Skip to main content
Molecular Vision logoLink to Molecular Vision
. 2009 Feb 6;15:276–282.

A novel nonsense mutation in CRYGC is associated with autosomal dominant congenital nuclear cataracts and microcornea

Lu Zhang 1, Songbin Fu 2, Yangshan Ou 1, Tingting Zhao 1, Yunjuan Su 1, Ping Liu 1,✉
PMCID: PMC2635849  PMID: 19204787

Abstract

Purpose

To report the identification of a novel nonsense mutation in CRYGC in a Chinese family with autosomal dominant congenital nuclear cataracts and microcornea.

Methods

We investigated a four-generation Chinese family with six members affected with nuclear cataracts and microcornea. The family resides in a relatively isolated region of northern China. Genomic DNA was isolated from blood leucocytes, genotyping was performed using more than 100 microsatellite markers for the known cataract candidate gene loci, and LOD scores were calculated using the LINKAGE programs. Mutations were detected by DNA sequence analysis of the candidate genes.

Results

Evidence for linkage was detected at marker D2S325 (LOD score [Z]=2.29, recombination fraction [θ]=0.0), which closely flanks the γ-crystallin gene cluster (CRYGA-CRYGD) on chromosome 2q32.3-q35. Direct sequencing of the candidate CRYGA-CRYGD gene cluster revealed a c.470G>A transversion in exon 3 of CRYGC, which cosegregated with cataracts in the family and was not observed in 100 normal controls. This single nucleotide change was predicted to introduce a translation stop codon at tryptophan 157 (W157X).

Conclusions

The present study has identified a novel nonsense mutation in CRYGC associated with autosomal dominant cataracts and microcornea in a Chinese family. Our finding expands the spectrum of CRYGC mutations associated with congenital cataract and confirms the role of γ-crystallin in the pathogenesis of congenital nuclear cataracts.

Introduction

Congenital cataract is a clinically and genetically heterogeneous lens disorder that typically appears as a sight-threatening trait in childhood and accounts for one-tenth of the cases of childhood blindness [1]. The prevalence of congenital cataracts is estimated to vary from 0.6 to 6 per 10,000 live births with an incidence of 2.2-2.49 per 10,000 live births [2]. Approximately half of all congenital cataract cases are inherited either in isolation or as part of a syndrome of ocular or systemic abnormalities [3]. All three classical forms of Mendelian inheritance have been associated with non-syndromic cataracts. However, the majority of families with a history of congenital cataracts show an autosomal dominant transmission pattern.

There are currently 34 loci implicated in nonsyndromic congenital cataract, and of these, over 20 have been associated with mutations in specific genes [4]. These genes can be considered in five functional groups: (1) 10 genes that encode crystallines, CRYAA [5,6], CRYAB [7,8], CRYBB1 [9,10], CRYBB2 [11-14], CRYBB3 [15], CRYBA1/A3 [16,17], CRYBA4 [18], CRYGC [19-23], CRYGD [19,21,24-26], and CRYGS [27]; (2) two genes that encode the gap junction proteins, GJA8 [28,29], and GJA3 [30,31]; (3) two genes that encode membrane proteins, MIP [32] and LIM2 [33,34]; (4) two genes that encode beaded filament proteins, BFSP1 [35] and BFSP2 [36-38]; and (5) seven genes that encode growth and transcription factors, PITX3 [39], MAF [40,41], HSF4 [42], FOXE3 [43], EYA1 [44], CHX10 [45], and PAX6 [46].

Crystallins are the dominant structural components of the vertebrate eye lens. At least 11 crystallin genes encode over 95% of the water-soluble structural proteins present in the crystallin lens, representing more than 30% of its mass and accounting for its optical transparency and high refractive index [47]. Therefore, mutations in the crystallin genes are strong candidates for certain hereditary forms of congenital cataracts.

In this study, we performed linkage analysis of a four-generation Chinese family with autosomal dominant nuclear cataract and microcornea, and we identified a novel nonsense mutation in CRYGC on 2q.

Methods

Clinical evaluation and DNA specimens

We identified a four-generation Chinese family with autosomal dominant nuclear cataracts and microcornea in the absence of other ocular or systemic abnormalities. The family resides in a relatively isolated region of northern China. Informed consent in accordance with the Declaration of Helsinki was obtained from all participants. Thirteen members participated in the study, six affected and seven unaffected family members (Figure 1). Affected status was determined by a history of cataract extraction or ophthalmologic examination, which included visual acuity testing, slit lamp examination, intraocular pressure measurement, and fundus examination with dilated pupils. Phenotypes were documented using slit lamp photography. Peripheral blood was collected and genomic DNA was extracted from blood leukocytes using a QIAampDNA Blood Mini Kit (Qiagen, Hilden, Germany).

Figure 1.

Figure 1

Pedigree and haplotypes of the Chinese family with cataracts. A pedigree is shown with the haplotype analysis of the Chinese family with cataracts, which shows the segregation of 10 microsatellite markers on chromosome 2q in descending order from the centromere. Squares and circles represent males and females, respectively. Black and white symbols denote affected and unaffected individuals, respectively.

Genotyping and linkage analysis

We conducted a genome wide linkage scan based on a set of dinucleotide repeat microsatellite markers spaced at approximately 10 cM intervals using an ABI PRISM Linkage Mapping Set version 2.5 (Applied Biosystems, Foster City, CA). “Touchdown” polymerase chain reaction (PCR) was performed in a 5 μl reaction volume containing 20 ng of genomic DNA, 1 µl of 10X PCR buffer, 7 mM MgCl2, 0.2 mM dNTPs, 0.3 U HotStar Taq DNA polymerase, and 0.05 µM microsatellite markers. After an initial denaturation period of 12 min at 95 °C, 14 cycles were performed at 95 °C for 30 s, 63–56 °C for 30 s (with a 0.5 °C decrease at each step), and 72 °C for 1 min. Thirty cycles were performed at 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min followed by an extension at 72 °C for 10 min and a final hold at 4 °C. The PCR products were pooled on the basis of size (Genescan-400HD ROX; Perkin Elmer, Foster City, CA), denatured at 95 °C for 1 min, and electrophoresed in a 96 capillary automated DNA analysis system (MegaBACE 1000, Amersham, Freiburg, Germany). The results were analyzed by Genetic Profiler version 1.5 (Amersham). Two point LOD scores (Z) were calculated using the LINKAGE software package (version 5.1). A gene frequency of 0.0001 and a penetrance of 100% were assumed for the cataract locus. LOD scores were calculated at recombination fractions (θ) of 0.00, 0.05, 0.1, 0.2, 0.3, and 0.4.

Mutational analyses

Four functional candidate genes (CRYGA-CRYGD) and two pseudogenes (CRYGE-CRYGF) with in-frame translation stop codons are clustered within the physical region defined for the cataract on 2q33–35. We systematically sequenced all four functional CRYG genes, each comprising three exons and two introns, in two affected and two unaffected members of the family using specific primers (Table 1). Genomic DNA was PCR amplified, purified, and sequenced directly using dye-terminator chemistry. The purified PCR products were sequenced on both DNA strands using an ABI 3100 sequencer (Applied Biosystems). After identifying a nonsense mutation in exon 3 of CRYGC, all of the family members (six affected and seven unaffected family members) and 100 unrelated normal individuals were screened.

Table 1. PCR primers for mutational screening of CRYGA-CRYGD.

Gene (Exon) Strand Primer Sequence (5′ - 3′)
CRYGA (1–2)
Sense
CCAGGTCCCTTTTGTGTTGT
 
Antisense
GGGTCAGGCCTTGCTATTCT
CRYGA (3)
Sense
GGCAACACAGCAAGACCTTT
 
Antisense
AGCCACTTAGTGCAGGGAAC
CRYGB (1–2)
Sense
GCCCTTTTGTGTGATTTCCT
 
Antisense
CGAGACTCCGCCTCAAAA
CRYGB (3)
Sense
AAACTTGGCCTGGGAGAACT
 
Antisense
TTGGCTGAGTGCCATTATCA
CRYGC (1)
Sense
GGACAGCGTTAGAATATACCAGAGA
 
Antisense
CTGAAATACGGCTGCAGGTT
CRYGC(2)
Sense
GGAAGGTGAGCAGAACACAA
 
Antisense
TCCATCTAACCCTTAGGTGTTTTT
CRYGC (3)
Sense
CATGCCACAACCTACCAAGTT
 
Antisense
TGACAAGGAGCATTTAAAGGTG
CRYGD (1)
Sense
CAGCAGCCCTCCTGCTAT
 
Antisense
TGCTCATAGAGCATCCAGCA
CRYGD (2)
Sense
GCCTTGCAGATCACCCTCTA
 
Antisense
TAGGGCAGGAGACACATTCC
CRYGD (3)
Sense
GCTTGAGCGGGTCCTCAC
  Antisense GCCTCGTGTGTGTAAATAAAATAAGA

Primer pairs used for amplification and sequencing of the coding exons for CRYGA-CRYGD located on 2q.

Results

Clinical findings

We report the identification of a four-generation Chinese family with a clear diagnosis of congenital nuclear cataracts and microcornea. Autosomal dominant inheritance of the cataract phenotype was supported by the presence of affected individuals in each of the four generations and male-to-male transmission. The affected individuals presented with bilateral congenital nuclear cataracts that consisted of a central nuclear opacity affecting the embryonic, fetal, and infantile nucleus of the lens (Figure 2) and with congenital small eyeballs and corneas with a diameter of approximately 9–10 mm. Every affected individual had the same poor visual acuity of hand movement in front of the eye, and they also had nystagmus and amblyopia.

Figure 2.

Figure 2

Slit lamp photographs of the eyes of affected individuals. A: Individual II:2 at 46 years of age is shown with visual acuity of hand movement in both eyes before surgery. B: Individual III:1 at 26 years of age is also shown with visual acuity of hand movement in both eyes before surgery.

Linkage analysis

By following the exclusion of large chromosomal regions, we obtained suggestive evidence of linkage for marker D2S2321 (Z=1.88, θ=0) on 2q33.3. Further analysis of the marker showed a positive LOD score at the recombination fraction of 0.00 and strongly supported this candidate region. The maximum two-point LOD score (Zmax) of 2.29 was obtained at marker D2S325 with recombination θ=0.00. The adjacent markers (D2S2321, D2S1385, and D2S1242) also showed LOD scores greater than 1.0. The results of the two-point LOD scores are summarized (Table 2).

Table 2. Two-point LOD scores for linkage analyses.

cM Markers LOD score at θ=
0.00 0.05 0.10 0.20 0.30 0.40 Zmax θmax
186.21
D2S364
−1.84
0.52
0.64
0.55
0.33
0.09
0.64
0.1
194.45
D2S117
−1.84
0.52
0.64
0.55
0.33
0.09
0.64
0.1
204.53
D2S325
2.29
2.07
1.84
1.34
0.79
0.26
2.29
0.0
205.06
D2S2208
0.80
0.79
0.73
0.55
0.33
0.12
0.80
0.0
205.06
D2S2321
1.88
1.69
1.48
1.05
0.58
0.16
1.88
0.0
205.59
D2S2178
0.26
0.31
0.32
0.28
0.19
0.09
0.32
0.1
206.74
D2S1385
1.88
1.69
1.49
1.05
0.58
0.16
1.88
0.0
213.49
D2S2382
−2.01
−0.43
0.01
0.27
0.26
0.13
0.27
0.2
214.71
D2S2248
−2.01
−0.44
−0.00
0.26
0.24
0.12
0.26
0.2
215.25
D2S1371
−1.98
0.55
0.67
0.60
0.39
0.15
0.67
0.1
218.45
D2S1242
1.08
1.05
0.97
0.74
0.45
0.17
1.08
0.0
221.13 D2S126 0.88 0.81 0.72 0.51 0.27 0.07 0.88 0.0

Two point LOD scores for linkage between the cataract locus and twelve markers on chromosome 2q listed in genetic (sex-averaged) order using the Marshfield genetic database from p-tel, measured in centi-Morgans (cM).

We constructed haplotypes of the family. The markers used are listed in Table 2. Haplotype data are given in Figure 1. A crossover between D2S117 and D2S325 in individual II:5 defines the proximal border of the region, and one between D2S1385 and D2S2382 in individual II:1, II:4, and II:5 define the distal border. All affected individuals had an affected parent, and none of the unaffected individuals carried the disease haplotype. Thus, penetrance appears to be virtually complete in this family. The disease-associated haplotype shared by all affected members was identified. The results of both linkage and haplotype analyses situated the disease gene in a 19.04 cM region bounded by D2S117 and D2S2382 at 2q32.3-q35.

Mutational analysis

Sequence analysis of CRYGC identified a transversion in exon 3. This single nucleotide change was predicted to result in a c.470G>A nonsense or chain-termination mutation at codon 157, which changed a phylogenetically conserved tryptophan residue to a stop codon (W157X). The cosegregation of the c.470G>A transition in only affected members of the pedigree and its absence in 100 normal control individuals strongly suggested that the W157X substitution was a causative mutation rather than a benign single nucleotide polymorphism (SNP) in linkage disequilibrium with the cataract (Figure 3).

Figure 3.

Figure 3

Mutational analysis of CRYGC. A: Sequence chromatograms of the wild type CRYGC allele show that the wild type gene encodes a tryptophan residue (TGG) at position 157. B: Sequence chromatograms of the mutant allele show a c.470G>A transversion that substituted a termination codon (TAG) for the tryptophan residue at position 157 (W157X). C: Exon organization and mutational profile of CRYGC are shown. Codons and the corresponding Greek key motifs are numbered above each exon. The relative locations of the W157X mutation and three other mutations associated with cataracts in humans are indicated. Mutations are numbered according to their amino acid position in the processed CRYGC protein. D: Multiple sequence alignments of CRYGC with the corresponding segments in human, mouse, and rat is exhibited together with human CRYGA, CRYGB, and CRYGD (sequences found using ClustalW2). The arrow indicates the W157X mutated position.

Discussion

The association of developmental cataract and microcornea (congenital cataract-microcornea syndrome, microcornea-cataract [CCMC], OMIM 116150) makes up a distinct phenotype within the group of autosomal dominant congenital cataracts. CCMC has been considered a rare phenotype. The frequency of CCMC may be underestimated because the focus is often on the sight-threatening cataract and corneal diameters may pass unnoticed. Hansen et al. [48] identified five novel mutations by screening 10 CCMC families in nine already known cataract genes. The numbers of known mutations in CCMC are, however, still limited, which hampers evaluation of whether the appearance of CCMC phenotypes depends on specific mutations or closely linked modifying elements.

Herein, we report the identification of a novel nonsense mutation (W157X) in processed CRYGC that cosegregated with autosomal dominant nuclear cataracts and microcornea in a four-generation Chinese family. In addition to the novel W157X mutation, there are four other mutations in CRYGC that have been associated with cataracts including Coppock-like cataracts (T5P) [19], variable zonular pulverulent cataracts (5 bp duplication) [20], lamellar cataracts (R168W) [21], nuclear cataracts (R168W) [22], and nuclear cataracts (C109X) [23]. Therefore, in a manner similar to the nuclear opacities associated with the W157X mutation, these other CRYGC-related opacities involve the nucleus of the lens. This clinical manifestation is in agreement with the function of CRYGC, which is abundantly expressed at an early developmental stage in elongating fiber cells. CRYGC is expressed primarily in the lens nucleus, which is consistent with the location of the opacity in the nucleus.

Crystallins constitute the major proteins of the vertebrate eye lens, and they maintain the transparency and refractive index of the lens. Because lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, requiring them to be extremely stable proteins. Mammalian lens crystallins are divided into α-, β-, and γ-crystallin families. β- and γ-crystallins are also considered a superfamily. Seven protein regions exist in β-crystallins: four Greek key motifs, a connecting peptide, NH2-terminal extensions, and COOH-terminal extensions. γ-Crystallins are a homogeneous group of highly symmetric, monomeric proteins. They are differentially regulated after early development. Four γ-crystallin genes (CRYGA, CRYGB, CRYGC, and CRYGD) and two pseudogenes (CRYGE and CRYGF) are tandemly organized in a genomic segment as a gene cluster.

Based on the crystal structure of human CRYGC, the W157X mutation lies in the COOH-terminal domain at the end of the fourth Greek key motif (Figure 3C). However, the deleterious effects of the W157X mutation on CRYGC folding, stability, and solubility are unclear. Interestingly, the T5P mutation, which is associated with Coppock-like cataracts, not only causes changes in conformation (partial unfolding) but also reduces protein solubility and stability [49]. Furthermore, the T5P mutation decreases interactions with wild type γC-crystallin and with αA-, αB-, and βB2-crystallins [50]. How the 5 bp duplication and R168W mutations, which are associated with variable zonular pulverulent cataracts and lamellar cataracts, respectively, exert their unique effects remains unknown. Further biophysical studies of these mutant proteins will be required to provide insights regarding the molecular pathology of CRYGC-associated cataracts.

Alignment of the CRYGC protein sequence from three different species with three human γ-crystallins revealed that the tryptophan residue at position 157 is highly conserved (Figure 3D). To further examine the structural change induced by the W157X mutation, we used the three-dimensional structure of γ-crystallin, which is characterized by the presence of four Greek key motifs. Motifs 1 and 2 are located in the NH2-terminal domain, and motifs 3 and 4 are located in the COOH-terminal domain [51,52]. The W157X mutation results in an in-frame stop codon at nucleotide 470 that leads to the truncation of 17 amino acids from the COOH-terminus of γC-crystallin. The corresponding alteration affects not only the length of the COOH-terminal arms but also the formation of the fourth Greek-key motif in γC-crystallin, which in turn disrupts the highly symmetric structure of γC-crystallin. The W157X mutation affects the Greek key motifs, and it is predicted to change the folding properties of γC-crystallin and/or affect its interactions with other crystallins. Furthermore, the resulting changes in the three-dimensional structure may ultimately lead to a decrease in the stability and/or solubility of γC-crystallin.

It is noteworthy that an autosomal dominant nuclear and radial cataract caused by a 6 bp deletion in the CRYGC has also been reported in the mouse [53]. A 6-bp deletion in exon 3 of the mouse γC-crystallin encoding gene (Crygc) is causative for the cataract phenotype. The mutation is therefore designated CrygcChl3. The deletion of bases 420−425 leads to a loss of two amino acid residues, Gly and Arg, in the fourth Greek key motif.

In summary, the present study has identified a novel nonsense W157X mutation in CRYGC associated with autosomal dominant cataracts and microcornea in a four-generation Chinese family. The association between microcornea and congenital cataracts in all affected individuals indicate that mutations disrupting lens biochemistry and physiology early in development can result in microphakia and subsequent microcornea as a secondary effect of damage to the lens.

Acknowledgments

We thank the family for participating in this study. This research was supported by the funds from National Natural Science Foundation of China (30772380), Natural Science Foundation of Heilongjiang Province of China (D200870), Postdoctoral Science Foundation of Heilongjiang Province of China (LRB07–324), Medical Scientific Research Foundation of Heilongjiang Province of China(2007–223), Foundation of Heilongjiang Educational Committee (11531110), and Foundation of Harbin Technology Bureau (2008RFQXS098). Dr. Zhang and Dr. Liu contributed equally to the research project and can be considered co-corresponding authors.

References

  • 1.Gilbert CE, Canovas R, Hagan M, Rao S, Foster A. Causes of childhood blindness: results from West Africa, south India and Chile. Eye. 1993;7:184–8. doi: 10.1038/eye.1993.39. [DOI] [PubMed] [Google Scholar]
  • 2.Reddy MA, Francis PJ, Berry V, Bhattacharya SS, Moore AT. Molecular genetic basis of inherited cataract and associated phenotypes. Surv Ophthalmol. 2004;49:300–15. doi: 10.1016/j.survophthal.2004.02.013. [DOI] [PubMed] [Google Scholar]
  • 3.Francis PJ, Moore AT. Genetics of childhood cataract. Curr Opin Ophthalmol. 2004;15:10–5. doi: 10.1097/00055735-200402000-00003. [DOI] [PubMed] [Google Scholar]
  • 4.Hejtmancik JF. Congenital cataracts and their molecular genetics. Semin Cell Dev Biol. 2008;19:134–49. doi: 10.1016/j.semcdb.2007.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, Weleber RG. Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum Mol Genet. 1998;7:471–4. doi: 10.1093/hmg/7.3.471. [DOI] [PubMed] [Google Scholar]
  • 6.Gu F, Luo W, Li X, Wang Z, Lu S, Zhang M, Zhao B, Zhu S, Feng S, Yan YB, Huang S, Ma X. A novel mutation in AlphaA-crystallin (CRYAA) caused autosomal dominant congenital cataract in a large Chinese family. Hum Mutat. 2008;29:769. doi: 10.1002/humu.20724. [DOI] [PubMed] [Google Scholar]
  • 7.Berry V, Francis P, Reddy MA, Collyer D, Vithana E, MacKay I, Dawson G, Carey AH, Moore A, Bhattacharya SS, Quinlan RA. Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. Am J Hum Genet. 2001;69:1141–5. doi: 10.1086/324158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vicart P, Caron A, Guicheney P, Li Z, Prevost MC, Faure A, Chateau D, Chapon F, Tome F, Dupret JM, Paulin D, Fardeau M. A missense mutation in the alphaB-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet. 1998;20:92–5. doi: 10.1038/1765. [DOI] [PubMed] [Google Scholar]
  • 9.Mackay DS, Boskovska OB, Knopf HL, Lampi KJ, Shiels A. A nonsense mutation in CRYBB1 associated with autosomal dominant cataract linked to human chromosome 22q. Am J Hum Genet. 2002;71:1216–21. doi: 10.1086/344212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yang J, Zhu Y, Gu F, He X, Cao Z, Li X, Tong Y, Ma X. A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract. Mol Vis. 2008;14:727–31. [PMC free article] [PubMed] [Google Scholar]
  • 11.Litt M, Carrero-Valenzuela R, LaMorticella DM, Schultz DW, Mitchell TN, Kramer P, Maumenee IH. Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human beta-crystallin gene CRYBB2. Hum Mol Genet. 1997;6:665–8. doi: 10.1093/hmg/6.5.665. [DOI] [PubMed] [Google Scholar]
  • 12.Gill D, Klose R, Munier FL, McFadden M, Priston M, Billingsley G, Ducrey N, Schorderet DF, Heon E. Genetic heterogeneity of the Coppock-like cataract: a mutation in CRYBB2 on chromosome 22q11.2. Invest Ophthalmol Vis Sci. 2000;41:159–65. [PubMed] [Google Scholar]
  • 13.Vanita, Sahardi V, Reis A, Jung M, Singh D, Sperling K, Singh JR, Burger J. A unique form of autosomal dominant cataract explained by gene conversion between beta-crystallin B2 and its pseudogene. J Med Genet. 2001;38:392–6. doi: 10.1136/jmg.38.6.392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li FF, Zhu SQ, Wang SZ, Gao C, Huang SZ, Zhang M, Ma X. Nonsense mutation in the CRYBB2 gene causing autosomal dominant progressive polymorphic congenital coronary cataracts. Mol Vis. 2008;14:750–5. [PMC free article] [PubMed] [Google Scholar]
  • 15.Riazuddin SA, Yasmeen A, Yao W, Sergeev YV, Zhang Q, Zulfiqar F, Riaz A, Riazuddin S, Hejtmancik JF. Mutations in betaB3-crystallin associated with autosomal recessive cataract in two Pakistani families. Invest Ophthalmol Vis Sci. 2005;46:2100–6. doi: 10.1167/iovs.04-1481. [DOI] [PubMed] [Google Scholar]
  • 16.Kannabiran C, Rogan PK, Olmos L, Basti S, Rao GN, Kaiser-Kupfer M, Hejtmancik JF. Autosomal dominant zonular cataract with sutural opacities is associated with a splice mutation in the betaA3/A1-crystallin gene. Mol Vis. 1998;4:21. [PubMed] [Google Scholar]
  • 17.Bateman JB, Geyer DD, Flodman P, Johannes M, Sikela J, Walter N, Moreira AT, Clancy K, Spence MA. A new betaA1-crystallin splice junction mutation in autosomal dominant cataract. Invest Ophthalmol Vis Sci. 2000;41:3278–85. [PubMed] [Google Scholar]
  • 18.Billingsley G, Santhiya ST, Paterson AD, Ogata K, Wodak S, Hosseini SM, Manisastry SM, Vijayalakshmi P, Gopinath PM, Graw J, Heon E. CRYBA4, a novel human cataract gene, is also involved in microphthalmia. Am J Hum Genet. 2006;79:702–9. doi: 10.1086/507712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Heon E, Priston M, Schorderet DF, Billingsley GD, Girard PO, Lubsen N, Munier FL. The gamma-crystallins and human cataracts: a puzzle made clearer. Am J Hum Genet. 1999;65:1261–7. doi: 10.1086/302619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ren Z, Li A, Shastry BS, Padma T, Ayyagari R, Scott MH, Parks MM, Kaiser-Kupfer MI, Hejtmancik JF. A 5-base insertion in the gammaC-crystallin gene is associated with autosomal dominant variable zonular pulverulent cataract. Hum Genet. 2000;106:531–7. doi: 10.1007/s004390000289. [DOI] [PubMed] [Google Scholar]
  • 21.Santhiya ST, Shyam Manohar M, Rawlley D, Vijayalakshmi P, Namperumalsamy P, Gopinath PM, Loster J, Graw J. Novel mutations in the gamma-crystallin genes cause autosomal dominant congenital cataracts. J Med Genet. 2002;39:352–8. doi: 10.1136/jmg.39.5.352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gonzalez-Huerta LM, Messina-Baas OM, Cuevas-Covarrubias SA. A family with autosomal dominant primary congenital cataract associated with a CRYGC mutation: evidence of clinical heterogeneity. Mol Vis. 2007;13:1333–8. [PubMed] [Google Scholar]
  • 23.Yao K, Jin C, Zhu N, Wang W, Wu R, Jiang J, Shentu X. A nonsense mutation in CRYGC associated with autosomal dominant congenital nuclear cataract in a Chinese family. Mol Vis. 2008;14:1272–6. [PMC free article] [PubMed] [Google Scholar]
  • 24.Stephan DA, Gillanders E, Vanderveen D, Freas-Lutz D, Wistow G, Baxevanis AD, Robbins CM, VanAuken A, Quesenberry MI, Bailey-Wilson J, Juo SH, Trent JM, Smith L, Brownstein MJ. Progressive juvenile-onset punctate cataracts caused by mutation of the gammaD-crystallin gene. Proc Natl Acad Sci USA. 1999;96:1008–12. doi: 10.1073/pnas.96.3.1008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Benazzouz B, Hajaji Y, Boutayeb S, Gribouval O, Arbogast L, Berraho A, Abitbol M, Hilal L. Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts. J Med Genet. 2003;40:262–7. doi: 10.1136/jmg.40.4.262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kmoch S, Brynda J, Asfaw B, Bezouska K, Novak P, Rezacova P, Ondrova L, Filipec M, Sedlacek J, Elleder M. Link between a novel human gammaD-crystallin allele and a unique cataract phenotype explained by protein crystallography. Hum Mol Genet. 2000;9:1779–86. doi: 10.1093/hmg/9.12.1779. [DOI] [PubMed] [Google Scholar]
  • 27.Sun H, Ma Z, Li Y, Liu B, Li Z, Ding X, Gao Y, Ma W, Tang X, Li X, Shen Y. Gamma-S crystallin gene (CRYGS) mutation causes dominant progressive cortical cataract in humans. J Med Genet. 2005;42:706–10. doi: 10.1136/jmg.2004.028274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Berry V, Mackay D, Khaliq S, Francis PJ, Hameed A, Anwar K, Mehdi SQ, Newbold RJ, Ionides A, Shiels A, Moore T, Bhattacharya SS. Connexin 50 mutation in a family with congenital “zonular nuclear” pulverulent cataract of Pakistani origin. Hum Genet. 1999;105:168–70. doi: 10.1007/s004399900094. [DOI] [PubMed] [Google Scholar]
  • 29.Polyakov AV, Shagina IA, Khlebnikova OV, Evgrafov OV. Mutation in the connexin 50 gene (GJA8) in a Russian family with zonular pulverulent cataract. Clin Genet. 2001;60:476–8. doi: 10.1034/j.1399-0004.2001.600614.x. [DOI] [PubMed] [Google Scholar]
  • 30.Mackay D, Ionides A, Kibar Z, Rouleau G, Berry V, Moore A, Shiels A, Bhattacharya S. Connexin46 mutations in autosomal dominant congenital cataract. Am J Hum Genet. 1999;64:1357–64. doi: 10.1086/302383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rees MI, Watts P, Fenton I, Clarke A, Snell RG, Owen MJ, Gray J. Further evidence of autosomal dominant congenital zonular pulverulent cataracts linked to 13q11 (CZP3) and a novel mutation in connexin 46 (GJA3). Hum Genet. 2000;106:206–9. doi: 10.1007/s004390051029. [DOI] [PubMed] [Google Scholar]
  • 32.Berry V, Francis P, Kaushal S, Moore A, Bhattacharya S. Missense mutations in MIP underlie autosomal dominant 'polymorphic' and lamellar cataracts linked to 12q. Nat Genet. 2000;25:15–7. doi: 10.1038/75538. [DOI] [PubMed] [Google Scholar]
  • 33.Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E, Geffen-Carmi N, Frydman M, Goldman B, Pras E. A missense mutation in the LIM2 gene is associated with autosomal recessive presenile cataract in an inbred Iraqi Jewish family. Am J Hum Genet. 2002;70:1363–7. doi: 10.1086/340318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ponnam SP, Ramesha K, Tejwani S, Matalia J, Kannabiran C. A missense mutation in LIM2 causes autosomal recessive congenital cataract. Mol Vis. 2008;14:1204–8. [PMC free article] [PubMed] [Google Scholar]
  • 35.Ramachandran RD, Perumalsamy V, Hejtmancik JF. Autosomal recessive juvenile onset cataract associated with mutation in BFSP1. Hum Genet. 2007;121:475–82. doi: 10.1007/s00439-006-0319-6. [DOI] [PubMed] [Google Scholar]
  • 36.Conley YP, Erturk D, Keverline A, Mah TS, Keravala A, Barnes LR, Bruchis A, Hess JF, FitzGerald PG, Weeks DE, Ferrell RE, Gorin MB. A juvenile-onset, progressive cataract locus on chromosome 3q21-q22 is associated with a missense mutation in the beaded filament structural protein-2. Am J Hum Genet. 2000;66:1426–31. doi: 10.1086/302871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jakobs PM, Hess JF, FitzGerald PG, Kramer P, Weleber RG, Litt M. Autosomal-dominant congenital cataract associated with a deletion mutation in the human beaded filament protein gene BFSP2. Am J Hum Genet. 2000;66:1432–6. doi: 10.1086/302872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zhang L, Gao L, Li Z, Qin W, Gao W, Cui X, Feng G, Fu S, He L, Liu P. Progressive sutural cataract associated with a BFSP2 mutation in a Chinese family. Mol Vis. 2006;12:1626–31. [PubMed] [Google Scholar]
  • 39.Semina EV, Ferrell RE, Mintz-Hittner HA, Bitoun P, Alward WL, Reiter RS, Funkhauser C, Daack-Hirsch S, Murray JC. A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat Genet. 1998;19:167–70. doi: 10.1038/527. [DOI] [PubMed] [Google Scholar]
  • 40.Jamieson RV, Perveen R, Kerr B, Carette M, Yardley J, Heon E, Wirth MG, van Heyningen V, Donnai D, Munier F, Black GC. Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma. Hum Mol Genet. 2002;11:33–42. doi: 10.1093/hmg/11.1.33. [DOI] [PubMed] [Google Scholar]
  • 41.Vanita V, Singh D, Robinson PN, Sperling K, Singh JR. A novel mutation in the DNA-binding domain of MAF at 16q23.1 associated with autosomal dominant “cerulean cataract” in an Indian family. Am J Med Genet A. 2006;140:558–66. doi: 10.1002/ajmg.a.31126. [DOI] [PubMed] [Google Scholar]
  • 42.Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M, Cui B, Xia Y, Liu J, Hu L, Zhao G, Hayden MR, Kong X. Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract. Nat Genet. 2002;31:276–8. doi: 10.1038/ng921. [DOI] [PubMed] [Google Scholar]
  • 43.Semina EV, Brownell I, Mintz-Hittner HA, Murray JC, Jamrich M. Mutations in the human forkhead transcription factor FOXE3 associated with anterior segment ocular dysgenesis and cataracts. Hum Mol Genet. 2001;10:231–6. doi: 10.1093/hmg/10.3.231. [DOI] [PubMed] [Google Scholar]
  • 44.Azuma N, Hirakiyama A, Inoue T, Asaka A, Yamada M. Mutations of a human homologue of the Drosophila eyes absent gene (EYA1) detected in patients with congenital cataracts and ocular anterior segment anomalies. Hum Mol Genet. 2000;9:363–6. doi: 10.1093/hmg/9.3.363. [DOI] [PubMed] [Google Scholar]
  • 45.Plotnikova OV, Kondrashov FA, Vlasov PK, Grigorenko AP, Ginter EK, Rogaev EI. Conversion and compensatory evolution of the gamma-crystallin genes and identification of a cataractogenic mutation that reverses the sequence of the human CRYGD gene to an ancestral state. Am J Hum Genet. 2007;81:32–43. doi: 10.1086/518616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Graw J, Klopp N, Illig T, Preising MN, Lorenz B. Congenital cataract and macular hypoplasia in humans associated with a de novo mutation in CRYAA and compound heterozygous mutations in P. Graefes Arch Clin Exp Ophthalmol. 2006;244:912–9. doi: 10.1007/s00417-005-0234-x. [DOI] [PubMed] [Google Scholar]
  • 47.Mackay DS, Andley UP, Shiels A. A missense mutation in the gammaD crystallin gene (CRYGD) associated with autosomal dominant “coral-like” cataract linked to chromosome 2q. Mol Vis. 2004;10:155–62. [PubMed] [Google Scholar]
  • 48.Hansen L, Yao W, Eiberg H, Kjaer KW, Baggesen K, Hejtmancik JF, Rosenberg T. Genetic heterogeneity in microcornea-cataract: five novel mutations in CRYAA, CRYGD, and GJA8. Invest Ophthalmol Vis Sci. 2007;48:3937–44. doi: 10.1167/iovs.07-0013. [DOI] [PubMed] [Google Scholar]
  • 49.Fu L, Liang JJ. Conformational change and destabilization of cataract gammaC-crystallin T5P mutant. FEBS Lett. 2002;513:213–6. doi: 10.1016/s0014-5793(02)02313-x. [DOI] [PubMed] [Google Scholar]
  • 50.Fu L, Liang JJ. Alteration of protein-protein interactions of congenital cataract crystallin mutants. Invest Ophthalmol Vis Sci. 2003;44:1155–9. doi: 10.1167/iovs.02-0950. [DOI] [PubMed] [Google Scholar]
  • 51.Blundell T, Lindley P, Miller L, Moss D, Slingsby C, Tickle I, Turnell B, Wistow G. The molecular structure and stability of the eye lens: x-ray analysis of gamma-crystallin II. Nature. 1981;289:771–7. doi: 10.1038/289771a0. [DOI] [PubMed] [Google Scholar]
  • 52.White HE, Driessen HP, Slingsby C, Moss DS, Lindley PF. Packing interactions in the eye-lens. Structural analysis, internal symmetry and lattice interactions of bovine gamma IVa-crystallin. J Mol Biol. 1989;207:217–35. doi: 10.1016/0022-2836(89)90452-x. [DOI] [PubMed] [Google Scholar]
  • 53.Graw J, Neuhauser-Klaus A, Loster J, Favor J. A 6-bp deletion in the Crygc gene leading to a nuclear and radial cataract in the mouse. Invest Ophthalmol Vis Sci. 2002;43:236–40. [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES