Skip to main content
Molecular Vision logoLink to Molecular Vision
. 2009 Feb 16;15:343–348.

Analysis of three pigment epithelium-derived factor gene polymorphisms in patients with exudative age-related macular degeneration

Dietmar Mattes 1,✉, Anton Haas 1, Wilfried Renner 2, Iris Steinbrugger 1, Yosuf El-Shabrawi 1, Andreas Wedrich 1, Christoph Werner 1, Otto Schmut 1, Martin Weger 1
PMCID: PMC2642842  PMID: 19223990

Abstract

Purpose

Exudative age-related macular degeneration (exudative AMD) is a common vision-threatening disease, with both environmental and genetic factors contributing to its development. Recently, homozygosity for the 72Met variant of the pigment epithelium-derived factor (PEDF) Met72Thr gene polymorphism (rs1136287) was identified as a novel risk factor for exudative AMD in Chinese patients from Taiwan. The role of this polymorphism, however, has not yet been determined in a white European population. In addition, two other PEDF gene polymorphisms, −5736T>C (rs12150053) and −5304C>T (rs12948385), have been associated with increased risk of diabetic retinopathy, but have not yet been studied among patients with exudative AMD. The purpose of the present study was thus to investigate a hypothesized association between these PEDF polymorphisms and the presence of exudative AMD in a white European population.

Methods

The present case-control study comprised 269 patients with exudative AMD and 155 control subjects. Genotypes of the PEDF polymorphisms were determined by 5′-exonuclease assays (TaqMan).

Results

PEDF genotype and allele frequencies were not significantly different between AMD patients and control subjects. The two promoter polymorphisms, −5736T>C (rs12150053) and −5304C>T (rs12948385), were in complete association. Presence of the homozygous PEDF 72 Met/Met genotype was associated with a nonsignificant odds ratio of 1.00 (95% confidence interval: 0.67–1.49, p=0.99). Similarly, presence of the homozygous PEDF −5736 TT genotype or −5304 CC genotype was associated with a nonsignificant odds ratio of 0.99 (95% confidence interval: 0.56 - 1.75, p=0.97). Both promoter polymorphisms were in linkage disequilibrium with the Met72Thr (rs1136287) polymorphism (D'=0.83) and formed three common and one rare haplotype. Haplotype frequencies were similar between AMD patients and control subjects (p>0.05).

Conclusions

Our data suggest that none of the investigated PEDF polymorphisms is likely a major risk factor for exudative AMD in a white European population.

Introduction

Exudative age-related macular degeneration (exudative AMD) is a major cause of severe visual impairment in patients older than 50 years [1–3]. An impaired balance between pro- and antiangiogenic factors has previously been implicated in the development of choroidal neovascularization in AMD [4–6].

Pigment epithelium-derived factor (PEDF), a 50 kDa glycoprotein belonging to the serine proteinase inhibitor family [7–10], is a potent antiangiogenic factor [11,12] and exerts neurotrophic and neuroprotective effects [8,13]. It is synthesized by several different cell types including retinal pigment epithelium (RPE) cells and photoreceptors [14]. Several lines of evidence indicate a role of PEDF in the pathogenesis of exudative AMD. First, immunohistochemical studies have revealed significantly reduced immunoreactivity for PEDF in both RPE cells and in Bruch’s membrane of AMD eyes compared with healthy control eyes [6,15]. Second, vitreous PEDF concentrations were found to be significantly decreased in eyes with exudative AMD [16]. Additional evidence comes from an animal laser injury model showing an inverse correlation between PEDF expression and formation of choroidal neovascularizations [17,18]. Finally, the administration of recombinant natural PEDF or adenoviral vector-delivered PEDF has been found either to inhibit the development of choroidal neovascularizations or to reduce its extent [19–21].

In 2005, Yamagishi et al. [22] proposed the hypothesis that a PEDF gene polymorphism, which is characterized by a methionine to threonine substitution at amino acid position 72 of PEDF (PEDF Met72Thr [PEDF 311T>C], rs1136287) [23], might be a genetic marker for AMD. Indeed, Lin et al. [24] only recently identified this polymorphism as a novel risk factor for exudative AMD in a Taiwan Chinese population. So far, this finding has not yet been replicated in a white European population. This, however, is essential to draw firm conclusions on the potential contribution of gene polymorphisms to exudative AMD risk in populations of different ethic origin. Two other PEDF polymorphisms, −5736T>C (rs12150053) and −5304C>T (rs12948385), have only recently been associated with diabetic retinopathy, but have not yet been studied in AMD patients [25]. The purpose of the present study was thus to investigate a hypothesized association between the aforementioned PEDF polymorphisms and exudative AMD in a white European population.

Methods

The study comprised 269 patients with exudative AMD and 155 control participants who were of European origin and living in the same geographical area in the southern part of Austria. All participants were seen at the local Department of Ophthalmology, Medical University of Graz, and gave written informed consent before enrollment. The study was conducted according to the Austrian Gene Technology Act and the guidelines of the local Ethics Committee.

Exudative AMD was diagnosed by ophthalmoscopic fundus examination, followed by fluorescein/indocyanine angiography revealing choroidal neovascularizations. Exclusion criteria comprised the presence of choroidal polypoidal vasculopathy or secondary choroidal neovascularizations due to pathologic myopia (>6 diopters, spherical equivalent), inflammatory or infectious chrorioretinal diseases, trauma, angioid streaks or hereditary diseases.

Each control participant underwent a detailed eye examination that included fundus examination. Exclusion criteria were defined as any evidence of age-related maculopathy (drusen as well as pigmentary changes), macular hemorrhages of any cause, or media opacities leading to impaired visualization of the macula.

Genotype determination

Venous blood drawn from the antecubital vein was collected in ethylene diamine tetraacetic acid tubes. Genomic DNA was isolated from whole blood using a commercial kit (QIA_AMP DNA blood mini kit; Qiagen, Vienna, Austria) and stored at −20 °C. PEDF genotype were determined by 5′-exonuclease assays (TaqMan). Primers and probes are summarized in Table 1. Fluorescence was measured in a lambda Fluoro 320 Plus plate reader (MWG Biotech AG, Penzberg, Germany) using excitation/emission filters of 485/530 nm for probes labeled with fluorescent dye FAM and 530/572 nm for probes labeled with fluorescent dye VIC. The data were exported into Excel format, depicted and analyzed as a scatter plot. The technicians responsible for genotyping were blinded for case/control status.

Table 1. Sequences of primers and probes used for the determination of the PEDF genotypes.

PEDF polymorphism Primers (5′-3′) and probes
−5736C>T (rs12150053)
F: CAGCCTGGGTGACAGAGT
R: AACCTTAGGTCAATGTATCACACTGTTC
WT-probe: VIC-TTTCCAGTGGAGACTC-NFQ
mutant probe: FAM-TTTTCCAATGGAGACTC-NFQ
−5304C>T (rs12948385)
F: CAACACACCTGGGTAATTTTGTTTGT
R: ACCTGAGGTCAGGAGTTCGA
WT-probe: VIC-TTCACCGTGTTGGCTAG-NFQ
mutant probe: FAM-TTCACCGTGTTGACTAG-NFQ
Met72Thr (rs1136287) F: CCAACTTCGGCTATGACCTGTAC
R: GAGACAGGAGCACGTTGGT
WT-probe: VIC-CCAGCATGAGCCCCA-NFQ
mutant probe: FAM-CAGCACGAGCCCCA-NFQ

PEDF genotypes were determined by 5′-exonuclease assays (TaqMan) using probes labeled with fluorescent dyes VIC or FAM. Abbreviations used in the table: F represents forward primer, R represents reverse primer, WT represents wild-type.

Statistics

SPSS for Windows (release 14.0; SPSS, Inc.) was used for statistical analyses. Continuous variables were analyzed by t-test and presented as mean±standard deviation (SD). Categorical variables are presented as percentages and were compared as chi-square test. Odds ratios (OR) and 95% confidence intervals (CI) were determined by logistic regression analysis. The criterion for statistical significance was p<0.05.

Results

Clinical characteristics of AMD patients and control participants are presented in Table 2. Table 3 shows PEDF genotype distribution in AMD patients and controls. In both groups, the observed genotype distributions were in line with those predicted by the Hardy–Weinberg equilibrium. PEDF genotype and allele frequencies were not significantly different between AMD patients and controls (Table 3). The two promoter polymorphisms, −5736T>C (rs12150053) and −5304C>T (rs12948385), were in complete association.

Table 2. Clinical characteristics of exudative AMD patients and controls.

Clinical characteristics Exudative AMD patients (n=269) Controls (n=155)
Females
178 (66.2)
86 (55.5)
Mean age±SD (years)
78.4±7.0
77.4±6.5
Range (years)
55.8–94.1
53.2–91.1
Body mass index *
26.3±3.9
26.7±4.0
Arterial hypertension
161 (59.9)
111 (71.6)
Hypercholesterolemia
193 (71.7)
101 (65.2)
Diabetes mellitus
26 (9.7)
22 (14.2)
Myocardial infarction
19 (7.1)
13 (8.4)
History of smoking 75 (27.9) 34 (21.9)

Numbers are given as n (%). Abbreviations: age-related macular degeneration (AMD); standard deviation (SD). The asterisk indicates that the data on body mass index were available from 205 AMD patients and 151 control subjects.

Table 3. PEDF genotypes in exudative AMD patients and controls.

Polymorphism Genotype Exudative AMD patients (n=269) Controls (n=155) p
Met72Thr (rs1136287)
Met/Met
111 (41.3%)
64 (41.3%)
0.81
Met/Thr
123 (45.7%)
74 (47.7%)

Thr/Thr
35 (13.0%)
17 (11.0%)

MAF
0.359
0.348
0.76
−5736T>C (rs12150053)
TT
108 (40.1%)
67 (43.2%)
0.71
TC
117 (43.5%)
61 (39.4%)

CC
44 (16.4%)
27 (17.4%)

MAF
0.381
0.371
0.77
−5304C>T (rs12948385) CC
108 (40.1%)
67 (43.2%)
0.71
CT
117 (43.5%)
61 (39.4%)

TT
44 (16.4%)
27 (17.4%)

MAF 0.381 0.371 0.77

Data indicate the number of eyes with and without exudative age-related macular degeneration (AMD), respectively. Numbers are given as n (%). Neither PEDF genotypes nor minor allele frequencies (MAF) were significantly associated with exudative AMD.

Presence of the homozygous PEDF 72 Met/Met genotype was associated with a nonsignificant OR of 1.00 (95% CI: 0.67–1.49, p=0.99). Similarly, presence of the homozygous PEDF−5736 TT genotype or −5304 CC genotype was associated with a nonsignificant OR of 0.99 (95% CI: 0.56–1.75, p=0.97). The observed OR was not substantially altered after adjustment of smoking habits (data not shown).

Both promoter polymorphisms were in linkage disequilibrium with the Met72Thr (rs1136287) polymorphism (D'=0.83). In total, three common haplotypes and one rare haplotype were formed by the PEDF polymorphisms investigated in the present study. Haplotype frequencies were similar between AMD patients and controls (Table 4).

Table 4. PEDF haplotype frequencies in exudative AMD patients and controls.

Haplotypes formed by Exudative AMD patients(n=269) Controls (n=155) p
C-T-Thr
0.361
0.338
0.51
T-C-Met
0.338
0.316
0.5
T-C-Thr
0.28
0.294
0.31
C-T-Met 0.02 0.033 0.26

Frequencies of haplotypes formed by PEDF polymorphisms −5736T>C (rs12150053), −5304C>T (rs12948385) and Met72Thr (rs1136287). Frequencies of haplotypes formed by PEDF polymorphisms −5736T>C (rs12150053), −5304C>T (rs12948385) and Met72Thr (rs1136287) did not significantly differ between patients and controls. Frequencies and p values were calculated using the HaploView 4.0 software.

Discussion

Exudative AMD has previously been shown to have a strong genetic component [26–39]. Only recently, a significantly increased prevalence of the PEDF 72 Met/Met genotype was reported in a Taiwan Chinese population, yielding an OR of 3.9 for exudative AMD [24]. This, however, has not yet been confirmed in other populations of different ethnic origin.

To the best of our knowledge, the present study is the first to investigate the potential role of this polymorphism in a white European population. In contrast to the findings of Lin et al. [24], homozygosity for the PEDF 72Met allele was not found to be significantly more prevalent in AMD patients compared with controls. Importantly, our study had a statistical power of 0.8 to detect or exclude an OR greater than or equal to 1.8. Thus, our data strongly suggest that the PEDF Met72Thr polymorphism itself is unlikely a major risk factor for exudative AMD in a white European population.

Interestingly, the PEDF 72Met allele frequency was 0.652 in our control group of white European subjects, which is substantially higher than the PEDF 72Met allele frequency of 0.311 found in a Taiwan Chinese population [24]. This finding indicates that genotype distributions of this polymorphism vary widely between different populations and thus underlines the importance of performing genetic association studies in various ethnicities.

As PEDF expression in RPE cells is also influenced by other factors such as oxidative stress [40], our finding that the PEDF Met72Thr polymorphism is not associated with exudative AMD risk in an European population does not argue against a role of PEDF in AMD. Beside the Met72Thr polymorphisms, other PEDF gene variations may be associated with exudative AMD. Recently, two polymorphisms in the PEDF promoter, −5736T>C (rs12150053) and −5304C>T (rs12948385), but not the Met72Thr polymorphism, were found to be associated with diabetic retinopathy [25,41]. The present study is also the first to investigate the potential association of these polymorphisms with exudative AMD. A major finding of our study was that the two polymorphisms did not confer a significantly increased risk for exudative AMD in a white European population.

Currently, the functionality of the PEDF polymorphisms investigated in the present study is unclear. A variety of putative binding sites for transcription factors and two Alu repetitive sequences have been described in the PEDF promoter [9], but the two promoter polymorphisms (−5736T>C [rs12150053] and −5304C>T [rs12948385]) we investigated do not affect any of these putative binding sites. The Met72Thr polymorphism lies at the end of a helix domain of the PEDF protein and results in the exchange of a hydrophobic amino acid (methionine) by a polar amino acid (threonine) [23]. Nevertheless, the functional consequences of this exchange are currently unknown. Further studies investigating the influence of these polymorphisms on the expression and function of the PEDF protein will be necessary to clarify their functionality.

Previous studies have clearly demonstrated that PEDF itself is able to inhibit the development of choroidal neovascularizations [19–21]. Considering the antiangiogenic and anti-vasopermeability effects of PEDF [11,12], it remains to be determined whether gene polymorphisms affecting the expression of PEDF in the chorioretinal tissue may modulate the efficacy as well as frequency of anti-vascular endothelial growth factor treatment. Thus, further studies focusing on the identification of functional PEDF polymorphisms and their potential association with treatment outcome might be of great interest.

Acknowledgments

We thank Gabriele Trummer, Christa Wachswender, Manuela Fischl, and Sieglinde Kirchengast for their excellent technical assistance.

References

  • 1.Klein R, Klein BE, Linton KL. Prevalence of age-related maculopathy. The Beaver Dam Eye Study. Ophthalmology. 1992;99:933–43. doi: 10.1016/s0161-6420(92)31871-8. [DOI] [PubMed] [Google Scholar]
  • 2.Mitchell P, Smith W, Attebo K, Wang JJ. Prevalence of age-related maculopathy in Australia. The Blue Mountains Eye Study. Ophthalmology. 1995;102:1450–60. doi: 10.1016/s0161-6420(95)30846-9. [DOI] [PubMed] [Google Scholar]
  • 3.National Advisory Eye Council. Report of the retinal diseases panel:vision research: a national plan, 1994–1998.Bethesda MD: United Staes Department of Health and Human Services, Publication NIH93–3186, 1993. [Google Scholar]
  • 4.Ohno-Matsui K, Morita I, Tombran-Tink J, Mrazek D, Onodera M, Uetama T, Hayano M, Murota SI, Mochizuki M. Novel mechanism for age-related macular degeneration: an equilibrium shift between the angiogenesis factors VEGF and PEDF. J Cell Physiol. 2001;189:323–33. doi: 10.1002/jcp.10026. [DOI] [PubMed] [Google Scholar]
  • 5.Zhang SX, Ma JX. Ocular neovascularization: Implication of endogenous angiogenic inhibitors and potential therapy. Prog Retin Eye Res. 2007;26:1–37. doi: 10.1016/j.preteyeres.2006.09.002. [DOI] [PubMed] [Google Scholar]
  • 6.Bhutto IA, Uno K, Merges C, Zhang L, McLeod DS, Lutty GA. Reduction of endogenous angiogenesis inhibitors in Bruch's membrane of the submacular region in eyes with age-related macular degeneration. Arch Ophthalmol. 2008;126:670–8. doi: 10.1001/archopht.126.5.670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tombran-Tink J, Johnson LV. Neuronal differentiation of retinoblastoma cells induced by medium conditioned by human RPE cells. Invest Ophthalmol Vis Sci. 1989;30:1700–7. [PubMed] [Google Scholar]
  • 8.Steele FR, Chader GJ, Johnson LV, Tombran-Tink J. Pigment epithelium-derived factor: neurotrophic activity and identification as a member of the serine protease inhibitor gene family. Proc Natl Acad Sci USA. 1993;90:1526–30. doi: 10.1073/pnas.90.4.1526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tombran-Tink J, Mazuruk K, Rodriguez IR, Chung D, Linker T, Englander E, Chader GJ. Organization, evolutionary conservation, expression and unusual Alu density of the human gene for pigment epithelium-derived factor, a unique neurotrophic serpin. Mol Vis. 1996;2:11. [PubMed] [Google Scholar]
  • 10.Simonovic M, Gettins PG, Volz K. Crystal structure of human PEDF, a potent anti-angiogenic and neurite growth-promoting factor. Proc Natl Acad Sci USA. 2001;98:11131–5. doi: 10.1073/pnas.211268598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dawson DW, Volpert OV, Gillis P, Crawford SE, Xu H, Benedict W, Bouck NP. Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science. 1999;285:245–8. doi: 10.1126/science.285.5425.245. [DOI] [PubMed] [Google Scholar]
  • 12.Liu H, Ren JG, Cooper WL, Hawkins CE, Cowan MR, Tong PY. Identification of the antivasopermeability effect of pigment epithelium-derived factor and its active site. Proc Natl Acad Sci USA. 2004;101:6605–10. doi: 10.1073/pnas.0308342101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tombran-Tink J, Barnstable CJ. PEDF: a multifaceted neurotrophic factor. Nat Rev Neurosci. 2003;4:628–36. doi: 10.1038/nrn1176. [DOI] [PubMed] [Google Scholar]
  • 14.Karakousis PC, John SK, Behling KC, Surace EM, Smith JE, Hendrickson A, Tang WX, Bennett J, Milam AH. Localization of pigment epithelium derived factor (PEDF) in developing and adult human ocular tissues. Mol Vis. 2001;7:154–63. [PubMed] [Google Scholar]
  • 15.Bhutto IA, McLeod DS, Hasegawa T, Kim SY, Merges C, Tong P, Lutty GA. Pigment epithelium-derived factor (PEDF) and vascular endothelial growth factor (VEGF) in aged human choroid and eyes with age-related macular degeneration. Exp Eye Res. 2006;82:99–110. doi: 10.1016/j.exer.2005.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Holekamp NM, Bouck N, Volpert O. Pigment epithelium-derived factor is deficient in the vitreous of patients with choroidal neovascularization due to age-related macular degeneration. Am J Ophthalmol. 2002;134:220–7. doi: 10.1016/s0002-9394(02)01549-0. [DOI] [PubMed] [Google Scholar]
  • 17.Renno RZ, Youssri AI, Michaud N, Gragoudas ES, Miller JW. Expression of pigment epithelium-derived factor in experimental choroidal neovascularization. Invest Ophthalmol Vis Sci. 2002;43:1574–80. [PubMed] [Google Scholar]
  • 18.Ogata N, Wada M, Otsuji T, Jo N, Tombran-Tink J, Matsumura M. Expression of pigment epithelium-derived factor in normal adult rat eye and experimental choroidal neovascularization. Invest Ophthalmol Vis Sci. 2002;43:1168–75. [PubMed] [Google Scholar]
  • 19.Mori K, Gehlbach P, Yamamoto S, Duh E, Zack DJ, Li Q, Berns KI, Raisler BJ, Hauswirth WW, Campochiaro PA. AAV-mediated gene transfer of pigment epithelium-derived factor inhibits choroidal neovascularization. Invest Ophthalmol Vis Sci. 2002;43:1994–2000. [PubMed] [Google Scholar]
  • 20.Saishin Y, Silva RL, Saishin Y, Kachi S, Aslam S, Gong YY, Lai H, Carrion M, Harris B, Hamilton M, Wei L, Campochiaro PA. Periocular gene transfer of pigment epithelium-derived factor inhibits choroidal neovascularization in a human-sized eye. Hum Gene Ther. 2005;16:473–8. doi: 10.1089/hum.2005.16.473. [DOI] [PubMed] [Google Scholar]
  • 21.Campochiaro PA, Nguyen QD, Shah SM, Klein ML, Holz E, Frank RN, Saperstein DA, Gupta A, Stout JT, Macko J, DiBartolomeo R, Wei LL. Adenoviral vector-delivered pigment epithelium-derived factor for neovascular age-related macular degeneration: results of a phase I clinical trial. Hum Gene Ther. 2006;17:167–76. doi: 10.1089/hum.2006.17.167. [DOI] [PubMed] [Google Scholar]
  • 22.Yamagishi S, Nakamura K, Inoue H, Takeuchi M. Met72Thr polymorphism of pigment epithelium-derived factor gene and susceptibility to age-related macular degeneration. Med Hypotheses. 2005;64:1202–4. doi: 10.1016/j.mehy.2005.01.017. [DOI] [PubMed] [Google Scholar]
  • 23.Koenekoop R, Pina AL, Loyer M, Davidson J, Robitaille J, Maumenee I, Tombran-Tink J. Four polymorphic variations in the PEDF gene identified during the mutation screening of patients with Leber congenital amaurosis. Mol Vis. 1999;5:10. [PubMed] [Google Scholar]
  • 24.Lin JM, Wan L, Tsai YY, Lin HJ, Tsai Y, Lee CC, Tsai CH, Tseng SH, Tsai FJ. Pigment Epithelium-Derived Factor Gene Met72Thr Polymorphism Is Associated With Increased Risk of Wet Age-related Macular Degeneration. Am J Ophthalmol. 2008;145:716–21. doi: 10.1016/j.ajo.2007.11.006. [DOI] [PubMed] [Google Scholar]
  • 25.Iizuka H, Awata T, Osaki M, Neda T, Kurihara S, Inoue K, Inukai K, Kabasawa S, Mori K, Yoneya S, Katayama S. Promoter polymorphisms of the pigment epithelium-derived factor gene are associated with diabetic retinopathy. Biochem Biophys Res Commun. 2007;361:421–6. doi: 10.1016/j.bbrc.2007.07.025. [DOI] [PubMed] [Google Scholar]
  • 26.Hageman GS, Anderson DH, Johnson LV, Hancox LS, Taiber AJ, Hardisty LI, Hageman JL, Stockman HA, Borchardt JD, Gehrs KM, Smith RJ, Silvestri G, Russell SR, Klaver CC, Barbazetto I, Chang S, Yannuzzi LA, Barile GR, Merriam JC, Smith RT, Olsh AK, Bergeron J, Zernant J, Merriam JE, Gold B, Dean M, Allikmets R. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci USA. 2005;102:7227–32. doi: 10.1073/pnas.0501536102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS, Haynes C, Henning AK, SanGiovanni JP, Mane SM, Mayne ST, Bracken MB, Ferris FL, Ott J, Barnstable C, Hoh J. Complement factor H polymorphism in age-related macular degeneration. Science. 2005;308:385–9. doi: 10.1126/science.1109557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Haines JL, Hauser MA, Schmidt S, Scott WK, Olson LM, Gallins P, Spencer KL, Kwan SY, Noureddine M, Gilbert JR, Schnetz-Boutaud N, Agarwal A, Postel EA, Pericak-Vance MA. Complement factor H variant increases the risk of age-related macular degeneration. Science. 2005;308:419–21. doi: 10.1126/science.1110359. [DOI] [PubMed] [Google Scholar]
  • 29.Edwards AO, Ritter R, 3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science. 2005;308:421–4. doi: 10.1126/science.1110189. [DOI] [PubMed] [Google Scholar]
  • 30.Okamoto H, Umeda S, Obazawa M, Minami M, Noda T, Mizota A, Honda M, Tanaka M, Koyama R, Takagi I, Sakamoto Y, Saito Y, Miyake Y, Iwata T. Complement factor H polymorphisms in Japanese population with age-related macular degeneration. Mol Vis. 2006;12:156–8. [PubMed] [Google Scholar]
  • 31.Rivera A, Fisher SA, Fritsche LG, Keilhauer CN, Lichtner P, Meitinger T, Weber BH. Hypothetical LOC387715 is a second major susceptibility gene for age-related macular degeneration, contributing independently of complement factor H to disease risk. Hum Mol Genet. 2005;14:3227–36. doi: 10.1093/hmg/ddi353. [DOI] [PubMed] [Google Scholar]
  • 32.Dewan A, Liu M, Hartman S, Zhang SS, Liu DT, Zhao C, Tam PO, Chan WM, Lam DS, Snyder M, Barnstable C, Pang CP, Hoh J. HTRA1 promoter polymorphism in wet age-related macular degeneration. Science. 2006;314:989–92. doi: 10.1126/science.1133807. [DOI] [PubMed] [Google Scholar]
  • 33.Yang Z, Camp NJ, Sun H, Tong Z, Gibbs D, Cameron DJ, Chen H, Zhao Y, Pearson E, Li X, Chien J, Dewan A, Harmon J, Bernstein PS, Shridhar V, Zabriskie NA, Hoh J, Howes K, Zhang K. A variant of the HTRA1 gene increases susceptibility to age-related macular degeneration. Science. 2006;314:992–3. doi: 10.1126/science.1133811. [DOI] [PubMed] [Google Scholar]
  • 34.Gold B, Merriam JE, Zernant J, Hancox LS, Taiber AJ, Gehrs K, Cramer K, Neel J, Bergeron J, Barile GR, Smith RT. AMD Genetics Clinical Study Group, Hageman GS, Dean M, Allikmets R. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nat Genet. 2006;38:458–62. doi: 10.1038/ng1750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Spencer KL, Hauser MA, Olson LM, Schmidt S, Scott WK, Gallins P, Agarwal A, Postel EA, Pericak-Vance MA, Haines JL. Protective effect of complement factor B and complement component 2 variants in age-related macular degeneration. Hum Mol Genet. 2007;16:1986–92. doi: 10.1093/hmg/ddm146. [DOI] [PubMed] [Google Scholar]
  • 36.Yates JR, Sepp T, Matharu BK, Khan JC, Thurlby DA, Shahid H, Clayton DG, Hayward C, Morgan J, Wright AF, Armbrecht AM, Dhillon B, Deary IJ, Redmond E, Bird AC, Moore AT, Genetic Factors in AMD Study Group. Complement C3 variant and the risk of age-related macular degeneration. N Engl J Med. 2007;357:553–61. doi: 10.1056/NEJMoa072618. [DOI] [PubMed] [Google Scholar]
  • 37.Maller JB, Fagerness JA, Reynolds RC, Neale BM, Daly MJ, Seddon JM. Variation in complement factor 3 is associated with risk of age-related macular degeneration. Nat Genet. 2007;39:1200–1. doi: 10.1038/ng2131. [DOI] [PubMed] [Google Scholar]
  • 38.Weger M, Renner W, Steinbrugger I, Köfer K, Wedrich A, Groselj-Strele A, El-Shabrawi Y, Schmut O, Haas A. Association of the HTRA1 −625G>A promoter gene polymorphism with exudative age-related macular degeneration in a Central European population. Mol Vis. 2007;13:1274–9. [PubMed] [Google Scholar]
  • 39.Wegscheider BJ, Weger M, Renner W, Steinbrugger I, März W, Mossböck G, Temmel W, El-Shabrawi Y, Schmut O, Jahrbacher R, Haas A. Association of complement factor H Y402H gene polymorphism with different subtypes of exudative age-related macular degeneration. Ophthalmology. 2007;114:738–42. doi: 10.1016/j.ophtha.2006.07.048. [DOI] [PubMed] [Google Scholar]
  • 40.Ohno-Matsui K, Morita I, Tombran-Tink J, Mrazek D, Onodera M, Uetama T, Hayano M, Murota SI, Mochizuki M. Novel mechanism for age-related macular degeneration: an equilibrium shift between the angiogenesis factors VEGF and PEDF. J Cell Physiol. 2001;189:323–33. doi: 10.1002/jcp.10026. [DOI] [PubMed] [Google Scholar]
  • 41.Yamagishi S, Amano S, Inagaki Y, Okamoto T, Koda Y, Soejima M, Kimura H. Pigment epithelium-derived factor Met72Thr polymorphism in patients with diabetic microangiopathy. Int J Clin Pharmacol Res. 2002;22:67–71. [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES