Abstract
A new role for the plant growth-promoting nitrogen-fixing endophytic bacteria Gluconacetobacter diazotrophicus has been identified and characterized while it is involved in the sugarcane-Xanthomonas albilineans pathogenic interactions. Living G.diazotrophicus possess and/or produce elicitor molecules which activate the sugarcane defense response resulting in the plant resistance to X. albilineans, in this particular case controlling the pathogen transmission to emerging agamic shoots. A total of 47 differentially expressed transcript derived fragments (TDFs) were identified by cDNA-AFLP. Transcripts showed significant homologies to genes of the ethylene signaling pathway (26%), proteins regulates by auxins (9%), β-1,3 Glucanase proteins (6%) and ubiquitin genes (4%), all major signaling mechanisms. Results point toward a form of induction of systemic resistance in sugarcane-G. diazotrophicus interactions which protect the plant against X. albilineans attack.
Key Words: Gluconacetobacter diazotrophicus, elicitors, sugarcane, Xanthomonas albilineans
Introduction
Sugarcane is an economically important monocotyledon with a unique capacity of accumulating high amounts of sucrose in its stems. It belongs to the grass family (Poaceae), like rice, maize, wheat and sorghum. Sugarcane can specifically interact with Gluconacetobacter diazotrophicus, a nitrogen-fixing bacterium.1 Unlike rhizobium/leguminosae symbiosis, where bacteria are restricted to nodules, these diazotrophs are endophytic, colonizing intercellular spaces and vascular tissues of most plant organs without causing damage to the host.1,2 They promote plant growth possibly by fixing nitrogen and also by the production of plant hormones.3,4 Nevertheless, little is know about the signaling mechanisms that are involved in the establishment of this particular type of endophytic interaction.
Primary experiments to find out which plant molecular mechanisms are involved in this interaction were performed, by searching for ESTs that are preferentially or exclusively represented in cDNA libraries from plants inoculated with G. diazotrophicus or Herbaspirillum rubrisubalbicans. The results reported suggest that the plant is actively involved in the interaction.5 Several of the identified genes are possibly involved in different processes of plant/bacteria signaling, including ESTs codifying for defense-related proteins.6,7 More recently, a sugarcane protein (SHR5), structurally similar to receptors related to defense against pathogens, was shown to be repressed in plants associated with endophytic bacteria.8
During any plant-microorganism interactions, the plant defense network is regulated by complex cross-talking signaling and transduction pathways, which determine whether the interaction will be successful or not.9 In sugarcane, polysaccharides and tannins accumulation in the parenchyma cells has been observed around the metaxylem of clone Ja60-5, what suggests that the plant defense system is activated during interaction with G. diazotrophicus.10 No hypersensitive response has been observed after inoculation of leaves and stems of cv. SP70-1143 with G. diazotrophicus. Extracellular matrix is accumulated around bacterial cells in the protoxylem and xylem parenchyma.11
An endophytic bacterium is being considered as an alternative or a supplemental way of reducing the use of chemicals in agriculture to control phytopathogens.12 The mechanisms of biocontrol mediated by endophytic bacteria are competition for an ecological niche or a substrate, production of inhibitory allelochemicals, and induction of systemic resistance (ISR) in host plants to a broad spectrum of pathogens and/or abiotic stresses.13
Leaf scald disease of sugarcane is a finely balanced host-pathogen interaction with prolonged latent infection.14 The systemic vascular pathogen Xanthomonas albilineans causes the characteristic chlorotic symptoms (white pencil line) of leaf scald by blocking plastid DNA replication, what may also represent a key factor in systemic invasion or the transition from latent infection to disease.15 Our preliminary observations in field conditions showed that when leaf scald-susceptible sugarcanes were inoculated with the endophytic G. diazotrophicus, X. albilineans presence was not confirmed (unpublished).
All these considerations taken together suggest that G. diazotrophicus could modulate expression of sugarcane genes that may lead to resistance against leaf scald disease.
To support this hypothesis, a genomic study of the interaction sugarcane-Gluconacetobacter diazotrophicus- Xanthomonas albilineans is conducted for the first time. A differentially-expressed transcript profile has been identified during this complex interaction; moreover, an elicitation of plant defense mechanism against pathogenic bacteria has been demonstrated. By using the sugarcane-diazotrophic bacteria interaction as a model, this article tries to enlighten the role of endophytic organisms in plant defense response.
Materials and Methods
Plant materials.
Sugarcane plantlets (cv. SP70-1143) free of microorganisms were obtained by sterile meristem culture and micropropagated according to the method of Hendre et al.16 Cultures were maintained at 110 mE m−2 s−1 luminosity, 12 h photoperiod, at 27°C. Vigorous and pathogen-free plants 15 days old (after subcultures) were selected for experiments. During two weeks plants were kept in greenhouse for ex vitro rooting in AIA 10 mgL−1 solution.
Bacterial cultures and plant infection.
Both strains proceeded from the microorganism collection of the National Institute for Sugarcane Research, Havana, Cuba. Endophytic bacteria Gluconacetobacter diazotrophicus (SRT1) were grown in medium composed by glucose 2 gL−1, peptone C 1.5 gL−1, yeast extract 2 gL−1, K2HPO4 0.5 gL−1, MgSO4 × 7 H2O 0.5 gL−1, glutamic acid 1.5 gL−1, pH 6.0. System pathogenic bacteria Xanthomonas albilineans (Serobar 1) were grown in medium containing sucrose 10 gL−1, peptone C 5 gL−1, K2HPO4 0.5 gL−1, MgSO4 × 7 H2O 0.25 gL−1, NaSO3 0.025 gL−1, pH 6.9–7.0. Both cultures were kept at 200 rpm, in the dark, at 37°C up to exponential growth (D.O:0.9-1). For mechanical infection, roots, stems and apical meristems of sugarcane plants, grown in greenhouse, were carefully and superficially wounded, by surgical blades previously immersed in separated bacteria cell suspension of G.d or X.a. After a 30 minutes of water stress, plants were immersed for 15 minutes into the respective bacteria culture.
Characterization of the biological activity.
Micropropagated sugarcane plants were both rooted and infested with G.d or X.a as previously described. Time between infections was seven days. After the cross infection, plants were maintained in vessels containing a mixture (1:1) of sterile soil:vermiculite at greenhouse conditions. A total of 30 plants were considered per experimental treatment as it follows:
1.- Sugarcane plants — G.d — X.a
2.- Sugarcane plants — G.d (cell debris) — X.a
3.- Sugarcane plants — X.a — G.d
4.- Sugarcane plants — X.a — G.d (cell debris)
5.- Sugarcane plants — X.a
6.- Sugarcane plants — G.d
7.- Culture media — X.a — G.d
8.- Culture media — G.d— X.a
Cell debris of G.diazotrophicus was prepared as it follows: a volume of 100 mL G.d culture (D.O:0.9-1) was centrifuged at 5000 rpm; the pellet was mortared in a pestle with liquid N2. Before their use, cell debris was suspended in 1 mL of sterile distilled water.
For treatments 7 and 8, 100 mL of sugarcane micropropagation media was inoculated with 1mL of bacterial suspension of G.d and X.a (D.O:0.9-1). Cultures were maintained at 150 rpm, in the dark, at 37°C.
Bacterial detection by polymerase chain reaction.
For a period of 60 days, an assessment of bacterial incidence (both X.a and G.d) was carried out while sugarcane secondary shoots were emerging from the primary plants.
For treatments 1–6, 1 gr of leaf tissues from five sugarcane plants were macerated in 2mL of distilled sterile water. A sample of 10 µL was used for PCR reactions. For treatments 7 and 8, 1 mL of cultures was reinoculated to the respective bacteria medium for 24 h in the same previously described conditions. A sample of 10 µL culture was used for PCR amplifications.
Detection of albicidin (alb) gene expression from X.albilineans was made by nested PCR, according to previously established conditions.17 Primary primers were XaAlb2-f3 (CACACACACAATACAGCATTGCGG) and XaAlb2-r3 (CCCAACTTACTTGAGGCTATGG). Secondary nested primers were XaAlb2-f4 (CTTCTGCAGCTTGCTCGTC) and XaAlb2-r4 (GCTCAGTTACGCTCAGCTAATC). Thermocycler parameters were:denaturation at 94°C for 4 min, followed by 31 cycles of 94°C for 30 s, 55°C for 30 s, and 65°C for 1 min; and final extension of 65°C for 3 min.
Amplification of 23S ribosomal RNA from G. diazotrophicus was conducted with the primers Ad (TGCGGCAAAAGCCGGAT) and HerbaGd (GTTGGCTTAGAAGCAGCC). PCR conditions were: 94°C for 3 min; 30 cycles of 94°C for 30 s, 56°C for 30 s and 65°C for 1 min; and final extension of 72°C for 3 min. All PCR products were submitted to electrophoresis in 1.0% agarose gels and visualized with ethidium bromide under U.V. light.
Characterization of the plant genomic response.
Experiments were conducted in greenhouse conditions by using ex vitro rooted plants. Plants were maintained in containers with a 0.5 cm lamina of distilled water. Design was as it follows:
Treatment I (G.d → X.a). A total of 30 sugarcane plants (cv. SP70-1143) were firstly infected with G. diazotrophicus and after seven days with pathogenic bacteria X. albilineas.
Treatment II (X.a → G.d). A total of 30 sugarcane plants (cv. SP70-1143) were firstly infected with the pathogen m and after seven days with symbiotic bacteria G. diazotrophicus.
For genomic analysis, five plants per treatment were mixed and considered as a unique sample at T0 (immediately after cross infection), T1, T2 and T3 time (one, three and seven days after cross infection), respectively.
AFLP-cDNA analysis.
Approximately 500 mg of leaf tissues per treatment was harvested and immediately frozen in liquid N2. Materials were ground to a fine powder in a precooled pestle, mortared under liquid N2 and then used for RNA purification by a commercial system (PROMEGA, cat. #Z3100). RNAs were quantified in spectrophotometer by determining the relation 260/280 and 260/230. cDNA synthesis was made by using a Universal RiboClone® System (PROMEGA, cat. #C4360). AFLP-cDNA analysis was made following the procedures reported by Bachem et al.18,19 cDNA was digested with AseI and TaqI restriction enzymes and the PCR reactions were conducted by using combinations of the AseI/TaqI primers listed in Table 1. AFLP products were separated in polyacrilamide gel 9% and evidenced by silver staining procedure (PROMEGA, cat. # Q4130).
Table 1.
Primers used in AFLP analysis
| Primer | Core sequence | SN* |
| AseI-1 | 5′- GAC TGC GTA CCT AAT | aty |
| AseyI-2 | 5′- GAC TGC GTA CCT AAT | cg |
| TaqI-1 | 5′- GAT GAG TCC TGA CCG A | ta |
| TaqI-2 | 5′- GAT GAG TCC TGA CCG A | gt |
| TaqI-3 | 5′- GAT GAG TCC TGA CCG A | ca |
Selective nucleotides.
Sequencing and data mining of polymorphic bands.
Polymorphic TDFs (transcript derived fragments) were marked, cut out and incubated in 150 mL of TE (10 mM Tris, pH 7.5, and 1 mM EDTA, pH 8.0), overnight, at 37°C. Extracted target bands were used as template for reamplification (PCR). Sequences were determined by an automatic sequencer (Perkin-Elmer ABI PRISM Dye Terminator Cycle sequencing kit and ABI Model 377 DNA sequencer), using the respective AFLP adapters as primers. BLASTX sequence alignment program20 was used to compare nucleotide sequences with those contained in the GenBank, EMBL and DDBJ databases. A search for sequence homologies in the TIGR Sugarcane (Saccharum officinarum) EST database of Gene Indices (SoGI), was also carried out using AFLP-cDNA produced bands.
Confirmation of differential expression.
For selected TDFs the differential expression was confirmed by Northern blots. Total RNAs (10 µg) corresponding with the cDNA-AFLP treatments were electrophoresed on a 1.2% agarose / 0.4 M formaldehyde RNA gel and transferred to Hybond N+ nylon membranes (Amersham-Pharmacia, Buckinghamshire,UK). For internal control the 18S rRNA transcript was used. Probes were made from PCR amplified fragments of selected clones using the ReadyPrime random primed DNA labeling kit (Amersham-Pharmacia, Buckinghamshire, UK) with (32P) (ICN Biomedicals, Irvine, CA). Blots were hybridized and washed according to standard procedures.21
Results
Biological activity characterization.
In order to characterize the biological activity during the sugarcane-G. diazotrophicus-X.albilineans interaction, micropropagated plants were cross-infected in two ways: with G.d followed by X.a (treatment 1) and vice versa (X.a followed by G.d:treatment 3). Experimental controls include treatments using G.d cell debris,2,4 plants inoculated either with X.a or G.d5,6 and, treatments including both bacterial cultures growing in sugarcane micropropagation media.7,8
The presence (and also the transmission) of both X.a and G.d for five sugarcane generation shoots, emerged from the infected plants, was measured by PCR. This strategy was conducted considering that, under environmental standard conditions, both the pathogenic bacteria X.a and the endophytic G.d should grow inside the sugarcane tissues and, in addition, could be propagated in asexual shoots from a primary infected plant. A first evaluation was made seven days after the cross inoculation and was repeated up to the 5th shoots for 60 days.
A summary of PCR experiments for the interactions characterization is shown in Table 2. Figure 1 displays the migration of the amplified fragments, where 440 bp fragments correspond to alb gene of X.a (A and B) and 500 bp fragments correspond to 23S ribosomal RNA gene from G. d (C and D).
Table 2.
Summary of PCR experiments for the characterization of the sugarcane (cv. SP70-1143) - X. albilineans - G. diazotrophicus interactions
| Treatment | Primary Plant | 3rd Shoot | 5th shoot | |||
| G.d | X.a | G.d | X.a | G.d | X.a | |
| 1. Plants — G.d — X.a | x | x | x | - | x | - |
| 2. Plants — G.d (cell debris) — X.a | - | x | - | x | - | x |
| 3. Plants — X.a — G.d | x | x | x | x | x | - |
| 4. Plants — X.a - G.d (cell debris) | - | x | - | x | - | x |
| 5. Plants — X.a | - | x | - | x | - | x |
| 6. Plants — G.d | x | - | x | - | x | - |
| 7. Medium — X.a — G.d | x | x | x | x | x | x |
| 8. Medium — G.d — X.a | x | x | x | x | x | x |
(—) Seven days interval, (x) presence, (-) absence.
Figure 1.
Amplification of the alb gene of X.albilineans (A and B) and the 23S ribosomal RNA gene from G. diazotrophicus (C and D) during the interactions sugarcane-X. albilineans- G. diazotrophicus. 1–8: Treatments (see Materials and Methods and Table 2). C+:PCR of X.a or G.d colonies growing in their respective solid medium. C-:PCR of sterile culture media for X.a or G.d without bacterial inoculation.
Plants submitted to treatment 1, in which G.d was first inoculated (before the pathogen X.a), shows no amplification signal for the alb gene of X.a in 3rd and 5th shoots, but the 440 bp fragment was present when plants were inoculated with G.d cell debris (treatment 2). When X.a was inoculated before G.d (treatment 3), the alb gene was amplified in 3rd shoots but not in 5th. X.a presence was demonstrated up to 5th shoots when plants were inoculated with G.d cell debris (treatment 4). In treatments 1 and 3, inoculated with living G.d culture, a 500 bp band was amplified corresponding to 23S ribosomal RNA gene from G.d.
In treatments 7 and 8, the pathogen X.a and the endophytic G.d were cross-inoculated in plant micropropagation media. In both cases, two bands, corresponding to 440 bp and 500 bp, were amplified indicating that bacteria (pathogen and endophyte) could survive in plant micropropagation media up to 60 days. As expected, control treatments,5,6 corresponding to plants inoculated with single X.a or G.d, show the amplification signals up to the 5th shoots.
According to the results, it is possible to verify if the symbiotic G.diazotrophicus could elicit a plant defense response against the systemic pathogen X.albilineans. This would be supported by the fact that X.a control was reached only when sugarcane plants were present in association with G.d (treatments 1 and 3). In these cases, the presence of the pathogen X.a and the endophytic bacteria G.d was confirmed in primary plants, whereas X.albilineans was not present in 3rd shoots (treatment 1) and, in 5th shoots for treatment 3. Furthermore, when sugarcane plants were inoculated with G.d cell debris, amplification signals for living G.d were not obtained, while the presence and transmission of the pathogen X.a was seen for the whole experiment. G.d itself probably is not responsible for this effect as, during the treatments, when X.a and G.d were inoculated in micropropagation media without sugarcane plants, both bacteria strains could stay alive, as demonstrated by the amplification signals; when they were reinoculated in their respective bacteria grow media.
Results pointed that, during the first days of the sugarcane-G.d interactions, a plant signaling pathway was activated and its effects could be responsible for the X.a cells control. As the X.a presence was always demonstrated in primary infected plants, this control should be done on cell division and/or on virulence mechanism in X.a, for instance in the bacterial transmission to the new agamic shoots.
Genomic characterization.
A genomic characterization of the transcript profiles was made for the sugarcane-G.d-X.a interactions. Considering the previous results, during the first 7 days after the cross inoculation, a differential gene expression was monitored by AFLP-cDNA. cDNA was synthesized from plant mRNA, that was isolated just after the cross inoculation (T0-controls) and after one day (T1); three days (T2); and seven days (T3). Considering the presence or the absence of signals, as well as its intensity, TDFs were observed as differentially expressed. A total of 47 different TDFs were identified by using six copy primers. Polymorphic bands were immediately excised from the gels and reamplified for direct sequencing. BLAST analysis20 were conducted to look for homologies and functions in public databases. Figure 2 shows sections of AFLP gels, displaying some of the different transcript derived fragments (TDFs) that were amplified.
Figure 2.
Section of AFLP-cDNA gels (9% polyacrilamide) showing differentially expressed TDFs (transcript derived fragments) in the Saccharum spp- Xanthomonas albilineans-Gluconacetobacter diazotrophicus interaction. Bands were evidenced by AgNO3 staining (Promega, USA), and the size of differential TDF was determined by direct sequencing. Copy primers A: AseI-1/TaqI-1; B: AseI-1/TaqI-2; C: AseI-1/TaqI-3; D: AseI-2/TaqI-1 I.- Plants inoculated firstly with G.d and after 7 days with the pathogenic bacterium X.a. II.- Plants infected with the pathogen X.a and after 7 days inoculated with G.d. T0.- Control treatments, just after cross inoculation: T1 - one day; T2- three days; T3- seven days.
A summary of the diverse types of differential transcriptional patterns obtained, and of the TDFs homologies in public databases, is shown in Table 3. A total of 26 sugarcane transcripts were induced only in G.d → X.a treatment, the most common differential pattern. Other 13 cDNA fragments were first induced in G.d → X.a, and had their induction delayed in X.a → G.d treatment. Six transcripts were induced in G.d → X.a whereas suppressed in X.a → G.d. Only one transcript was induced in X.a → G.d treatment, and another one had its expression suppressed under this conditions. For example, both 653 bp and 508 bp fragments, with homologies to a transcription factor to ethylene response and Sucrose-phosphate synthase were, respectively, induced first in G.d → X.a treatment (one day after the cross inoculation) and then in X.a → G.d treatment (corresponding to the third and seventh day (Fig. 2A and B). The 391 bp, 382 bp and 487 bp fragments, with nonsignificant homologies and unknown function in databases, were only induced in the G.d → X.a treatment (Fig. 2C and D).
Table 3.
Differential TDFs amplified in the Saccharum spp .- G. diazotrophicus - X. albilineans interactions
| TDF1 | Size (bp) | Homology2 | Protein3 | E-value4 | G.d → X.a treatment5 | X.a → G.d treatment6 | ||||||
| T0 | T1 | T2 | T3 | T0 | T1 | T2 | T3 | |||||
| 1 | 661 | XP_468441 (O. sativa) | Ethylene receptor | 7e-42 | x | x | ||||||
| 2 | 653 | AAM00285 (O. sativa) | Transcription factor to ethylene response | 1e-50 | x | x | xx | x | ||||
| 3 | 613 | CAD56466 (T. aestivum) | Transcription factor to ethylene response | 3e-52 | x | x | ||||||
| 4 | 608 | AAF04899 (A. thaliana) | Induced protein by auxin - Aux/IAA | 1e-31 | x | x | ||||||
| 5 | 550 | AAA33401 (L.usitatissimum) | Ubiquitin | 1e-54 | x | xx | ||||||
| 6 | 544 | AAP92744 (O. sativa) | Transcription factor to ethylene response | 4e-06 | x | xx | x | |||||
| 7 | 543 | XP_466220 (O. sativa) | Transcription factor for auxin response - ARF1 | 1e-36 | x | x | xx | |||||
| 8 | 529 | - | - | - | x | x | x | |||||
| 9 | 508 | BAA19242 (S. officinarum) | Sucrose-phosphate synthase | 2e-60 | x | x | x | x | x | |||
| 10 | 505 | BAD82174 (O. sativa) | Ribosomal protein 60S | 4e-63 | x | x | ||||||
| 11 | 494 | BAD54446 (O. sativa) | Xiloglucan endotransglycosilase | 1e-42 | x | x | ||||||
| 12 | 487 | TC70637* | - | 4e-100* | x | x | xx | |||||
| 13 | 480 | XP_475484 (O. sativa) | Transcription factor to ethylene response | 4e-36 | x | xx | xxx | x | x | |||
| 14 | 472 | XP_468566 (O. sativa) | Transcription factor BTF3 | 3e-27 | x | x | ||||||
| 15 | 444 | BU925674* | - | 1e-93* | x | x | ||||||
| 16 | 437 | TC61807* | - | 2e-89* | x | x | ||||||
| 17 | 436 | AAV98702 (O. sativa) | Transcription factor to ethylene response | 7e-59 | x | x | x | |||||
| 18 | 428 | - | - | - | x | xx | ||||||
| 19 | 424 | AAQ20898 (O. sativa) | Transcription factor to ethylene response | 5e-25 | x | x | x | |||||
| 20 | 420 | TC56550* | - | 1e-81* | x | x | ||||||
| 21 | 401 | AAQ06261 (S. bicolor) | β- 1,3 Glucanase | 8e-30 | x | x | x | |||||
| 22 | 391 | NP_176303 (A. thaliana) | - | 7e-05 | x | xx | ||||||
| 23 | 382 | - | - | - | x | x | x | |||||
| 24 | 373 | BAB84334 (O. sativa) | UDP- glucuronic acid descarboxilase | 4e-33 | x | x | x | x | ||||
| 25 | 371 | XP_481608 (O. sativa) | Endo-ribonuclease | 8e-18 | x | x | x | x | ||||
| 26 | 368 | - | - | - | x | xx | xx | x | x | |||
| 27 | 359 | XP_482965 (O. sativa) | F0 ATP synthase from Mitocondria | 8e-31 | x | x | x | |||||
| 28 | 357 | XP_550382 (O. sativa) | Induced protein by auxin - Aux/IAA | 3e-32 | x | xx | ||||||
| 29 | 354 | AAP53941 (O. sativa) | Transcription factor to ethylene response | 4e-21 | x | x | x | xxx | ||||
| 30 | 341 | XP_468441 (O. sativa) | Ethylene receptor | 1e-13 | x | x | x | |||||
| 31 | 325 | TC50195* | - | 1e-65 | x | x | x | x | ||||
| 32 | 318 | AAG33924 (R. pseudoacacia) | Protein regulated by auxin | 8e-15 | x | x | x | x | ||||
| 33 | 309 | AAT38997 (B. vulgaris) | Protein ligating of RNA | 7e-29 | x | x | x | |||||
| 34 | 305 | XP_479969 (O. sativa) | β- 1,3 Glucanase | 2e-32 | x | x | ||||||
| 35 | 293 | XP_550431 (O. sativa) | Glutamine tRNA synthetase | 2e-16 | x | x | x | x | ||||
| 36 | 291 | AAX95628 (O. sativa) | Transposable element | 3e-05 | x | xx | x | x | ||||
| 37 | 288 | XP_476644 (O. sativa) | β- 1,3 Glucanase | 9e-16 | x | x | x | |||||
| 38 | 260 | XP_475484 (O. sativa) | Transcription factor to ethylene response | 1e-19 | x | xx | xxx | x | x | |||
| 39 | 251 | AAT85197 (O. sativa) | - | 1e-20 | x | x | x | x | ||||
| 40 | 245 | TC48467* | - | 2.4e-48 | x | x | x | x | x | |||
| 41 | 243 | AAP53387 (O. sativa) | Transcription factor to ethylene response | 1e-18 | x | x | x | |||||
| 42 | 243 | CAG30776 (E. globulus) | Ubiquitin | 3e-20 | x | x | x | x | x | |||
| 43 | 241 | AAP83936 (G. hirsutum) | Transcription factor DREB | 1e-07 | x | xx | ||||||
| 44 | 237 | AAF40112 (O. sativa) | Photomorphogenic element | 4e-05 | x | x | ||||||
| 45 | 232 | XP_467394 (O. sativa) | Response element to ethylene | 5e-14 | x | xx | x | |||||
| 46 | 232 | XP_483731 (O. sativa) | - | 5e-05 | x | x | x | x | ||||
| 47 | 227 | TC50866* | - | 1e-38* | x | x | ||||||
Transcript derived fragment (TDF) codices corresponding to polymorphism band in acrylamide gel.
Sequences were compared with those deposited in the protein database NCBI (BLASTX program), ESTs sugarcane database of TIGR Gene Indice (*), and ESTs database of NCBI () (TBLASTX program). Access number of protein, EST with significant homology and corresponding specie are showed.
Identification of homologue protein. Symbol “-” represent an EST without significative homology to protein with knows functions.
E-value alignment with the most homologue sequence in databases.
G.d→X.a treatment. Sugarcane plants inoculated firstly with G. diazotrophicus and after seven days with the pathogenic bacteria X. albilineas.
X.a → G.d treatment. Sugarcane plants inoculated firstly with the pathogen X. albilineans and after seven days with the symbiotic bacteria G. diazotrophicus.
It is noticeable that at T0 time (control), the amplification patterns were high similar in both treatments (G.d → X.a and X.a → G.d), as shown in Figure 2. As this correspondence was obtained with six copy primers, it could be possible that AFLP-cDNA is not able to detect a low number of transcript copies that could be induced during the first seven days after (a) single interaction(s). Nevertheless, strong and reproducible polymorphic signals were identified 24 h after the cross inoculation. These results point out the elicitation of a more complete plant response when both endophyte and pathogen coexist.
The categorization on the basis of TDFs function is also shown in Table 3. A total of 14 TDFs (31%) did not show significant homologies with genes of known function reported in public databases. Twelve TDFs (26%) were found to be related to the ethylene signaling pathway, including receptors and transcription factors. This was the major number of the identified TDFs for the same linked function. With four TDFs (9%), proteins related to the auxins pathway represented the second most important index of known function. Genes for both β-1,3 Glucanases and related to transduction were represented by three TDFs (6%) each one. Two TDFs (4%) were homologues to ubiquitin genes. Transposable and morphogenesis elements, endoribonucleases, BTF3 and DREB transcription factors, Sucrose-phosphate synthase, UDP-glucuronic acid decarboxilase and Xiloglucan-endotransglicosilase (XET) were only represented by one TDF (2% each one).
In order to confirm the amplified patterns obtained by cDNA-AFLP, Northern analyses were conducted for some selected TDFs. Figure 3 substantiate that TDFs 17 and 37, codifying to a transcription factor of ethylene response and a β-Glucanase protein, respectively, were up-regulated after 24 h in the G.d → X.a treatment. Others two transcription factors to ethylene responses (codices 6 and 41), were up-regulated three days after cross inoculation in the G.d → X.a treatment, while were induced at 7th day in the X.a → G.d treatment. An auxin-induced protein (TDF 28) was upregulated after three days in G.d → X.a, whereas was not induced in the X.a → G.d treatment. These data are in accordance with the differences in gene expression detected by cDNA-AFLP. As expected, in both blots control 18S rRNA transcript showed similar hybridization signals.
Figure 3.
RNA blot analysis for differentially amplified TDFs identified during the Saccharum spp.- G. diazotrophicus - X. albilineans interactions. RNA blots were performed with 10 µg of total RNA per lane. T0 (immediately after cross infection), T1, T2 and T3 time (one, three and seven days after cross infection), respectively. For codices description see Table 3.
Discussion
The objective of this study was to use sugarcane plants, free of microorganisms, as a model to evaluate if G. diazotrophicus is capable to induce plant defense mechanisms responsible for diseases protection. Moreover, we intend to initiate the molecular characterization of sugarcane-G. diazotrophicus-X. albilineans interaction, in order to detect plant genes potentially involved in this association.
Considering the presence of both endophyte and pathogen, demonstrated by PCR, in all treatments in which sugarcane plants were cross-inoculated with G.d and X.a or vice-versa, we confirmed the effectiveness of our experimental design. Besides, we verified that the treatment in which sugarcane plants were inoculated initially with the endophyte and, seven days later, with the pathogenic agent, works as a “preventive” treatment, since the pathogenic bacteria levels inside the plants were rapidly decreased (after the 3rd shoots). The inverse treatment, where the pathogen was inoculated first, showed that G. diazotrophicus can also induce control of Xanthomonas but after some time (later than 5th shoots). This fact could be explained by the lowest number of differentially expressed TDFs (44.6%) which were identified in treatment X.a-G.d during the first 7 days after cross-inoculation. Gluconacetobacter did not demonstrated direct effect on X.albilineans growth, since PCR data showed that both bacteria species continued to be detected when they were grown at the same time without the plants' presence for the whole duration of the experiments.
The results presented in this work suggest that G. diazotrophicus is capable of generating plant defense responses against its systemic pathogen X. albilineans. Our results imply the participation of different signal pathways that could be involved in the sugarcane-G. diazotrophicus-X. albilineans interaction. Nevertheless, a major signaling mechanism that, once induced, determined a sugarcane resistance the pathogen X.albilineans was identified by AFLP-cDNA.
The major number of TDFs (26%) corresponded to the ethylene signaling pathway, including two receptors and ten transcription factors. A group of TDFs (9%), corresponding to proteins regulated by auxins was the second most frequent identified in our analysis. An overlap between the signaling pathways of ethylene and auxins has been reported22 and auxin response has been related to ethylene biosynthesis.23 In addition, gene expression studies correlating ethylene and auxin pathways, as well endogen hormone levels, confirmed that both plant hormones were involved in pathogenic interactions.24
Ethylene induces transcription in different genes, i.e., those codifying Cellulase, Chitinases, β-1,3 Glucanases, Peroxidases, Chalcone synthase, as well as others pathogenesis-related (PR) proteins.25,26 In addition, Penmetsa and Cook27 described an insensitive ethylene mutant (skl-1) displaying a super infective phenotype to the symbiotic Rhizobium, which illustrate a strong negative effect of ethylene in both infection and nodulation processes in legume plants. The role of ethylene in legume-rhizobia symbiosis is probably to keep the number of nodules and bacteria levels under control.28 Our evidences suggest that gramineous plants may also use the ethylene pathway (also including other protein synthesis induced by this hormone) to control the number of G. diazotrophicus cells colonizing their tissues.
Recent studies reinforce molecular data about the ethylene role during the G.diazotrophicus-sugarcane interactions, which were analyzed by our research group. The expression of erad1 ethylene receptor was significantly induced during the benefic endophytic interaction, and was drastically suppressed in pathogenic associations. Despite the apparent beneficial and nonpathogenic aspects of the association between endophytic bacteria and sugarcane, it is reasonable to expect that, to control endophyte colonization and overgrowth, sugarcane might have evolved mechanisms of bacteria recognition, leading to defense responses against the endophytes until the establishment of an efficient association.5,8
A total of three TDFs (6 %), with homologies to β-1,3 Glucanase proteins, was identified in the sugarcane-G. diazotrophicus-X. albilineans interactions. A characteristic plant response to microbial attack is the production of endo- β-1,3-Glucanases, which are thought to play an important role in plant defense, either directly, through the degradation of β-1,3/1,6-glucans in the pathogen cell wall, or indirectly, by releasing oligosaccharide elicitors that induce additional plant defenses.29 Moreover, β-1,3 Glucanases have been correlated to the systemic acquired resistance (SAR) in plant-pathogen interactions, since β-1,3 gluc mutant plants are not able to develop SAR.30 Differential expression of TDFs homologues to β-1,3 glucanase genes, during the sugarcane-G. diazotrophicus-X. albilineans interactions, could also support the hypothesis that defense signaling pathways should be related with the protective effect produced by endophytic benefic interactions.
It is possible to suggest that the control of endophytic population maintains the plant defense on the alert. This permanent “vigilance” status, produced by the plant signaling, could comprise the expression of defense proteins, originating a form of systemic resistance in sugarcane. G.d may induce in sugarcane particular protection mechanisms, as the induction of ethylene pathway, which normally will not be triggered by a pathogenic microorganism, as we saw in X. albilineans attack, since in AFLP experiments where sugarcane plants were only infected with X. albilineans (T0), the ethylene pathway was not induced.
Certain bacteria trigger a phenomenon known as ISR, phenotypically similar to systemic acquired resistance (SAR). SAR develops when plants successfully activate their defense mechanism in response to primary infection by a pathogen, notably when the latter induces a hypersensitive reaction through which it becomes limited in a local necrotic lesion of brown, desiccated tissue.31 As SAR, ISR is effective against different types of pathogens, but it differs from SAR because the induction of Plant Growth-Promoting Bacteria (PGPB) does not origin visible symptoms on the host plant.31 Most reports of PGPB-mediated ISR involve free-living rhizobacterial strains, but endophytic bacteria have also been observed to have ISR activity. For example, ISR was triggered by the endophytic P. fluorescens EP1 against red rot caused by Colletotrichum falcatum on sugarcane.32
The production of ethylene has been established as a condition to activate ISR in plants colonized by nonpathogenic rizobacterium.33,34 This phenomenon has been described in Arabidopsis plants using a biocontrol bacterium35 and the differential induction of this systemic resistance has been characterized.36
Our experimental data hold up that the plant defense mechanisms could be activated by the beneficial interaction with G. diazotrophicus. Such mechanisms may outcome in plant protection to X. albilineans, possibly by an ISR-like response. G. diazotrophicus potentially possesses and/or produces elicitor molecules, which activate the sugarcane defense response. Our experimental evidences pointed out that those elicitor molecules should be produced during the plant-bacteria interaction with living G. diazotrophicus, because control of X. albilineans cells was not demonstrated in treatments with G.d cell debris.
Elicitor-like substances are involved in the symbiosis between leguminous plants and rhizobia.37 Bacteria produce chemical signal-nodulation (Nod) factors, which are responsible for an appropriate recognition of the bacteria by the plant and subsequent nodulation. The Nod factors are lipo-chitooligosaccharides and evidences suggest that the perception of Nod factors has evolved from recognition of more general plant defense elicitors, such as chitin fragments or LPS.37,38 Interestingly, LPS from plant growth-promoting rhizobacteria triggers induced systemic resistance (ISR) to subsequent plant pathogens infections, without eliciting the accumulation of PR proteins or phytoalexin.31,39
A new role of nitrogen-fixing endophythic bacterium G. diazotrophicus has been identified and characterized in this work. Up to our knowledge, this is the first time the sugarcane defense response against the systemic pathogenic bacteria X. albilineans has been studied at genomic level. Considering that resistance genes to X. albilineans have not been identified yet within the Saccharum germoplasma, present results allow us to hypothesize about the possible role of endophytic bacteria in this resistance. Integrative genomics and metabolic approaches could offer basic information about the most pyramidal molecules and genes which are responsible for the development of this beneficial interaction, as well as the pathogenic mechanisms related to scald leaf disease produced by X. albilineans. Genetic handling of genes that can lead to more efficient plant-endophytic bacteria associations could result in biocontrol of X. albilineans infections and higher production yields. Moreover, present results could be applied to other plants from which recently Gluconacetobacter diazotrophicus has also been isolated, i.e: Arabidopsis thaliana and the crop plants maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), oilseed rape (Brassica napus), tomato (Lycopersicon esculentum), and white clover (Trifolium repens).40
Footnotes
Previously published online as a Plant Signaling & Behavior E-publication: http://www.landesbioscience.com/journals/psb/abstract.php?id=3389
References
- 1.Baldani JI, Caruso L, Baldani VLD, Goi SR, Döbereiner J. Recent advances in BNF with nonlegume plants. Soil Biology and Biochemistry. 1997;29:911–922. [Google Scholar]
- 2.Reinhold-Hurek B, Hurek T. Life in grasses: Diazotrophic endophytes. Trends Microbiol. 1998;6:139–144. doi: 10.1016/s0966-842x(98)01229-3. [DOI] [PubMed] [Google Scholar]
- 3.Bastian F, Cohen A, Piccoli P, Luna V, Baraldi R, Bottini R. Production of indole-3-acetic acid and giberellins A(1) and A(3) by Gluconacetobacter diazotrophicus and Herbaspirillum seropedicae in chemically-defined culture media. Plant Growth Regul. 1998;24:7–11. [Google Scholar]
- 4.Sevilla M, Burris RH, Gunapala N, Kennedy C. Comparison of benefit to sugarcane plant growth an 15N2 incorporation following inoculation of sterile plants with Gluconacetobacter diazotrophicus wild-type and Nif mutant strains. Mol Plant-Microbe Interact. 2001;14:358–366. doi: 10.1094/MPMI.2001.14.3.358. [DOI] [PubMed] [Google Scholar]
- 5.Nogueira EM, Vinagre F, Masuda HP, Vargas C, Padua VLM, Silva FR, Santos RV, Baldani JI, Ferreira PCG, Hemerly AS. Expression of sugarcane genes induced by inoculation with Gluconacetobacter diazotrophicus and Herbaspirillum rubrisubalbicans. Genetics and Molecular Biology. 2001;24:199–206. [Google Scholar]
- 6.Lambais MR. In silico differential display of defense-related expressed tags from sugarcane tissues infected with diazotrophic endophytes. Genetics and Molecular Biology. 2001;24:103–111. [Google Scholar]
- 7.Vargas C, Pádua VLM, Nogueira EM, Vinagre F, Masuda HP, Silva FR, Baldani JI, Ferreira PCG, Hemerly AS. Signaling pathways mediating the association between sugarcane and endophytic diazotrophic bacteria: A genomic approach. Symbiosis. 2003;35:159–180. [Google Scholar]
- 8.Vinagre F, Vargas C, Schwarcz K, Cavalcante J, Nogueira EM, Baldani JI, Ferreira PCG, Hemerly AS. SHR5: A novel plant receptor kinase involved in plant-N2-fixing endophytic bacteria association. Journal of Experimental Botany. 2006;57:559–569. doi: 10.1093/jxb/erj041. [DOI] [PubMed] [Google Scholar]
- 9.McDowell JM, Dangl JL. Signal transduction in the plant immune response. Trends in Biochemical Science. 2000;25:79–82. doi: 10.1016/s0968-0004(99)01532-7. [DOI] [PubMed] [Google Scholar]
- 10.Dong Z, McCully ME, Canny MJ. Does Gluconacetobacter diazotrophicus live and move in the xylem of sugarcane stems? Anatomical and physiological data. Annual of Botany. 1997;80:147–158. [Google Scholar]
- 11.James EK, Olivares FL, de Olivera ALM, dos Reis FB, da Silva LG, Reis VM. Further observations on the interaction between sugarcane and Gluconacetobacter diazotrophicus under laboratory and greenhouse conditions. Journal of Experimental Botany. 2001;52:747–760. doi: 10.1093/jexbot/52.357.747. [DOI] [PubMed] [Google Scholar]
- 12.Lodewyckx C, Vangronsveld J, Porteous F, Moore ERB, Taghavi S, Mezgeay M, van der Lelie D. Endophytic bacteria and their potential applications. Crit Rev Plant Sci. 2002;21:583–606. [Google Scholar]
- 13.Compant S, Duffy B, Nowak J, Clément C, Barka EA. Use of plant growth-promoting bacteria for biocontrol of plant diseases: Principles, mechanisms of action, and future prospects. Applied and Environmental Microbiology. 2005;71:4951–4959. doi: 10.1128/AEM.71.9.4951-4959.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ricaud C, Ryan CC. Leaf scald. In: Ricaud C, Egan BT, Gillaspie AG, Hughes CG, editors. Diseases of sugarcane: Major diseases. Amsterdam: Elsevier; 1989. pp. 39–53. [Google Scholar]
- 15.Birch RG, Bower R, Elliot A, Hansom S, Basnayake S, Zhang L. Regulation of transgene expression: Progress towards practical development in sugarcane, and implications for others species. In: Arencibia AD, editor. Plant Genetic Engineering towards the Third Millennium. Amsterdam: Elsevier; 2000. pp. 118–125. [Google Scholar]
- 16.Hendre KR, Iyer RS, Kotwain M, Kluspe SS, Mascarenhas AF. Rapid multiplication of sugarcane by tissue culture. Sugarcane. 1983;1:5–8. [Google Scholar]
- 17.Rott P, Costest L, Davis MPJ, Frutos R, Gabriel DW. At least two separate genes clusters are involved in Albicidin production by Xanthomonas albilineans. Journal of Bacteriology. 1996;178:4590–4596. doi: 10.1128/jb.178.15.4590-4596.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bachem CWB, Oomen RJF, Visser RGF. Transcript imaging with cDNA-AFLP: A step-by-step protocol. Plant Mol Biol Rep. 1998;16:157–173. [Google Scholar]
- 19.Bachem CWB, van der Hoeven RS, Lucker J, Oomen RJF, Casarini E, Jacobsen E, Visser RGF. Functional genomic analysis of potato tuber life-cycle. Potato Res. 2000;43:297–312. [Google Scholar]
- 20.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sambrook EJ, Fritsch F, Maniatis T. Molecular cloning: A laboratory manual. NewYork: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
- 22.Swarup R, Parry G, Graham N, Allen T, Bennett M. Auxin cross-talk: Integration of signalling pathways to control plant development. Plant Mol Biol. 2002;49:411–426. doi: 10.1007/978-94-010-0377-3_12. [DOI] [PubMed] [Google Scholar]
- 23.Merrit F, Kemper A, Tallman G. Inhibitors of ethylene synthesis inhibit auxin-induced stomatal opening in epidermis detached from leaves of Vicia faba L. Plant Cell Physiol. 2001;42:223–230. doi: 10.1093/pcp/pce030. [DOI] [PubMed] [Google Scholar]
- 24.Dowd C, Wilson IW, McFadden H. Gene expression profile changes in cotton root and hypocotyl tissues in response to infection with Fusarium oxysporum f. sp. vasinfectum. Mol Plant Microbe Interact. 2004;17:654–667. doi: 10.1094/MPMI.2004.17.6.654. [DOI] [PubMed] [Google Scholar]
- 25.Thara VK, Tang X, Gu YQ, Martin GB, Zhou JM. Pseudomonas syringae pv tomato induces the expression of tomato EREBP-like genes pti4 and pti5 independent of ethylene, salicylate and jasmonate. Plant Journal. 1999;20:475–483. doi: 10.1046/j.1365-313x.1999.00619.x. [DOI] [PubMed] [Google Scholar]
- 26.Thomma BP, Eggermont K, Tierens KF, Broekaert WF. Requirement of functional ethylene-insensitive 2 gene for efficient resistance of Arabidopsis to infection by Botrytis cinerea. Plant Physiology. 1999;121:1093–1102. doi: 10.1104/pp.121.4.1093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Penmetsa RV, Cook DR. A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbiont. Science. 1997;275:527–530. doi: 10.1126/science.275.5299.527. [DOI] [PubMed] [Google Scholar]
- 28.Spaink HP. Ethylene as a regulator of Rizhobium infection. Trends in Plant Science. 1997;2:203–204. [Google Scholar]
- 29.Rose JK, Ham KS, Darvill AG, Albersheim P. Molecular cloning and characterization of glucanase inhibitor proteins: Coevolution of a counterdefense mechanism by plant pathogens. Plant Cell. 2002;14:1329–1345. doi: 10.1105/tpc.002253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Cao H, Bowling SA, Gordon AS, Dong X. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of Systemic Acquired Resistance. Plant Cell. 1994;6:1583–1592. doi: 10.1105/tpc.6.11.1583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.van Loon LC, Bakker PAHM, Pieterse CMJ. Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopatol. 1998;36:453–483. doi: 10.1146/annurev.phyto.36.1.453. [DOI] [PubMed] [Google Scholar]
- 32.Viswanathan R, Samiyappan R. Induction of systemic resistance by plant growth-promoting rhizobacteria against red rot disease caused by Colletotrichum falcatum went in sugarcane; Proceedings of the Sugar Cane Technology Association; New Delhi, India. 1999. pp. 24–39. [Google Scholar]
- 33.Knoester M, Pieterse CM, Bol JF, van Loon LC. Systemic resistance in Arabidopsis induced by rhizobacteria requires ethylene-dependent signaling at the site of application. Mol Plant Microbe Interact. 1996;12:720–727. doi: 10.1094/MPMI.1999.12.8.720. [DOI] [PubMed] [Google Scholar]
- 34.Rojo E, Solano R, Sanchez-Serrano J. Interaction between signaling compounds in plant defense. Journal of Plant Growth Regulation. 2003;22:82–98. [Google Scholar]
- 35.Pieterse CMJ, van Wees SCM, Hoffland E, van Pelt JA, van Loon LC. Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis-related gene expression. Plant Cell. 1996;8:1225–1237. doi: 10.1105/tpc.8.8.1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.van Wees SC, Pieterse CM, Trijssenaar A, Vann't Westende YA, Hartog F, van Loon LC. Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria. Mol Plant-Microbe Interact. 1997;10:716–724. doi: 10.1094/MPMI.1997.10.6.716. [DOI] [PubMed] [Google Scholar]
- 37.Cullimore JV, Ranjeva R, Bono JJ. Perception of lipo-kitooligosaccharidic Nod factors in legumes. Trends Plant Sci. 2001;6:24–30. doi: 10.1016/s1360-1385(00)01810-0. [DOI] [PubMed] [Google Scholar]
- 38.Boller T. Chemoperception of microbial signals in plant cells. Annu Rev Plant Physiol Plant Mol Biol. 1995;46:189–214. [Google Scholar]
- 39.Montesano M, Brader G, Tapio E. Pathogen derived elicitors: Searching for receptors in plants. Molecular Plant Pathology. 2003;4:73–79. doi: 10.1046/j.1364-3703.2003.00150.x. [DOI] [PubMed] [Google Scholar]
- 40.Cocking EC, Stone PJ, Davey MR. Intracellular colonization of roots of Arabidopsis and crop plantas by Gluconacetobacter diazotrophicus. In Vitro Cellular and Development Biology- Plant. 2006;42:74–82. [Google Scholar]