin heavy-chain CDR3 region for the diagnosis of leptomeningeal involvement of B-cell malignancies using standard cerebrospinal fluid cytospins. J Neurol Sci. 2004;219:83–8. doi: 10.1016/j.jns.2003.12.012. [DOI] [PubMed] [Google Scholar]
- 18.Hardy RR, Wei CJ, Hayakawa K. Selection during development of VH11+ B cells: a model for natural autoantibody-producing CD5+ B cells. Immunol Rev. 2004;197:60–74. doi: 10.1111/j.0105-2896.2004.0100.x. [DOI] [PubMed] [Google Scholar]
- 19.Seidl KJ, MacKenzie JD, Wang D, Kantor AB, Kabat EA, Herzenberg LA, Herzenberg LA. Frequent occurrence of identical heavy and light chain Ig rearrangements. Int Immunol. 1997;9:689–702. doi: 10.1093/intimm/9.5.689. [DOI] [PubMed] [Google Scholar]
- 20.Seidl KJ, MacKenzie JD, Wang D, Kantor AB, Kabat EA, Herzenberg LA, Herzenberg LA. Recurrent identical rearrangement and repeated expression of identical heavy and light chains in single anti-phosphatidylcholine B cells. Ann N Y Acad Sci. 1997;815:484–8. doi: 10.1111/j.1749-6632.1997.tb52110.x. [DOI] [PubMed] [Google Scholar]
- 21.Plytycz B, Seljelid R. B-1/macrophages as ‘living fossils’. Immunol Today. 1997;18:505. doi: 10.1016/s0167-5699(97)82523-6. [DOI] [PubMed] [Google Scholar]
- 22.Mikkola I, Heavey B, Horcher M, Busslinger M. Reversion of B cell commitment upon loss of Pax5 expression. Science. 2002;297:110–3. doi: 10.1126/science.1067518. [DOI] [PubMed] [Google Scholar]
- 23.Sidman CL, Shultz LD, Hardy RR, Hayakawa K, Herzenberg LA. Production of immunoglobulin isotypes by Ly-1+ B cells in viable motheaten and normal mice. Science. 1986;232:1423–5. doi: 10.1126/science.3487115. [DOI] [PubMed] [Google Scholar]
- 24.Tumang JR, Hastings WD, Bai C, Rothstein TL. Peritoneal and splenic B-1 cells are separable by phenotypic, functional, and transcriptomic characteristics. Eur J Immunol. 2004;34:2158–67. doi: 10.1002/eji.200424819. [DOI] [PubMed] [Google Scholar]
- 25.Hayakawa K, Hardy RR, Herzenberg LA. Peritoneal Ly-1 B cells: genetic control, autoantibody production, increased lambda light chain expression. Eur J Immunol. 1986;16:450–6. doi: 10.1002/eji.1830160423. [DOI] [PubMed] [Google Scholar]
- 26.Bogsan CS, Novaes e Brito RR, Palos Mda C, Mortara RA, Almeida SR, Lopes JD, Mariano M. B-1 cells are pivotal for in vivo inflammatory giant cell formation. Int J Exp Pathol. 2005;86:257–65. doi: 10.1111/j.0959-9673.2005.00433.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Popi AF, Lopes JD, Mariano M. Interleukin-10 secreted by B-1 cells modulates the phagocytic activity of murine macrophages in vitro. Immunology. 2004;113:348–54. doi: 10.1111/j.1365-2567.2004.01969.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.De Lorenzo BH, Brito RR, Godoy LC, Lopes JD, Mariano M. Tolerogenic property of B-1b cells in a model of allergic reaction. Immunol Lett. 2007;114:110–8. doi: 10.1016/j.imlet.2007.09.013. [DOI] [PubMed] [Google Scholar]




