Skip to main content
NCBI home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2009 Feb 17.
Published in final edited form as: Oncogene. 2008 Sep 22;27(57):7150–7161. doi: 10.1038/onc.2008.335

Colorectal cancer cells with the BRAFV600E mutation are addicted to the ERK1/2 pathway for growth factor-independent survival and repression of BIM

JA Wickenden 1, H Jin 2, M Johnson 1, AS Gillings 1, C Newson 1, M Austin 1, SD Chell 1, K Balmanno 1, CA Pritchard 2, SJ Cook 1
PMCID: PMC2643813  EMSID: UKMS3761  PMID: 18806830

Abstract

The RAF-mitogen-activated protein kinase kinase 1/2-extracellular signal-regulated kinase 1/2 (RAF-MEK1/2-ERK1/2) pathway is activated in many human tumours and can protect cells against growth factor deprivation; however, most such studies have relied upon overexpression of RAF or MEK constructs that are not found in tumours. Here we show that expression of the endogenous BRAFV600E allele in mouse embryonic fibroblasts from conditional knock-in transgenic mice activates ERK1/2, represses the BH3-only protein BIM and protects cells from growth factor withdrawal. Human colorectal cancer (CRC) cell lines harbouring BRAFV600E are growth factor independent for the activation of ERK1/2 and survival. However, treatment with the MEK1/2 inhibitors U0126, PD184352 or the novel clinical candidate AZD6244 (ARRY-142886) overcomes growth factor independence, causing CRC cell death. BIM is de-phosphorylated and upregulated following MEK1/2 inhibition in all CRC cell lines studied and knockdown of BIM reduces cell death, indicating that repression of BIM is a major part of the ability of BRAFV600E to confer growth factor-independent survival. We conclude that a single endogenous BRAFV600E allele is sufficient to repress BIM and prevent death arising from growth factor withdrawal, and CRC cells with BRAFV600E mutations are addicted to the ERK1/2 pathway for repression of BIM and growth factor-independent survival.

Keywords: apoptosis, BIM, BRAF, colorectal cancer, ERK1/2

Introduction

Most normal cells are dependent upon growth factors for their survival and proliferation, whereas cancer cells are growth factor independent and can evade apoptosis (Hanahan and Weinberg, 2000). Apoptosis following withdrawal of growth factors is regulated by the BCL-2 protein family in which the pro-apoptotic BAX and BAK proteins are restrained by their interaction with the antiapoptotic BCL-2 family members, such as BCL-2 and MCL-1; this balance is disrupted by the binding of BH3-only proteins to BCL-2 or MCL-1, thereby releasing BAX or BAK to promote cell death (Cory et al., 2003; Chen et al., 2005; Willis et al., 2007). BIM is a BH3-only protein that promotes cell death following withdrawal of survival factors (Bouillet et al., 1999; Dijkers et al., 2000; Ewings et al., 2007a). Survival factors repress BIM expression by reducing its transcription (Dijkers et al., 2000; Gilley et al., 2003). In addition, the most abundant splice variant, BIMEL, is phosphorylated by extracellular signal-regulated kinase 1/2 (ERK1/2), preventing it from binding to its target pro-survival BCL-2 proteins (Ewings et al., 2007a; Ewings et al., 2007b) and promoting its proteasomal turnover (Ley et al., 2003; Luciano et al., 2003; Weston et al., 2003; Ley et al., 2004; Marani et al., 2004; Ley et al., 2005).

The RAF-mitogen-activated protein kinase kinase 1/2-ERK1/2 (RAF-MEK-ERK1/2) signalling pathway is activated in human tumours because of activating mutations in RAS or BRAF. BRAFV600E is found in 10-25% of human colorectal cancers (CRC) (Davies et al., 2002; Mercer and Pritchard, 2003), early in the adenoma to carcinoma sequence (Rajagopalan et al., 2002; Yuen et al., 2002), and cancer cells harbouring BRAFV600E typically exhibit high ERK1/2 activity. Although tumours accumulate numerous mutations, they evolve to be dependent on a specific oncogene(s) to maintain the malignant phenotype; a phenomenon termed ‘oncogene addiction’ (Weinstein, 2002). Several studies have shown that the activation of ERK1/2 can inhibit BIM expression and prevent cell death arising from growth factor withdrawal (Ley et al., 2003; Luciano et al., 2003; Weston et al., 2003; Marani et al., 2004). However, these studies have typically involved the overexpression of RAF or MEK mutants or the use of conditional kinases that are not found in human tumours and may not faithfully mimic the effects of BRAFV600E.

Here we show that conditional activation of a single BRAFV600E allele in primary mouse embryonic fibroblasts (MEFs) from transgenic conditional knock-in mice is sufficient to repress BIM expression and protect against growth factor withdrawal. CRC cell lines with BRAFV600E fail to upregulate BIM or undergo apoptosis following growth factor withdrawal unless the ERK1/2 pathway is also inhibited; furthermore, death arising from inhibition of the ERK1/2 pathway is substantially reduced by the use of short hairpin RNA or small interfering RNA (siRNA) to BIM. These data suggest that CRC cells with BRAFV600E are addicted to the ERK1/2 pathway for the repression of BIM and growth factor-independent survival.

Results

Expression of a single endogenous BRAFV600E allele is sufficient to repress BIM and protect cells from growth factor withdrawal

BrafLSL-V600E mice conditionally express a knock-in mutation of BrafV600E (Mercer et al., 2005); Cre recombinase activity is required to induce recombination of the Lox-STOP-Lox cassette and allow expression of BRafV600E (Figure 1a). We used the CreER™ system in which Cre is expressed as a fusion protein with a tamoxifen-responsive version of the hormone-binding domain of the oestrogen receptor (Hayashi and McMahon, 2002). Primary MEFs derived from Braf+/LSL-V600E;CreER™ double heterozygote embryos were treated over a time course with 4-HT (4-hydroxytamoxifen). The CreER™ protein was stabilized and localized to the nucleus within 5 h (Figure 1 b), but full recombination of the BrafLSL-V600E allele was not achieved until 96 h (Figure 1c). These studies show for the first time the efficient regulation of a floxed allele by the CreER™ protein and establish the conditions for maximal induction of the BrafV600E allele by 4-HT.

Figure 1.

Figure 1

Open in a new tab

Regulation of endogenous BRAFV600E expression using CreER™. (a) Induction of V600EBRaf by CreER™. Conversion of the LSL-BrafV600E allele expressing WTBRaf to the Lox-BrafV600E allele expressing V600EBRaf is shown. This allele is described in full in Mercer et al. (2005). Mice heterozygous for BrafLSL-V600E and CreER™ alleles were intercrossed and MEFs were obtained from resulting E14.5 embryos. To induce activation of Cre, and thus LSL recombination, MEFs were treated with 4-HT. (b) Immunofluorescence of Cre. Braf+/LSL-V600E;CreER™ MEFs were treated over a time course of up to 96 h with 4-HT and immunostained with a Cre antibody (green), counterstained with DAPI (blue) and the images merged. 4-HT induces a rapid translocation of the CreER™ protein within 5 h, and it remains here throughout the time course. (c) PCR detection of LSL-BrafV600E recombination. Braf+/LSL-V600E;CreER™ MEFs were treated with 4-HT or carrier control for the time course indicated, genomic DNA was isolated and subjected to PCR with the primers described in Mercer et al. (2005). Recombination is first detected within 5 h of 4-HT treatment and continues to increase in level throughout the time course. By 96 h, recombination is almost complete as indicated by the virtual absence of the LSL-BrafV600E allele and the high level of the Lox-BrafV600E allele. DAPI, 4′,6-diamidino-2-phenylindole; MEFs, mouse embryonic fibroblasts.

Primary MEFs derived from either Braf+/+;CreER™ or Braf+/LSL-V600E;CreER™ embryos underwent apoptosis following serum starvation. Inclusion of 4-HT to induce BrafV600E expression strongly inhibited this apoptotic response in Braf+/LSL-V600E;CreER™ MEFs but not in Braf+/+;CreER™ MEFs as measured by three different apoptosis assays (Figure 2a and Supplementary Figure S1). This protective effect of 4-HT was due to BRAFV600E-dependent activation of the MEK-ERK1/2 pathway as it was reversed by the MEK inhibitor U0126 (Figure 2b). 4-HT treatment was able to partially reverse the loss of mitochondrial membrane potential (MMP) arising from serum withdrawal in Braf+/LSL-V600E;CreER™ MEFs but not in Braf+/+;CreER™ MEFs (Figure 2c).

Figure 2.

Figure 2

Open in a new tab

Conditional expression of a single endogenous BRAFV600E allele protects MEFs from growth factor withdrawal. (a) BrafLSL-V600E MEFs and control Braf+/+ MEFs containing the CreER™ allele were treated with 4-HT or carrier control for 96 h after which they were treated for 48 h in the presence (FBS) or absence (SF) of growth factors. The cells were subjected to an annexin V assay. Results are the mean ± s.e.m. pooled from at least three experiments. (b) BrafLSL-V600E MEFs containing the CreER™ allele were treated with 4-HT or carrier control for 96 h after which they were treated for 48 h in the presence (FBS) or absence (SF) of growth factors, with or without 10 μm U0126 and subjected to an annexin V assay. Results are the mean ± s.e.m. pooled from at least three experiments. (c) BrafLSL-V600E MEFs and control Braf+/+ MEFs containing the CreER™ allele were treated with 4-HT or carrier control for 96 h, they were then treated for 48 h in the presence (FBS) or absence (SF) of growth factors after which MMPwas measured. Results are the mean ± s.e.m. pooled from at least three experiments. FBS, fetal bovine serum; MEFs, mouse embryonic fibroblasts.

BCL-2 proteins control the loss of mitochondrial membrane potential, and BIM has been implicated in the death of MEFs following the loss of growth factors (Ewings et al., 2007a). Indeed, when Braf+/LSL-V600E;CreER™ MEFs were serum starved, there was a striking increase in BIM expression, predominantly the BIMEL isoform, which was completely prevented by the inclusion of 4-HT (Figure 3a). Serum withdrawal from Braf+/LSL-V600E;CreER™ MEFs caused only a modest increase in BIM mRNA levels, as judged by (quantitative) reverse transcription PCR (Q)RT-PCR), and 4-HT treatment did not reverse this (Figure 3b). However, the expression of BrafV600E did cause the MEK-dependent hyperphosphorylation of BIMEL, and the BrafV600E-dependent downregulation of BIMEL was reversed by the inclusion of the proteasome inhibitor MG132 (Figure 3c); furthermore, MG132 potentiated the induction of BIMEL upon serum withdrawal. These results indicate that the expression of a single BrafV600E allele is sufficient to repress BIM expression and it does so largely by promoting the phosphorylation and proteasome-dependent turnover of BIMEL rather than by repressing BIM transcription.

Figure 3.

Figure 3

Open in a new tab

Expression of a single endogenous BRAFV600E allele inhibits the expression of BIMEL following growth factor withdrawal. (a) BrafLSL-V600E MEFs containing the CreER™ allele were treated with (+) or without (−) 4-HT for 96 h after which they were grown in the absence of growth factors (SF) over a time course of up to 72 h. Protein lysates were prepared at each time point, and western blots prepared and analysed with antibodies for BIM, phospho-ERK and ERK2. (b) BrafLSL-V600E MEFs containing the CreER™ allele were treated with or without 4-HT for 96 h after which they were treated for 48 h in the presence (FBS) or absence (SF) of growth factors. BIM mRNA levels were normalized to those of GAPDH, and the result is the mean ± s.e.m. of three experiments. (c) BrafLSL-V600E MEFs containing the CreER™ allele were treated with or without 4-HT for 96 h after which they were treated for 48 h in the presence (FBS) of growth factors, in the absence (SF) of growth factors, in SF with 30 μm MG132 or in SF with 30 μm MG132 and 10 μm U0126. Protein lysates were prepared and subjected to western blot analysis with the antibodies indicated as described in Materials and methods. ERK2, extracellular signal-regulated kinase 2; FBS, fetal bovine serum; MEFs, mouse embryonic fibroblasts.

Growth factor-independent survival in colorectal cancer cells with the BRAFV600E mutation is reversed by the inhibition of MEK1/2

Initial experiments revealed that COLO205 cells fail to increase caspase/DEVDase activity (Figures 4a and b) or die (Figure 4c) following serum withdrawal. Similar results were observed in three other BRAFV600E-positive CRC cell lines (J Wickenden and S Cook, unpublished observations). In contrast, when COLO205 cells were serum starved in the presence of U0126, caspase activation was strikingly enhanced and accelerated (Figure 4a) and there was a large increase in the number of dead cells (Figure 4c); this was also seen in HT29, LS411 and CO115 cells (summarized in Figure 4d). U0126 also induced some death in cells maintained in fetal bovine serum (FBS) in some instances (for example, COLO205 cells, Figures 4a and c). The effect of U0126 was dose dependent; half-maximal cell death being induced by 300 nm−1 μm U0126 (Figure 4e). In addition, the effect of U0126 was replicated by PD184352, a more selective MEK1/2 inhibitor (Figure 4f).

Figure 4.

Figure 4

Open in a new tab

Inhibition of MEK overcomes growth factor-independent survival in CRC cells with BRAFV600E. (a and b) COLO205 cells were serum starved (SF) or placed in fresh FBS-containing medium (FBS) with or without 20 μm U0126 as indicated. Cells were then assayed for DEVDase activity and each data point represents (a) the mean ± range of duplicate dishes of cells or (b) the mean ± s.e.m. pooled from at least three experiments performed in duplicate. (c) COLO205 cells were treated 30 h in the presence (FBS) or absence (SF) of serum, with or without 20 μm U0126 and analysed for the percentage of cells with sub-G1 DNA. (d) The indicated cell lines were treated for 30 h in the presence (FBS) or serum starved with 20 μm U0126 and analysed for the percentage of cells with sub-G1 DNA. (e) HT29 cells were maintained in FBS or serum starved in the presence of increasing concentrations of U0126 for 30 h and analysed for the percentage of cells with sub-G1 DNA. (f) HT29 and COLO205 cells were maintained in FBS or serum starved with 2 μm PD184352 in the presence of increasing doses of zVAD.fmk for 30 h before being analysed for the percentage of cells with sub-G1 DNA. In (a), (e) and (f), results are mean ± s.d. from a single experiment performed with biological triplicates; similar results were obtained in two further experiments. In (b-d), results are the mean ± s.e.m. pooled from at least three experiments performed in duplicate ± s.e.m. *P<0.05, **P<0.01, ***P<0.001. CRC, colorectal cancer; FBS, fetal bovine serum.

Although death arising from MEK inhibition was inhibited by the caspase inhibitor zVAD.fmk in HT29 cells, death of COLO205 (Figure 4f) and LS411 cells (Supplementary Figure S2A) was largely caspase independent (Figure 4f). zVAD.fmk was fully competent to inhibit caspase activity in COLO205 cells (Supplementary Figure S2B) and had no off-target effects on de-phosphorylation of ERK1/2 or expression of BIM (Supplementary Figure S2C). This indicates that although caspases are activated during MEK inhibitor-induced cell death in COLO205 and LS411 cells, death can proceed through an alternative pathway if caspase activation is blocked.

Inhibition of MEK1/2 results in de-phosphorylation and accumulation of BIM protein

BIM is rate determining for cell death following withdrawal of survival factors (Bouillet et al., 1999; Ewings et al., 2007a). BIMEL was the major BIM isoform present in COLO205 and HT29 cells maintained in 10% FBS and migrated as a diffuse hyperphosphorylated series of bands (Figures 5a and b). Although serum starvation inactivates ERK1/2 and promotes BIM expression in fibroblasts (Weston et al., 2003; Ewings et al., 2007a), it did not inactivate ERK1/2 and caused little increase in BIM expression in CRC cells (Figures 5a and b). However, the addition of U0126 to cells (whether in 10% FBS or serum starved) resulted in the rapid de-phosphorylation of ERK1/2 and BIMEL and an increase in BIMEL levels. U0126 did not affect the antiapoptotic BCL-2 proteins, except at 24 h when decreased levels of BCL-2 and MCL-1 were observed (Figure 5a). BIM expression is also repressed by the phosphatidylinositol 3-hydroxykinase (PI3K)-dependent protein kinase B (PKB) pathway (Dijkers et al., 2000; Gilley et al., 2003), but U0126 did not influence PKB phosphorylation (Figure 5a). Furthermore, serum starvation caused de-phosphorylation of PKB but had little effect on BIM levels (Figure 5a); similar results were observed in LS411 and CO115 cells (Supplementary Figure S3A and B) despite the very strong constitutive activation of PKB in CO115 cells (Supplementary Figure S3C). These data demonstrate that BRAFV600E-positive CRC cells are growth factor independent for ERK1/2 activation and repression of BIM, this can be reversed by the administration of an MEK1/2 inhibitor and the ERK1/2 pathway is the dominant pathway for the repression of BIM in these cells.

Figure 5.

Figure 5

Open in a new tab

MEK inhibition promotes de-phosphorylation and increased expression of BIMEL in CRC cells with BRAFV600E. COLO205 cells (a) and HT29 cells (b) were maintained in FBS or serum starved (SF) with or without 20 μm U0126 before lysis and western blotting analysis as described in Materials and methods. Results are representative of three independent experiments for each cell line. Similar results were obtained in LS411 and CO115 cells (Supplementary Figure S4). (c) COLO205 cells maintained in FBS were treated with 2 μm AZD6244 or 10 μm U0126 for the indicated times and probed for BIM expression by western blot; ERK1 was used as a loading control. (d and e) HT29 cells were serum starved with or without 2 μm AZD6244 for indicated times. (d) The percentage of cells with sub-G1 DNA was determined by flow cytometry and data shown are mean ± s.d. of biological triplicates from a single experiment representative of three. **P<0.01. (e) Cell lysates were probed for BIM, MCL-1 and P-ERK1/2 by western blot; ERK1 was used as a loading control. Results are representative of three independent experiments. CRC, colorectal cancer; ERK1/2, extracellular signal-regulated kinase 1/2; FBS, fetal bovine serum.

AZD6244 (ARRY-142886) is a potent and selective MEK1/2 inhibitor that is undergoing pre-clinical and clinical evaluation (Wallace et al., 2006; Davies et al., 2007) and which does not inhibit the ERK5 pathway (Balmanno et al., submitted). AZD6244 was able to cause a substantial increase in the basal expression of BIM, predominantly BIMEL, even in COLO205 cells maintained in FBS (Figure 5c). Treatment of HT29 cells with AZD6244 overcame growth factor-independent survival, resulting in substantial cell death (Figure 5d), and also caused the de-phosphorylation of BIMEL and enhanced its expression upon serum withdrawal (Figure 5e). Thus, the MEK1/2-specific clinical candidate, AZD6244, replicated our results with U0126.

Reduced BIM expression protects HT29 cells against death induced by U0126 and AZD6244

Growth factor withdrawal-induced cell death requires de novo protein synthesis in some systems (Weston et al., 2003). Indeed, cycloheximide protected cells from caspase activation arising from MEK inhibition (Supplementary Figure S4A), exacerbated the reduction in MCL-1 and also reduced both basal and induced expression of BIMEL (Supplementary Figure S4B). As BIM expression decreases and cells are protected under these conditions, we considered that BIM might contribute to MEK inhibitor-induced cell death. To test this, we used RNA interference to reduce BIM expression. HT29 cells formed the focus of the RNAi experiments as their death was largely caspase dependent (Figure 4f), and BIM is primarily involved in the activation of caspase-dependent death pathways.

To assess the function of BIM, we used lentivirus (Wiznerowicz and Trono, 2003) to deliver short hairpin RNA against BIM to HT29 cells. BIM protein expression was reduced by 50-60% though it was not possible to fully prevent the increase in BIMEL following treatment with serum-free medium (SF) with U0126 (SF + U0126) (Supplementary Figure S5A); other members of the BCL-2 family were unaffected. Overexposure of the BIM blot revealed knockdown of smaller BIM splice variants. A control virus expressing the same sequence but with four mismatches (BIM-MM) did not affect BIM protein levels. Treatment with SF + U0126 in WT cells increased the fraction of cells with sub-G1 DNA and this was significantly reduced in the BIM RNAi cells, whereas the BIM mismatch sequence had no effect (Supplementary Figure S5B). As a control, cisplatin-induced cell death was unaffected by the short hairpin RNAs used.

This partial reduction in cell death could reflect partial knockdown of BIM, a partial function for BIM or adaptation during the selection of virally infected cells. To address this, we used siRNA oligos to knock down human BIM transiently (Figure 6a). Knockdown of BIM was complete under these conditions (Figure 6b) and reduced death arising from the combination of serum withdrawal and U0126 or AZD6244 by 60% (Figure 6c). The corresponding siRNA oligos from mouse BIM, used as a control (Figure 6a), failed to reduce BIM expression and had no effect on cell death (Figures 6b and c). Thus, BIM contributes in large part to cell death arising when HT29 cells are serum starved in the presence of U0126 or AZD6244.

Figure 6.

Figure 6

Open in a new tab

siRNA-mediated silencing of BIM protects HT29 cells against death induced by MEK inhibition. (a) HT29 cells were mock transfected (c) or transfected with murine (Mm) or human (Hs) BIM-specific siRNA oligos. The cells were then serum starved in the presence of U0126 to induce BIM. Whole-cell extracts were probed for BIM, BAK and BAX expression. (b and c) HT29 cells in six-well plates were mock transfected (Con) or transfected with murine (Mm) or human (Hs) BIM-specific siRNA oligos; four wells were transfected in each condition. Cells were then left in complete medium or switched to serum-free medium with 20 μm U0126 (SF U0) or 2 μm AZD6244 (SF AZ) for 30 h. (b) One well of each condition was used to blot for BIM, P-ERK1/2 and ERK1. (c) Three wells of each condition were analysed for the percentage of cells with sub-G1 DNA. Data are mean ± s.d. of biological triplicates from a single experiment; similar results were obtained in a total of three experiments. **P<0.005. ERK1/2, extracellular signal-regulated kinase 1/2; siRNA, small interfering RNA.

BRAFV600E provides a constitutive MEK-dependent signal for BIMEL degradation

Transcription of BIM is repressed by the PI3K-dependent regulation of FOXO-3A (Dijkers et al., 2000; Gilley et al., 2003). However, the ERK1/2 pathway can also repress BIM mRNA levels in fibroblasts (Weston et al., 2003) and epithelial cells (Reginato et al., 2005). When HT29 cells were deprived of growth factors, we found that BIM mRNA expression increased after withdrawal of growth factors but this was not enhanced further by MEK inhibition (Supplementary Figure S5C). Together, these data indicate a relatively minor function for the ERK1/2 pathway in repressing BIM mRNA levels in HT29 cells.

BIMEL, the most abundant form of BIM in all four cell lines, undergoes proteasomal degradation after phosphorylation by ERK1/2 (Ley et al., 2003; Luciano et al., 2003; Ley et al., 2004; Marani et al., 2004); consequently, we examined the turnover of BIMEL in COLO205 and HT29 cells. Cells were serum starved in the presence of U0126 for 18 h to increase the level of BIM protein. Cells were then washed to remove U0126 and subjected to an emetine chase in SF media, with or without fresh U0126 (Figure 7a). In both cell lines, ERK1/2 was rapidly re-activated in fresh SF medium, resulting in the rapid phosphorylation and degradation of BIMEL; U0126 reversed all of these effects (Figure 7b). These results indicate that there is a strong, constitutive, MEK-dependent signal for degradation of BIMEL in CRC cells harbouring BRAFV600E.

Figure 7.

Figure 7

Open in a new tab

CRC cells with BRAFV600E exhibit a strong constitutive MEK-dependent degradation of BIMEL and dissociation from MCL-1. (a) Schematic representation of treatment regimen for BIMEL turnover. (b) COLO205 and HT29 cells were treated overnight with 20 μm U0126 in the absence of growth factors. The cells were pre-treated for 30 min with 10 μm emetine, washed and fresh growth factor-free medium containing emetine with or without U0126 was added for up to 7 h. Cells were harvested for western blotting as described in Materials and methods. Results are representative of three experiments in each case. (c) Schematic representation of treatment regimen for BIMEL dissociation from MCL-1. (d) COLO205 and HT29 cells were treated overnight with 20 μm U0126 in the absence of growth factors. The cells were washed thoroughly to remove U0126 and fresh serum-free media added for 10, 30 or 60min. Cells were harvested, MCL-1 immunoprecipitated and probed for association with BIMEL. Whole-cell lysates were also probed for MCL-1, BIM, P-ERK1/2 and ERK1. Results are representative of three experiments in each case. CRC, colorectal cancer; ERK1/2, extracellular signal-regulated kinase 1/2.

ERK1/2-dependent phosphorylation of BIMEL also inhibits its binding to pro-survival BCL-2 proteins such as MCL-1 (Ewings et al., 2007a; Ewings et al., 2007b). To investigate if BRAFV600E signalling could regulate BIMEL−MCL-1 complexes, COLO205 and HT29 cells were treated with SF + U0126 for 18 h to induce BIM expression and the formation of BIMEL−MCL-1 complexes; cells were then washed to remove U0126 and placed in fresh SF media (Figure 7c). Reactivation of ERK1/2 was complete within 30 min in COLO205 cells or 10 min in HT29 (Figure 7d). In both cases, as the ERK1/2 was reactivated, BIMEL became phosphorylated and the amount of BIMEL recovered in MCL-1 IPs was reduced. In both cell lines, this dissociation of BIMEL from MCL-1 preceded any decrease in total BIMEL. For example, loss of BIMEL from MCL-1 IPs occurred within 30 min in COLO205 cells at which point total BIMEL levels were unchanged; in HT29 cells, loss of BIMEL from MCL-1 IPs occurred within 10 min and again total BIMEL levels were unchanged (Figure 7d). Indeed, the dissociation of BIMEL from the MCL-1−BIMEL complex is not due to ERK-dependent ubiquitination or proteasomal degradation of BIM (Ewings et al., 2007a). Study of the BCL-XL−BIM complex showed a similar pattern of dissociation as seen with MCL-1 (data not shown). Thus, the constitutive activation of the ERK1/2 pathway by BRAFV600E in CRC cells promotes dissociation of BIMEL from its pro-survival target proteins and its proteasomal degradation.

Discussion

Growth factor-independent cell proliferation requires that cancer cells evade growth factor withdrawal-induced cell death; indeed, these are both hallmarks of cancer cells (Hanahan and Weinberg, 2000). Presumably, tumour cells must evolve mechanisms to repress or tolerate BIM. Several studies have shown that activation of ERK1/2 can block BIM expression and prevent cell death arising from growth factor withdrawal but these have usually involved ectopic overexpression of RAF or MEK mutants that are not found in human tumours, raising concerns about their physiological relevance. Here we have studied MEFs from knock-in transgenic mice that exhibit conditional expression of a single BrafV600E allele and CRC cells harbouring a single BRAFV600E allele; in both cases, these mutant oncoproteins are expressed from their endogenous promoters rather than being overexpressed.

The importance of the Lox-STOP-Lox system is best exemplified by studies of genetically engineered mice with K-rasG12D alleles (Frese and Tuveson, 2007). Although conditional overexpression of ectopic K-rasG12D promotes proliferation and tumour initiation in several tissues, these models do not always faithfully reproduce the development of human cancers with KRASG12D mutations due to supraphysiological RAS signalling. In contrast, the expression of endogenous K-rasG12D alleles by crossing K-ras+/LSL-G12D mice with appropriate cre transgenic mice provides exquisite temporal and spatial control over oncogene expression. In the case of the lung and pancreas, this leads to the development of benign adenomas and eventually adenocarcinomas with many of the histopathological and molecular characteristics of human non-small-cell lung carcinoma and pancreatic ductal adenocarcinoma, respectively (Jackson et al., 2001; Hingorani et al., 2003; Tuveson et al., 2004). These studies highlight the advantage of expressing oncogenes from endogenous alleles and are helping to define the relative importance of various RAS effector pathways in tumour development. An important advance in our study was the use of primary MEFs derived from Braf+/LSL-V600E;CreER™ mice (Mercer et al., 2005). Treatment of these MEFs with 4-HT allowed full recombination of the Braf+/LSL-V600E allele, the first time this has been demonstrated with the CreER™ system for any floxed allele. Significantly, expression of a single BrafV600E allele and resultant activation of the endogenous ERK1/2 pathway protected against growth factor withdrawal and completely blocked the otherwise substantial increase in BIM expression. The fact that this was observed in primary MEFs indicates that this pathway alone is sufficient to repress BIM expression and cell death.

Prompted by these results, we also examined CRC cell lines harbouring a single BRAFV600E allele and exhibiting a strong constitutive activation of ERK1/2. We found that (i) these cells were growth factor independent for survival; (ii) inhibition of the ERK1/2 pathway promoted cell death and this was substantially dependent upon BIM and (iii) constitutive ERK1/2 signalling is responsible for repressing BIM expression and function. The ‘oncogene addiction’ hypothesis posits that tumours evolve an unusual dependence upon certain oncogenes and the signalling pathways they control to maintain the malignant phenotype; for example, CRC cells with mutations in KRAS are addicted to the mutant KRAS oncoprotein (Shirasawa et al., 1993). We found that CRC cells with BRAFV600E were growth factor independent for cell survival and this could be overcome by any of the three distinct MEK inhibitors (U0126, PD184352 or AZD6244). Indeed, in some cases, MEK inhibition alone could induce cell death in the presence of FBS, indicating the degree to which these cells have evolved an extreme dependency upon the ERK1/2 pathway for survival. This is all the more remarkable as some of these CRC cell lines also harbour PIK3CA mutations (HT29) and/or exhibit strong basal PKB activation (CO115 cells) (Supplementary Figure S3B), a pathway that promotes cell survival. This underlines the extent to which these cells are addicted to the ERK1/2 pathway for growth factor-independent survival and suggests that inhibition of ERK1/2 signalling may be particularly effective in killing BRAFV600E-positive CRC cells. Similar conclusions have been drawn in BRAFV600E-positive melanoma (Karasarides et al., 2004).

There is a prominent function for increased BIM expression in death arising from growth factor withdrawal in MEFs (Ewings et al., 2007a). We found that the expression of endogenous BrafV600E was sufficient to block BIM expression in Braf+/LSL-V600E;CreER™ MEFs (Figure 3a). Similarly, all the four BRAFV600E-positive CRC cell lines failed to increase BIM expression unless serum starvation was combined with MEK inhibition; indeed, in some cases, the administration of U0126 or AZD6244 to cells in complete medium was sufficient to increase BIM expression, indicating that these cells are addicted to the ERK1/2 pathway for repression of BIM, even when they are exposed to growth factor-rich FBS, which activates the PI3K-PKB pathway, possess PIK3CA mutations or exhibit strong basal PKB activity, such as CO115 cells (Supplementary Figure S3B).

BIM was specifically implicated in death arising from MEK inhibition by the use of a BIM-specific short hairpin RNA and two different BIM-specific siRNAs, which reduced cell death by at least 60%. However, whereas BIM is involved in death arising from MEK inhibition in these CRC cells, it may not be the only regulator. For example, inhibition of MEK in the presence of FBS caused de-phosphorylation of BIMEL and some increase in BIM expression but only a modest increase in cell death. This may indicate that there is a crucial threshold level of BIM required for cell death that is only achieved upon serum withdrawal and MEK inhibition or that other important regulators are also induced by serum withdrawal and MEK inhibition. In addition, even when the siRNA-mediated knockdown of BIM was complete (Figure 6b), this did not completely prevent cell death (Figure 6c), again suggesting that other regulators are operating in parallel; likely candidates might include BAD, which is regulated by both the ERK1/2-RSK and PKB pathways (Datta et al., 1997; Eisenmann et al., 2003; Boisvert-Adamo and Aplin, 2008).

We observed little evidence of regulation of BIM mRNA levels by the ERK1/2 pathway in either MEFs or CRC cells. Furthermore, in both cell systems, BIMEL was by far the most abundant isoform and was certainly the major isoform that was dynamically regulated by MEK inhibition. Among the canonical splice forms, BIMEL is unique in being subject to extensive multisite phosphorylation by ERK1/2, which targets it for polyubiquitination and proteasomal degradation. Indeed, the downregulation of BIMEL in MEFs was reversed by MG132 (Figure 3c), and both COLO205 and HT29 cells exhibited a strong constitutive MEK-dependent signal for BIMEL degradation (Figure 7b). Although growth factor independent for ERK1/2 activity, the CRC cells remained growth factor dependent for PKB activation (Figure 5a), so inactivation of the PI3K-PKB pathway upon serum withdrawal may contribute to increases in BIM mRNA levels, perhaps by the activation of FOXO3A (Dijkers et al., 2000; Gilley et al., 2003). However, the fact that serum withdrawal alone caused little or no increase in BIM protein expression in 4-HT-treated MEFs or CRC cells suggests that any mature BIMEL that is expressed following serum withdrawal is rapidly phosphorylated by ERK1/2 and thereby degraded. Thus, ERK1/2-dependent turnover of BIMEL appears to be the dominant signal responsible for restraining BIM expression in both MEFs and CRC cells with BRAFV600E.

BAX and BAK are thought to be kept in check by the pro-survival BCL-2 proteins until liberated by binding of the BH3-only proteins to the pro-survival proteins (Chen et al., 2005; Willis et al., 2007). In addition to protein turnover, ERK1/2-dependent phosphorylation of BIMEL can prevent its binding to pro-survival BCL-2 proteins (Ewings et al., 2007a; Ewings et al., 2007b), whereas withdrawal of growth factors and/or inhibition of ERK1/2 promotes the association of BIMEL with MCL-1. Here we have demonstrated that this is also the case in CRC cells where washout of U0126 and reactivation of ERK1/2 resulted in the phosphorylation of BIMEL and its dissociation from MCL-1. Thus, the constitutive activation of ERK1/2 observed in COLO205 and HT29 cells drives dissociation of BIMEL from MCL-1 and subsequent BIMEL turnover.

The ability of BIM to promote apoptosis and its expression following withdrawal of growth factors suggest that BIM has some of the credentials of a tumour suppressor protein. Indeed, the loss of one Bim allele accelerates Myc-induced leukaemia in the mouse (Egle et al., 2004), and disruption of the BIM locus has been observed in various haematological malignancies, most notably in 17% of mantle cell lymphomas (Tagawa et al., 2005). In contrast, the disruption of the BIM gene seems to be rare in solid tumours and yet many tumour cell lines exhibit very low levels of BIM, suggesting that alternative mechanisms are employed to repress BIM. These may include epigenetic mechanisms in renal cell carcinoma (Zantl et al., 2007), but activation of signalling pathways downstream of oncogenes is emerging as one such mechanism. Mutant forms of EGFR can repress BIM expression in lung cancer, and this is overcome by EGFR inhibitors that are in clinical use (Costa et al., 2007; Cragg et al., 2007; Gong et al., 2007). Our demonstration that BIM is repressed in an ERK1/2-dependent manner in CRCs harbouring BRAFV600E suggests that increased expression of BIM may contribute to cell death in response to inhibitors of the BRAF–MEK–ERK1/2 pathway such as AZD6244. Finally, it is important to note that the inhibition of the ERK1/2 pathway appears to initiate parallel caspase-dependent and caspase-independent cell death pathways in COLO205 and LS411 cells. Future studies should seek to investigate the pathway of caspase-independent cell death in these cells as it may be important in the response of CRC cells to ERK1/2 pathway inhibitors.

Materials and methods

Cells and cell lines

Primary MEFs were prepared from E14.5 embryos as described earlier (Hüser et al., 2001). All studies were performed on MEFs following immediate isolation from the embryo. MEFs and the CRC cell lines, COLO205, HT29 and CO115, were maintained in Dulbecco’s Modified Eagle’s high-glucose Medium (DMEM, Invitrogen, Carlsbad, CA, USA). The LS411 cell line was maintained in RPMI (Invitrogen). Both media were supplemented with 10% FBS (Invitrogen), 20 mm l-glutamine (Invitrogen) and 100 U streptomycin (Invitrogen). All four CRC lines harbour the BRAFV600E mutation and have wild-type KRAS and mutant p53.

Antibodies

The following antibodies were used for western blotting: BCL-2 (Santa Cruz; 7382); BCL-XL (Cell Signalling Technology, Danvers, MA, USA; 2762); BIM (Chemicon, Temecula, CA, USA; AB17003); BIM (rat, for analysis of immunoprecipitates) (Calbiochem/Novabiochem, San Diego, CA, USA; AM53); MCL-1 (Santa Cruz, CA, USA; sc-819); phospho-Akt/PKB (Cell Signalling Technologies; 9271); Akt/PKB (Cell Signalling Technologies; 9272); phospho-ERK1/2 (Cell Signalling Technologies; 9106); and ERK1 (BD Biosciences, San Jose, CA, USA; 61003). The ERK2 antibody was a gift from Professor Chris Marshall (ICR, London).

Immunoprecipitation and western blot analysis

At the required times, cells were lysed in Triton-Glycerol (TG) lysis buffer and analysed by western blot as described earlier (Weston et al., 2003; Todd et al., 2004). For immunoprecipitation, cell extracts were normalized for equal protein loading and incubated at 4 °C with MCL-1 antibody (sc-819) bound to protein A sepharose beads (Sigma, St Louis, MO, USA).

Apoptosis assays

Cell extracts were assayed for DEVDase activity as described earlier (Weston et al., 2003). The proportion of cells with hypo-diploid (sub-G1) DNA was assessed by propidium iodide staining and flow cytometry (Weston et al., 2003; Todd et al., 2004). The annexin V assay was performed as described earlier (Hüser et al., 2001). Changes in mitochondrial membrane potential were examined by flow cytometric analysis of cells stained with tetramethylrhodamine ethyl ester (Molecular Probes, Eugene, OR, USA) (Scaduto and Grotyohann, 1999), a cell-permeable dye accumulating in mitochondria with unaltered membrane potential. Cells were harvested by trypsinization and 5 × 105 cells were incubated with 20 nm tetramethylrhodamine ethyl ester for 20 min at 37 °C followed by the analysis with FACScan (20 000 cells per sample). The fluorescence intensity of tetramethylrhodamine ethyl ester was monitored at 582 nm (FL-2).

Quantitative reverse transcription PCR

Total RNA was extracted from cells using TRI-Reagent (Sigma) and reverse transcription PCR was performed according to the protocol supplied with the TaqMan Reverse Transcription reagents (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase was determined to be the most stable housekeeping gene using the GeNorm protocol (Vandesompele et al., 2002) and the following primers were used (5′-TGCACCACCAACTGCTTAGC; 3′-GGCATGGACTGTGGTCATGAG). Primers for human BIM were 5′-ACCTTCTGATGTAAGTTCTGAGTGTGA and 3′-GGATTACCTGTGGCTCTGTCTG. The primers for mouse BIM were 5′-GTCCTCCAGTGGGTATTTCT and 3′-CAGATCTTCAGGTTCCTCCT. Quantitative PCR was performed using SYBR Green (Applied Biosystems, Foster City, CA, USA) in a Chromo-4 Thermal Cycler analysed with Opticon Software (BioRad, Hercules, CA, USA).

siRNA sequences and RNAi

For transient RNAi, the following oligos were used: human BIM1 GACCGAGAAGGTAGACAATT; human BIM2 GCAACCTTCTGATGTAAGT; mouse Bim1 GGAGGAACCTGAAGATCTG; the mouse Bim sequence has four mismatches when compared with the human BIM and served as a specificity control. HT29 cells were plated the day before transfection at 2 × 105 per well (six-well tray) in pen/strep-free medium. Briefly, 500 pmol of each human Bim siRNA was mixed with Optimem media (1000 pmol for control mouse siRNA), and an equivalent volume of Optimem was combined with Lipofectamine 2000 and incubated for 5 min. Both siRNA and Lipofectamine 2000 were combined, mixed well and incubated for 20 min. Following incubation, siRNA/Lipofectamine complexes were added dropwise to cell cultures. Transfection medium was aspirated after 24 h and individual drug treatments were initiated for a further 30 h incubation.

Statistical analysis

Results were analysed for statistical significance using analysis of variance with a Tukey’s post-test for parametric data and Kruskal-Wallis test for non-parametric data.

Supplementary Material

Fig. S1
Fig. S2
Fig. S3
Fig. S4
Fig. S5
Suppl text

Acknowledgements

We thank members of the SJC and CAP labs for discussions and Richard Marais for his advice and encouragement. We particularly thank the Division of Biomedical Services at Leicester for help with breeding and Susan Giblett for isolation of MEFs. We are grateful to the Trono lab for provision of lentiviral expression systems, Paul Smith (AstraZeneca) for provision of AZD6244 and discussions and Richard Hamelin for provision of CO115 cells. Work in the CAP lab was funded by a CRUK programme grant number C1362/A6969. Work in the SJC lab was supported by the Association for International Cancer Research (AICR), AstraZeneca, BBSRC (BB/E02162X/1) and the Babraham Institute.

References

  1. Boisvert-Adamo K, Aplin AE. Mutant B-RAF mediates resistance to anoikis via Bad and Bim. Oncogene. 2008;27:3301–3312. doi: 10.1038/sj.onc.1211003. [DOI] [PubMed] [Google Scholar]
  2. Bouillet P, Metcalf D, Huang DC, Tarlinton DM, Kay TW, Kontgen F, et al. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science. 1999;286:1735–1738. doi: 10.1126/science.286.5445.1735. [DOI] [PubMed] [Google Scholar]
  3. Chen L, Willis SN, Wei A, Smith BJ, Fletcher JI, Hinds MG, et al. Differential targeting of prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary apoptotic function. Mol Cell. 2005;17:393–403. doi: 10.1016/j.molcel.2004.12.030. [DOI] [PubMed] [Google Scholar]
  4. Cory S, Huang DC, Adams JM. The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene. 2003;22:8590–8607. doi: 10.1038/sj.onc.1207102. [DOI] [PubMed] [Google Scholar]
  5. Costa DB, Halmos B, Kumar A, Schumer ST, Huberman MS, Boggon TJ, et al. BIM mediates EGFR tyrosine kinase inhibitor-induced apoptosis in lung cancers with oncogenic EGFR mutations. PLoS Med. 2007;4:1669–1679. doi: 10.1371/journal.pmed.0040315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cragg MS, Kuroda J, Puthalakath H, Huang DC, Strasser A. Gefitinib-induced killing of NSCLC cell lines expressing mutant EGFR requires BIM and can be enhanced by BH3 mimetics. PLoS Med. 2007;4:1681–1689. doi: 10.1371/journal.pmed.0040316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, et al. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell. 1997;91:231–241. doi: 10.1016/s0092-8674(00)80405-5. [DOI] [PubMed] [Google Scholar]
  8. Davies BR, Logie A, McKay JS, Martin P, Steele S, Jenkins R, et al. AZD6244 (ARRY-142886), a potent inhibitor of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1/2 kinases: mechanism of action in vivo, pharmacokinetic/pharmacodynamic relationship, and potential for combination in preclinical models. Mol Cancer Ther. 2007;6:2209–2219. doi: 10.1158/1535-7163.MCT-07-0231. [DOI] [PubMed] [Google Scholar]
  9. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417:949–954. doi: 10.1038/nature00766. [DOI] [PubMed] [Google Scholar]
  10. Dijkers PF, Medema RH, Lammers JW, Koenderman L, Coffer PJ. Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr Biol. 2000;10:1201–1204. doi: 10.1016/s0960-9822(00)00728-4. [DOI] [PubMed] [Google Scholar]
  11. Egle A, Harris AW, Bouillet P, Cory S. Bim is a suppressor of Myc-induced mouse B cell leukemia. Proc Natl Acad Sci USA. 2004;101:6164–6169. doi: 10.1073/pnas.0401471101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Eisenmann KM, VanBrocklin MW, Staffend NA, Kitchen SM, Koo HM. Mitogen-activated protein kinase pathway-dependent tumor-specific survival signaling in melanoma cells through inactivation of the proapoptotic protein bad. Cancer Res. 2003;63:8330–8337. [PubMed] [Google Scholar]
  13. Ewings KE, Hadfield-Moorhouse K, Wiggins CM, Wickenden JA, Balmanno K, Gilley R, et al. ERK1/2-dependent phosphorylation of BimEL promotes its rapid dissociation from Mcl-1 and Bcl-xL. EMBO J. 2007a;26:2856–2867. doi: 10.1038/sj.emboj.7601723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ewings KE, Wiggins CM, Cook SJ. Bim and the pro-survival Bcl-2 proteins: opposites attract, ERK repels. Cell Cycle. 2007b;6:2236–2240. doi: 10.4161/cc.6.18.4728. [DOI] [PubMed] [Google Scholar]
  15. Frese KK, Tuveson DA. Maximising mouse cancer models. Nat Rev Cancer. 2007;7:645–658. doi: 10.1038/nrc2192. [DOI] [PubMed] [Google Scholar]
  16. Gilley J, Coffer PJ, Ham J. FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. J Cell Biol. 2003;162:613–622. doi: 10.1083/jcb.200303026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gong Y, Somwar R, Politi K, Balak M, Chmielecki J, Jiang X, et al. Induction of BIM Is essential for apoptosis triggered by EGFR kinase inhibitors in mutant EGFR-dependent lung adenocarcinomas. PLoS Med. 2007;4:e294. doi: 10.1371/journal.pmed.0040294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57–70. doi: 10.1016/s0092-8674(00)81683-9. [DOI] [PubMed] [Google Scholar]
  19. Hayashi S, McMahon AP. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol. 2002;244:305–318. doi: 10.1006/dbio.2002.0597. [DOI] [PubMed] [Google Scholar]
  20. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell. 2003;4:437–450. doi: 10.1016/s1535-6108(03)00309-x. [DOI] [PubMed] [Google Scholar]
  21. Hüser M, Luckett J, Chiloeches A, Mercer K, Iwobi M, Giblett S, et al. MEK kinase activity is not necessary for Raf-1 function. EMBO J. 2001;20:1940–1951. doi: 10.1093/emboj/20.8.1940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jackson EL, Willis N, Mercer K, Bronson RT, Crowley D, Montoya R, et al. Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev. 2001;15:3243–3248. doi: 10.1101/gad.943001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Karasarides M, Chiloeches A, Hayward R, Niculescu-Duvaz D, Scanlon I, Friedlos F, et al. B-RAF is a therapeutic target in melanoma. Oncogene. 2004;23:6292–6298. doi: 10.1038/sj.onc.1207785. [DOI] [PubMed] [Google Scholar]
  24. Ley R, Balmanno K, Hadfield K, Weston C, Cook SJ. Activation of the ERK1/2 signaling pathway promotes phosphorylation and proteasome-dependent degradation of the BH3-only protein, Bim. J Biol Chem. 2003;278:18811–18816. doi: 10.1074/jbc.M301010200. [DOI] [PubMed] [Google Scholar]
  25. Ley R, Ewings KE, Hadfield K, Cook SJ. Regulatory phosphorylation of Bim: sorting out the ERK from the JNK. Cell Death Differ. 2005;12:1008–1014. doi: 10.1038/sj.cdd.4401688. [DOI] [PubMed] [Google Scholar]
  26. Ley R, Ewings KE, Hadfield K, Howes E, Balmanno K, Cook SJ. Extracellular signal-regulated kinases 1/2 are serum-stimulated ‘BimEL kinases’ that bind to the BH3-only protein BimEL causing its phosphorylation and turnover. J Biol Chem. 2004;279:8837–8847. doi: 10.1074/jbc.M311578200. [DOI] [PubMed] [Google Scholar]
  27. Luciano F, Jacquel A, Colosetti P, Herrant M, Cagnol S, Pages G, et al. Phosphorylation of Bim-EL by Erk1/2 on serine 69 promotes its degradation via the proteasome pathway and regulates its proapoptotic function. Oncogene. 2003;22:6785–6793. doi: 10.1038/sj.onc.1206792. [DOI] [PubMed] [Google Scholar]
  28. Marani M, Hancock D, Lopes R, Tenev T, Downward J, Lemoine NR. Role of Bim in the survival pathway induced by Raf in epithelial cells. Oncogene. 2004;23:2431–2441. doi: 10.1038/sj.onc.1207364. [DOI] [PubMed] [Google Scholar]
  29. Mercer K, Giblett S, Green S, Lloyd D, DaRocha Dias S, Plumb M, et al. Expression of endogenous oncogenic V600EB-raf induces proliferation and developmental defects in mice and transformation of primary fibroblasts. Cancer Res. 2005;65:11493–11500. doi: 10.1158/0008-5472.CAN-05-2211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mercer KE, Pritchard CA. Raf proteins and cancer: B-Raf is identified as a mutational target. Biochim Biophys Acta. 2003;1653:25–40. doi: 10.1016/s0304-419x(03)00016-7. [DOI] [PubMed] [Google Scholar]
  31. Rajagopalan H, Bardelli A, Lengauer C, Kinzler KW, Vogelstein B, Velculescu VE. Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature. 2002;418:934. doi: 10.1038/418934a. [DOI] [PubMed] [Google Scholar]
  32. Reginato MJ, Mills KR, Becker EB, Lynch DK, Bonni A, Muthuswamy SK, et al. Bim regulation of lumen formation in cultured mammary epithelial acini is targeted by oncogenes. Mol Cell Biol. 2005;25:4591–4601. doi: 10.1128/MCB.25.11.4591-4601.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Scaduto RC, Jr, Grotyohann LW. Measurement of mitochondrial membrane potential using fluorescent rhodamine derivatives. Biophys J. 1999;76:469–477. doi: 10.1016/S0006-3495(99)77214-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shirasawa S, Furuse M, Yokoyama N, Sasazuki T. Altered growth of human colon cancer cell lines disrupted at activated Ki-ras. Science. 1993;260:85–88. doi: 10.1126/science.8465203. [DOI] [PubMed] [Google Scholar]
  35. Tagawa H, Karnan S, Suzuki R, Matsuo K, Zhang X, Ota A, et al. Genome-wide array-based CGH for mantle cell lymphoma: identification of homozygous deletions of the proapoptotic gene BIM. Oncogene. 2005;24:1348–1358. doi: 10.1038/sj.onc.1208300. [DOI] [PubMed] [Google Scholar]
  36. Todd DE, Densham RM, Molton SA, Balmanno K, Newson C, Weston CR, et al. ERK1/2 and p38 cooperate to induce a p21CIP1-dependent G1 cell cycle arrest. Oncogene. 2004;23:3284–3295. doi: 10.1038/sj.onc.1207467. [DOI] [PubMed] [Google Scholar]
  37. Tuveson DA, Shaw AT, Willis NA, Silver DP, Jackson EL, Chang S, et al. Endogenous oncogenic K-ras(G12D) stimulates proliferation and widespread neoplastic and developmental defects. Cancer Cell. 2004;5:375–387. doi: 10.1016/s1535-6108(04)00085-6. [DOI] [PubMed] [Google Scholar]
  38. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3 doi: 10.1186/gb-2002-3-7-research0034. RESEARCH0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Wallace EM, Lyssikatos J, Blake JF, Seo J, Yang HW, Yeh TC, et al. Potent and selective mitogen-activated protein kinase kinase (MEK) 1,2 inhibitors. 1.4-(4-bromo-2-fluorophenylamino)-1-methylpyridin-2(1H)-ones. J Med Chem. 2006;49:441–444. doi: 10.1021/jm050834y. [DOI] [PubMed] [Google Scholar]
  40. Weinstein IB. Cancer. Addiction to oncogenes—the Achilles heal of cancer. Science. 2002;297:63–64. doi: 10.1126/science.1073096. [DOI] [PubMed] [Google Scholar]
  41. Weston CR, Balmanno K, Chalmers C, Hadfield K, Molton SA, Ley R, et al. Activation of ERK1/2 by ΔRaf-1:ER* represses Bim expression independently of the JNK or PI3K pathways. Oncogene. 2003;22:1281–1293. doi: 10.1038/sj.onc.1206261. [DOI] [PubMed] [Google Scholar]
  42. Willis SN, Fletcher JI, Kaufmann T, van Delft MF, Chen L, Czabotar PE, et al. Apoptosis initiated when BH3 ligands engage multiple Bcl-2 homologs, not Bax or Bak. Science. 2007;315:856–859. doi: 10.1126/science.1133289. [DOI] [PubMed] [Google Scholar]
  43. Wiznerowicz M, Trono D. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol. 2003;77:8957–8961. doi: 10.1128/JVI.77.16.8957-8961.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yuen ST, Davies H, Chan TL, Ho JW, Bignell GR, Cox C, et al. Similarity of the phenotypic patterns associated with BRAF and KRAS mutations in colorectal neoplasia. Cancer Res. 2002;62:6451–6455. [PubMed] [Google Scholar]
  45. Zantl N, Weirich G, Zall H, Seiffert BM, Fischer SF, Kirschnek S, et al. Frequent loss of expression of the pro-apoptotic protein Bim in renal cell carcinoma: evidence for contribution to apoptosis resistance. Oncogene. 2007;26:7038–7048. doi: 10.1038/sj.onc.1210510. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1
NIHMS3761-supplement-Fig__S1.pdf (860.8KB, pdf)
Fig. S2
NIHMS3761-supplement-Fig__S2.pdf (200.8KB, pdf)
Fig. S3
NIHMS3761-supplement-Fig__S3.pdf (645.6KB, pdf)
Fig. S4
NIHMS3761-supplement-Fig__S4.pdf (181.5KB, pdf)
Fig. S5
NIHMS3761-supplement-Fig__S5.pdf (315.6KB, pdf)
Suppl text
NIHMS3761-supplement-Suppl_text.doc (47.5KB, doc)

RESOURCES