Abstract
The establishment of prostatic budding patterns occurs early in prostate development but mechanisms responsible for this event are poorly understood. We investigated the role of WNT5A in patterning prostatic buds as they emerge from the fetal mouse urogenital sinus (UGS). Wnt5a mRNA was expressed in UGS mesenchyme during budding and was focally up-regulated as buds emerged from the anterior, dorsolateral, and ventral UGS regions. We observed abnormal UGS morphology and prostatic bud patterns in Wnt5a null male fetuses, demonstrated that prostatic bud number was decreased by recombinant mouse WNT5A protein during wild type UGS morphogenesis in vitro, and showed that ventral prostate development was selectively impaired when these WNT5A-treated UGSs were grafted under under kidney capsules of immunodeficient mice and grown for 28 d. Moreover, a WNT5A inhibitory antibody, added to UGS organ culture media, rescued prostatic budding from inhibition by a ventral prostatic bud inhibitor, 2,3,8,7-tetrachlorodibenzo-p-dioxin, and restored ventral prostate morphogenesis when these tissues were grafted under immunodeficient mouse kidney capsules and grown for 28 d. These results suggest that WNT5A participates in prostatic bud patterning by restricting mouse ventral prostate development.
Keywords: WNT5A, TCDD, urogenital sinus, ventral prostate development, prostatic bud formation, mouse
INTRODUCTION
The mature mouse prostate is comprised of four bilaterally symmetric lobes: anterior, dorsal, lateral and ventral. Each prostate lobe features unique ductal morphology and gene expression profiles, yet they all arise from a common primordium, the urogenital sinus (UGS). Specification of prostate lobar identity begins during embryogenesis and is mediated by androgen-dependent interactions between UGS mesenchyme (UGM), and UGS epithelium, UGE (Cunha et al., 1987). These interactions promote outgrowth of ductal precursors, or buds, that derive from UGE in a distinct spatial pattern and temporal sequence (Lin et al., 2001). Buds on the anterior UGE surface emerge first, as early as embryonic day (E) 16.5, and give rise to anterior prostate ducts. Dorsal prostate buds also emerge on E16.5 and lateral and ventral buds are the last to appear on approximately E17.5.
Budding is a recurrent theme in limb, lung, tooth, and feather development (Hogan, 1999). While morphogenetic signals often overlap in these tissues, prostate induction is distinguished by its androgen-dependence. Androgen receptors (ARs) in UGM are necessary for bud initiation and UGM is also largely responsible for specifying bud patterns (Cunha and Chung, 1981; Cunha and Lung, 1978; Goldstein and Wilson, 1975).
The most fundamental aspect of the prostatic budding mechanism, how activation of ARs by fetal testosterone participates in bud initiation and patterning, remains unknown. This issue is being addressed by complementary approaches. The first, a chemical genetics approach, uses chemical inhibitors of prostatic budding that act in a region-selective fashion. This approach has revealed some molecular signals involved in prostatic bud patterning. Estrogen receptors were implicated in dorsolateral prostatic budding when it was discovered that estrogen receptor agonists, diethylstilbesterol and bisphenol A, inhibited dorsolateral bud formation (Timms et al., 2005). The nuclear orphan receptor, aryl hydrocarbon receptor (AHR), was implicated in ventral prostatic budding after it was discovered that ventral buds were selectively impaired by the AHR agonist, 2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD (Lin et al., 2003).
The use of transgenic mice and in vitro models of prostate growth have also elucidated signaling factors participating in prostate induction and patterning. ARs are required for prostate budding in all UGS zones (Lasnitzki and Mizuno, 1980); fibroblast growth factor 10 (Fgf10) is required for the formation of most buds (Donjacour et al., 2003); Noggin is required for ventral and anterior prostatic buds (Cook et al., 2007); Sry box 9 (Sox9) is required for ventral buds and likely also for other buds (Thomsen et al., 2008), homeobox (Hox) a13 and d13 are involved in budding in all zones (Podlasek et al., 1999b) but are especially important for anterior prostatic budding (Warot et al., 1997). Also involved in prostatic budding are sonic hedgehog (SHH) and retinoic acid, which are prostatic bud agonists and bone morphogenetic proteins (BMPs) 4 and 7, which are prostatic bud antagonists (Doles et al., 2006; Grishina et al., 2005; Lamm et al., 2002; Podlasek et al., 1999a; Vezina et al., 2008a). It is unclear at this time how AR, FGF, SHH, BMP, and HOX signals are orchestrated to initiate buds and establish prostatic bud patterns. None of these signals can account completely for the generation of prostatic bud patterns, suggesting that additional factors or coordinated interactions of multiple signals are involved.
Genes of the wingless-related MMTV integration site (Wnt) superfamily have been associated with bud initiation and patterning in multiple tissues (Gat et al., 1998; Liu et al., 2008; Liu et al., 2007; Lu et al., 2004; Noramly et al., 1999; Teuliere et al., 2005; Widelitz et al., 2000). WNTs are embedded in a molecular signaling pathway that interfaces with FGF, SHH, BMP, and HOX signaling. Further, Wnts are also expressed in the UGS during prostatic budding (Joesting et al., 2008; Zhang et al., 2006), but their role in prostatic bud initiation had not been investigated.
Secreted Wnts bind to receptors on target tissues and initiate signaling through two principle mechanisms: a canonical signaling pathway involving stabilization of β-catenin, and a less understood non-canonical, β-catenin-independent signaling pathway. Wnt5a, the most abundantly expressed Wnt gene in the UGS (Zhang et al., 2006), signals through the non-canonical pathway and its deletion has been shown to impede budding in other developing mouse tissues (Yamaguchi et al., 1999).
In the present study, we sought to determine whether Wnt5a is involved in prostatic bud initiation and patterning in the male fetal mouse UGS. We characterized Wnt5a mRNA expression in the UGS, assessed development of the UGS and related structures in the Wnt5a null fetus, and evaluated the effects of exogenous WNT5A protein and WNT5A inhibitory antibody on prostatic bud formation and patterning in UGS organ culture. The significance of our findings is that they reveal for the first time that WNT5A signaling participates in prostatic bud patterning by restricting ventral prostatic bud formation during prostate morphogenesis.
MATERIALS AND METHODS
Animals
Wnt5a null mice, backcrossed onto a C57BL/6 background (Yamaguchi et al., 1999), were obtained from Terry Yamaguchi (NCI, Frederick, MD). Offspring were genotyped as previously described (Benedict et al., 2000) using the following primers to identify heterozygous breeders: mouse WNT5A primer 5’ – TTCCAAGTTCTTCCTAATGGC – 3’ and E. coli neomycin resistance cassette primer 5’ - TTGGGTGGAGAGGCTATTCG – 3’. C57BL/6J wild-type mice were from the Jackson Laboratory (Bar Harbor, ME). Animals were housed with a 12 h light-dark cycle (lighted 0600 to 1800 h) at room temperature (22 ± 1°C) in clear plastic microisolator cages with corn-cob bedding. Feed (5015 Mouse Diet, PMI Nutrition International, Brentwood, MO) and water were available ad libitum.
Timed-pregnant females were generated by housing males and females together overnight. The day after overnight mating was designated E0.5. Pregnant dams were treated as described below, then euthanized by CO2 overdose prior to removal of fetuses. UGS samples in each experimental block were taken from separate litters to minimize litter-dependent observations. Some pregnant dams were exposed to the ventral prostatic budding inhibitor TCDD (5 µg/kg, po). Dosing occurred on either E13.5 or E15.5, either of which has been shown previously to inhibit ventral bud formation (Vezina et al., 2008b). All procedures were approved by the University of Wisconsin Institutional Animal Care and Use Committee.
Vibratome sectioning and sectional in situ hybridization
UGSs were fixed overnight in 4% paraformaldehyde, dehydrated in methanol, rehydrated in phosphate-buffered saline containing 0.1% Tween-20 (PBT), embedded in 4% SeaPlaque agarose in PBT (Biowhittaker Molecular Applications, Rockland, ME), and cut into 80 µm sections using a double-edged razor mounted on a vibratome emersed in PBT. In situ hybridization was performed on UGS sections as described by Vezina et al. (2008b). The Wnt5a riboprobe was a gift from Dr. Terry Yamaguchi (NCI, Frederick, MD).
Scanning electron microscopy and bud counting
UGS samples were prepared for scanning electron microscopy (SEM) as previously described (Lin et al., 2003). For experiments involving bud counting, at least four views of each UGS were obtained such that all surfaces of the UGS could be viewed. Two reviewers independently counted the total number of buds for each UGS and these counts were averaged to give the best estimate of actual bud number for each. At least five UGSs were examined in this manner for each treatment group.
Testicular testosterone content
Testicular testosterone content was measured with the Correlate-EIA Testosterone Enzyme Immunoassay Kit (Assay Designs, Inc., Ann Arbor, MI). Steroids were extracted from E18.5 fetal testes with ethyl acetate, extracts were dried and reconstituted in manufacturer supplied buffer, and testicular content was measured according to the manufacturer’s instructions. Results are presented as the mean ± SEM for 7 litter-independent males of each genotype.
UGS organ culture
E14.5 UGSs were collected and cultured as described previously (Vezina et al., 2008a). Cultured UGSs were exposed to 10 nM 5α-dihydrotestosterone (DHT, Sigma) and either dimethyl sulfoxide (DMSO, 0.1% v/v) or 1 nM TCDD dissolved in 0.1% DMSO. Some cultures were also exposed to graded concentrations of recombinant mouse WNT5A protein (rmWNT5A [80% purity], 0.5, 1, or 2 µg/ml; R&D Systems, Minneapolis, MN), goat anti-mouse WNT5A inhibitory antibody (anti-WNT5A-IgG, 4 or 8 µg/ml; R&D Systems), or rmWNT5A (2 µg/ml) + anti-WNT5A-IgG (8 µg/ml). Anti-WNT5A-IgG was certified to exhibit less than 2% cross-reactivity with WNT4 and WNT10b by the manufacturer. Media and treatments were replaced every 48 h.
Renal grafting
E14.5 UGSs cultured for 3 d as described above, or E18.5 UGSs removed from WT male and Wnt5a null male fetuses were grafted under the renal capsules of adult male nu/nu immunodeficient mice (Harlan, Indianapolis, IN). Mice received oral antibiotics (Sulfatrim Suspension, Alpharma, Fort Lee, NJ) for one week following surgery. Grafts were removed after 28 d and either fixed with formalin, dehydrated in ethanol, and embedded in paraffin for histology or frozen in liquid nitrogen and stored at −80°C for RT-PCR.
Calcium imaging
To assess rmWNT5A and anti-WNT5A-IgG activity, mouse embryonic fibrobla1sts (MEFs) were obtained from American Tissue Type Culture Collection (Manassas, VA). MEFs were seeded on 35 mm tissue culture dishes 24 hr prior to measurement of intracellular free calcium. MEFs were cultured in Dulbecco’s Minimal Essential Medium supplemented with 10% heat-inactivated fetal bovine serum, and were maintained at 37°C in a 95% air/5% CO2 and 100% humidity incubator. MEFs were incubated for 1 hr with 10 µM Calcium Green-1 AM (Molecular Probes, OR), washed with culture medium to remove unincorporated dye, and then maintained in 2 ml culture media for confocal fluorescent microscopy as described previously (Verbny et al., 2002). A 500X stock solution of rmWNT5A and anti-WNT5A-IgG were prepared in Hank’s balanced Salt Solution (HBSS) and diluted into MEF culture media.
Real-time reverse-transcription PCR
Real-time reverse transcription polymerase chain reaction was performed as previously described (Lin et al., 2002). Primer sequences, annealing temperatures, and product sizes are provided in Supplemental Table 1.
Statistical Analyses
Statistical analyses were performed using Statistica Software (StatSoft, Inc., Tulsa, OK). Levene’s test was used to determine homogeneity of variances between or among groups with equal n values and the Brown-Forsythe test was used for groups with unequal n values. Student’s t-test was used to identify differences between groups and one-way Analysis of Variance (ANOVA) to detect differences among groups. Fisher’s Least Significant Test was used for multiple comparisons. A difference of p < 0.05 was considered significant. Variances in mean bud number were not equal for all treatment groups (Levene’s test p < 0.05), so differences in bud number between groups were assessed using the nonparametric Mann-Whitney U test.
RESULTS
Wnt5a is expressed in UGS mesenchyme during prostatic bud formation
Wnt5a is the most abundant Wnt transcript in the male mouse UGS during prostatic budding (Zhang et al., 2006) but its spatial distribution in the UGS has not been previously reported. We used ISH to investigate Wnt5a mRNA expression at 24 hr intervals prior to and during prostatic budding (E15.5–17.5). Prior to bud initiation (E15.5), Wnt5a was detected in a diffuse band of UGM circumscribing each of the UGE zones from which prostatic buds emerge (Fig. 1). For each embryonic day examined, Wnt5a was most abundant in UGS zones where buds were forming and least abundant in non-budding regions of the UGS. Wnt5a was most abundant in the anterior budding zone immediately after anterior bud formation (E16.5), was moderately expressed in the dorsolateral prostatic budding zone during dorsolateral bud initiation, and was weakly expressed where buds had not yet emerged in the ventral budding zone at E16.5. Wnt5a staining on E17.5 appeared to be expressed at a much lower level in the ventral UGS region during ventral budding compared to that observed during budding from anterior and dorsolateral UGS regions. Wnt5a was also observed in UGM juxtaposed to elongating anterior and dorsal prostatic buds at E17.5, where expression was most robust at the base of buds and dissipated towards bud tips.
Figure 1. Wnt5a transcripts are expressed in male mouse UGS mesenchyme (UGM) during prostatic bud formation and are increased focally where buds emerge from each UGS zone.
Wnt5a mRNA distribution was determined by in-situ hybridization (ISH) of mid-sagittal male UGS tissue sections at E15.5, 16.5, and 17.5. Results are representative of three UGSs from each day. Colored dashed lines demarcate the UGE-UGM interface in the anterior (red), dorsolateral (green), and ventral (yellow) prostatic budding zones, respectively. Wnt5a-positive staining is dark blue.
Wnt5a-null mice exhibit multiple urogenital abnormalities
The presence of Wnt5a transcripts in areas where anterior and dorsolateral prostatic buds were forming suggested it may be required for budding. To test this hypothesis, prostatic budding was assessed in wild-type (WT) and Wnt5a null mice at E18.5. Multiple urogenital abnormalities were associated with the Wnt5a null phenotype, including UGS agenesis in some fetuses. The incidence of specific defects is reported in Table 1. The UGS and bladder were absent and the hindgut ended blindly in approximately 30% of Wnt5a null male fetuses (results not shown). In the 70% of Wnt5a null male fetuses where the UGS was present, it was morphologically deformed, devoid of a pelvic urethra, and attached by a fistulous connection to the hindgut (Fig. 1, arrowheads).
Table 1.
Incidence of Urogenital Defects in E18.5 Wnt5a Null Male Fetuses
| Type of Defect † |
Wnt5a Null Fetuses # affected / # observed |
|---|---|
| Undescended Testes | 14 / 14 |
| Bladder Agenesis | 4 / 14 |
| UGS Agenesis | 4 / 14 |
| Pelvic Urethra Agenesis | 9 / 14 |
| Hindgut-UGS Fistula* | 10 / 10 |
None of these defects were observed in wild type littermates (n > 14).
Results reported only for Wnt5a null fetuses in which the UGS had formed.
Three techniques were utilized to assess morphology in the most fully-developed UGSs from Wnt5a null males. First, intact UGSs of representative WT and E18.5 Wnt5a null male fetuses were photographed (Fig. 2A and C); second, a mid-sagittal UGS section from each genotype was examined histologically (Fig. 2B and D); and third, after the UGS was treated with trypsin and UGM was removed with fine forceps, the underlying UGE surface was examined by SEM and color coded to reveal anterior (red), dorsolateral (green) and ventral (yellow) prostatic buds (Fig. 3). The bladder neck and the prostatic urethra containing the anterior and ventral prostatic budding zones were truncated and widened in many Wnt5a null UGSs (Fig. 3). Wnt5a null UGSs exhibited prostatic bud patterning defects associated with this UGS deformity. Anterior buds were absent from all male Wnt5a null UGSs, ventral buds were rarely observed and dorsolateral bud number varied substantially between fetuses, but was always less than WT (Fig. 3).
Figure 2. E18.5 Wnt5a null male fetuses exhibit aberrant hindgut and urogenital morphology.
Images of whole UGSs and hematoxylin and eosin stained sagittal UGS sections are shown for representative wild-type and Wnt5a null male mouse fetuses. Results are representative of ten fetuses from each genotype. Distal UGS boundaries are indicated by dashed white lines. The E18.5 Wnt5a null UGSs shown in panels C and D feature a fistulous hindgut (HG)-UGS connection (arrowhead) and agenic pelvic urethra (PU), compared to the normal anatomy of wild-type UGSs in panels A and B. The other structure shown is bladder (BL).
Figure 3. E18.5 Wnt5a null male fetuses exhibit an aberrant prostatic bud pattern.
UGS mesenchyme was removed from wild type and Wnt5a null UGSs and the underlying UGS epithelium (UGE) was visualized by scanning electron microscopy. Results are representative of three UGSs per genotype. The Wnt5a null UGE shown above exhibits a shortened and distended bladder neck (BN), is devoid of anterior (red) and ventral (yellow) prostatic buds, and exhibits fewer dorsolateral buds (green). Also evident is a fistulous connection (arrowhead) between UGS and hindgut (HG). HG is distinguished from seminal vesicle (SV) by its numerous epithelial protrusions. The other structure shown is the pelvic urethra (PU).
Abnormal testicular development in Wnt5a null fetuses could impair prostatic budding by reducing circulating fetal testosterone. All fourteen Wnt5a null male fetuses examined exhibited defects in testicular descent. We therefore compared testicular testosterone content in WT and Wnt5a null fetuses to investigate testicular function in Wnt5a null fetuses. Loss of Wnt5a was associated with a significant reduction in fetal testicular testosterone (219 ± 29 pg testosterone/testis in Wnt5a null fetuses vs. 732 ± 116 pg testosterone/testis in WT fetuses, p ≤ 0.05).
WNT5A is not required for bud formation and exogenous WNT5A inhibits ventral budding
The Wnt5a null phenotype revealed a role for Wnt5a in the early phase of UGS morphogenesis and in UGS-hindgut separation. However, it was not possible to determine whether WNT5A was also required for prostatic budding or if prostatic budding defects in Wnt5a null fetuses occurred secondary to pre-existing UGS deformities and decreased testicular testosterone.
To determine if WNT5A signaling is directly required for prostatic bud formation, we assessed prostatic budding in a well-established, in vitro serum-free UGS organ culture model, where bladder neck and prostatic urethra morphology were normal at the start of the culture period and androgen concentration in the culture medium was sustained in the physiological range. Prostatic buds did not form in the absence of androgens (results not shown) and all subsequent experiments were conducted with culture media containing 10 nM 5α-dihydrotestosterone (DHT, an AR agonist). WNT5A signaling in WT UGSs was then repressed by adding a WNT5A inhibitory antibody (anti-WNT5A-IgG) to the culture medium or was activated by adding recombinant mouse WNT5A (rmWNT5A) protein. These reagents were used previously to repress or activate WNT5A signaling in other systems (Castelo-Branco et al., 2006; Cheng et al., 2008; Dejmek et al., 2006; Murdoch et al., 2003; Roarty and Serra, 2007; Schulte et al., 2005). Their activities were confirmed in this study by measuring intracellular calcium mobilization (Supplemental Figure 1) as a WNT5A-responsive endpoint (Ma and Wang, 2006; Schleiffarth et al., 2007).
We next incubated WT UGSs in organ culture media containing 10 nM DHT and vehicle or anti-WNT5A-IgG (4 and 8 µg/ml) to determine if WNT5A signaling was necessary for prostatic bud formation. Prostatic budding was assessed by removing UGM, imaging underlying UGE from multiple angles by SEM, and enumerating the total number of prostatic buds per UGS. Exposure to anti-WNT5A-IgG did not change the number of prostatic buds formed in culture (results not shown). This finding supports the hypothesis that WNT5A signaling is not required for prostatic bud formation.
Functional redundancy has been observed for some mediators of prostatic budding. For example, prostatic budding requires hedgehog signaling but occurs normally in Shh null mice because indian hedgehog is upregulated to compensate for loss of Shh (Doles et al., 2006). An analogous mechanism may also trigger the upregulation of a compensatory signal during in vitro incubation of UGSs with media containing anti-WNT5A-IgG, and this may explain why prostatic bud number was unchanged by treatment with anti-WNT5A-IgG. Therefore, as an alternative approach to interrogate the role of WNT5A in prostatic budding, we next investigated whether excess WNT5A signaling impaired prostatic bud formation. UGSs were cultured for 3 d with media containing 10 nM DHT and graded concentrations of exogenous rmWNT5A (0–2 µg/ml). Mean prostatic bud number was significantly reduced by rmWNT5A (1 and 2 µg/ml), to approximately 75% of the control value (Fig. 4). Inhibition of budding by rmWNT5A appeared to be AR independent since it did not significantly change Ar mRNA abundance or abundance of the androgen-responsive gene steroid 5 alpha-reductase 2 (results not shown).
Figure 4. Recombinant mouse WNT5A (rmWNT5A) restricts prostatic budding in mouse UGS organ culture.
E14.5 UGSs were cultured for 3 d in serum-free media containing either 10 nM DHT and 0.1% DMSO (vehicle control, open bar) or DHT and graded concentrations of rmWNT5A (solid bars). Prostatic bud number (all lobes) was determined after the 3 d culture period by collecting each UGS, removing UGM as described previously, and then imaging the underlying UGE by scanning electron microscopy (SEM). A representative micrograph of a cultured UGS, after the mesenchyme was removed to reveal the underlying prostatic buds, is shown for each group. Prostatic buds are pseudocolored yellow. Results are mean ± SEM of five UGSs per group. Differences between groups were determined by ANOVA followed by Fisher’s least-significant difference test. “*” indicates significantly different from the vehicle control (0 µg/ml rmWNT5A), p < 0.05.
Excess WNT5A signaling blocked the formation of some, but not all prostatic buds and we next investigated the hypothesis that WNT5A selectively blocked development of certain prostate buds and not others. UGSs were cultured for 3 d in the presence of vehicle (control) or an effective prostatic bud inhibitory concentration of rmWNT5A. UGSs were then grafted under the kidney capsules of adult male immunodeficient mice and allowed to grow for 28 d. Prostate lobar-development was assessed by histological examination and gene expression profiling. Relative mRNA abundance of prostate lobe-selective gene products was assessed by real-time RT-PCR. It was established previously that probasin (Pbsn) is selectively expressed in dorsal prostate, beta-microseminoprotein (Msmb) is selectively expressed in lateral prostate, renin 1 (Ren1) is selectively expressed in anterior prostate, and spermine binding protein (Sbp) is selectively expressed in ventral prostate (Cook et al., 2007; Fabian et al., 1993; Fujimoto et al., 2006; Kwong et al., 1999; Mills et al., 1987; Shi et al., 2007; Thielen et al., 2007; Xuan et al., 1999). Arborization of prostate ducts and cytodifferentiation of secretory luminal cells occurred during this period in all grafted tissues. Grafted tissues from the rmWNT5A treatment group were devoid of ventral prostate ducts (results not shown) and exhibited significantly less Sbp (Fig. 5), despite the presence dorsolateral and anterior prostate ducts and normal levels of Pbsn, Msmb, and Ren1 (results not shown).
Figure 5. Recombinant mouse WNT5A restricts ventral prostate development.
E14.5 male UGSs were cultured for 3 d with 10 nM DHT, 0.1% DMSO and either no rmWNT5A (control, open bar) or 2 µg/ml rmWNT5A (solid bar) then grafted under the kidney capsule of adult male nu/nu mice and grown for 28 d. Real-time RT-PCR was used to measure abundance of a gene selectively expressed in ventral prostate, spermine binding protein (Sbp), as an index of ventral prostate development. The abundance of Sbp mRNA was normalized to peptidylprolyl isomerase A abundance, and results are presented as mean ± SEM of five grafted UGSs per in vitro treatment. Differences between groups were determined by Student’s T test. “*” indicates significantly different from vehicle control.
Antagonism of WNT5A signaling reverses ventral prostate inhibition by TCDD
To independently confirm that WNT5A acts selectively to block development of ventral prostate, but not other lobes, we investigated the effect of anti-WNT5A-IgG in a chemical model of ventral prostatic budding inhibition. We demonstrated previously that ventral prostatic budding was selectively impaired by TCDD, an agonist of the AHR nuclear orphan receptor and transcription factor (Lin et al., 2003). Since TCDD inhibits budding in a ventral UGS-selective fashion, we hypothesized that inhibition of WNT5A signaling may rescue ventral prostatic budding from inhibition by TCDD. UGSs were incubated for 3 d in organ culture media containing DHT and vehicle (control), TCDD, or TCDD + anti-WNT5A-IgG. TCDD alone significantly reduced total prostatic bud number and this effect was blocked by anti-WNT5A-IgG (Fig. 5A). To test whether this restoration of bud number by anti-WNT5A-IgG was due to the rescue of ventral bud formation, UGSs from the treatment groups described above were grafted under the kidney capsule of immunodeficient mice and evaluated 28 d later. Based on histological assessment and expression of transcripts that are selectively expressed in each of the mouse prostate lobes, TCDD did not impair development of anterior or dorsolateral prostate (results not shown). The antibody alone did not significantly change prostatic bud number or impair development of anterior, dorsolateral, or ventral prostate (results not shown). However, TCDD selectively impaired development of ventral prostate and this was restored by inhibition of WNT5A signaling with anti-WNT5A-IgG (Fig. 6). Thus, inhibition of WNT5A signaling reverses the inhibitory actions of TCDD on ventral prostatic budding.
Figure 6. A WNT5A inhibitory antibody (anti-WNT5A-IgG) counteracts the effects of a selective ventral prostate inhibitor, TCDD, during mouse UGS development in vitro.
E14.5 UGSs were cultured for 3 d in serum-free media containing 10 nM DHT and 0.1% DMSO (vehicle control, open bar) or these same two constituents and either TCDD (1 nM, gray-shaded bar) or TCDD + anti-WNT5A-IgG (gray-shaded, diagonally slashed bar). (A) Some cultured UGSs were imaged by scanning electron microscopy to assess total bud count. (B) Other cultured UGSs were grafted under the kidney capsule of nu/nu mice and grown for 28 d. Ventral prostate development was assessed by using real-time, RT-PCR to measure abundance of the ventral prostate-selective transcript, spermine binding protein (Sbp), in grafted tissues. Sbp abundance was normalized to peptidylprolyl isomerase A. Results are mean ± SEM of five UGS per treatment group. Differences between groups were determined by ANOVA followed by Fisher’s least significant difference test. The presence of “*” indicates significantly different from vehicle control and “‡” indicates significantly different from TCDD (p < 0.05).
DISCUSSION
WNT5A is required for early events in urogenital development
This is the first report, to our knowledge, that WNT5A is required early in testes, bladder, pelvic urethra, and UGS formation. Wnt5a null male mouse fetuses exhibited less testicular testosterone and thirty percent did not form bladder or pelvic urethra. Of the 70% of Wnt5a null male fetuses that formed bladder and UGS, only half formed pelvic urethra. It is worthwhile to note that agenesis of bladder, pelvic urethra, and UGS was not gender-dependent and occurred at the same frequency in male and female Wnt5a null mice (unpublished observation).
Prostatic budding was impaired in Wnt5a null male mice. However, we were unable to replicate this aberrant budding phenotype by pharmacologically inhibiting WNT5A signaling in WT UGSs cultured in media containing anti-WNT5A-IgG. Our interpretation of these results is that Wnt5a may contribute to, but alone is not required for prostatic bud patterning. Instead, Wnt5a may be required for normal UGS morphogenesis prior to budding. We suggest that truncation and distention of anterior and ventral prostatic budding zones in Wnt5a null males and decreased testosterone production predisposed these mice to bud patterning defects that do not occur in morphologically normal, WT UGSs. It was shown long ago that ventral prostatic buds are the most sensitive to androgen. Ventral prostatic buds form in female UGSs (Raynaud, 1942) even though circulating androgens are lower than in males (vom Saal, 1989). Androgens induce prostatic budding in female rats, with ventral prostatic bud formation occurring at lower androgen doses compared to dorsolateral and anterior buds (Greene et al., 1939). Therefore, absence of ventral buds in Wnt5a null UGSs suggests that other factors, in addition to reduced testosterone levels in these fetuses, contribute to ventral bud agenesis in these mice.
Excess Wnt5a negatively regulates ventral prostate development
Mechanisms responsible for prostatic bud patterning are poorly understood. The significance of our work is that it is the first to report impairment of ventral prostatic bud specification by WNT5A, the prototypical non-canonical WNT protein. Effects of WNT5A on prostatic budding are strikingly similar to those produced by TCDD, a previously identified chemical inhibitor of ventral prostatic budding and potent ligand of the AHR. We showed previously that AHR signaling was not required for prostatic bud formation (Lin et al., 2003) and showed in this study that WNT5A signaling also was not required for prostatic budding in vitro. However, activation of either AHR or WNT5A signaling inhibited budding. Addition of rmWNT5A or TCDD to UGS organ culture meida blocked ventral prostate development, as assessed by Sbp abundance and ventral prostate duct formation in grafted tissues. The blockade of prostate development by rmWNT5A and TCDD was ventral prostate-selective and did not appreciably affect dorsolateral or anterior prostate development. Inhibition of WNT5A signaling during UGS organ culture with TCDD completely prevented the loss of buds associated with TCDD exposure and permitted ventral prostate development. Collectively, these results support our hypothesis that WNT5A is a ventral UGS region-selective inhibitor of ventral prostate development in mice.
SOX9 was recently identified as a prostatic bud inhibitor (Thomsen et al., 2008). Conditional deletion of Sox9 in cells that express the early prostate marker NKX3.1 prevented ventral prostatic buds from forming while having considerably lesser effects on prostatic budding in other UGS regions. Since mesenchymal-epithelial interactions are required for prostatic budding (Cunha and Chung, 1981) and Wnt5a is synthesized in UGS mesenchyme, SOX9 activity in UGS epithelium may be mechanistically linked and downstream of WNT5A signaling during prostatic bud formation.
Wnt5a overlaps Ar, Bmp4, and Hoxa13 during prostate specification
Formation of bladder and UGS are supported by hormonally-independent developmental pathways but prostatic bud patterning and initiation require androgen (Lasnitzki and Mizuno, 1980). ARs in UGM bind testosterone but in UGE do not (Takeda and Chang, 1991). Activation of ARs in the periprostatic portion of UGM is particularly important for prostate specification (Takeda et al., 1987). Wnt5a abundance was not directly regulated by androgens (results not shown) but did overlap the purported location of AR activity. We detected Wnt5a in periprostatic UGM prior to and during bud formation. In UGS organ culture, rmWNT5A inhibited prostatic budding without changing abundance of Ar mRNA or abundance of Srd5a2, a gene that is directly regulated by activated AR. Thus, inhibition of prostatic budding by exogenous WNT5A likely occurred downstream of AR signaling.
Wnt5a is not required for prostatic budding in vivo. However, Wnt5a mRNA is up-regulated in anterior, dorsolateral, and ventral UGS budding zones during bud formation in these regions. Coupled with the fact that exogenous rmWNT5A inhibits prostatic budding, the functional role of WNT5A during prostatic budding in vivo may be to act in concert with other factors to limit the total number of buds that form in each UGS zone, especially the ventral budding zone. A similar role has been ascribed to Bmp4, which is also expressed in UGM during budding and inhibits prostatic budding from cultured UGSs (Lamm et al., 2001; Vezina et al., 2008a). In future studies, we will investigate interaction between Wnt5a and Bmp4 during prostatic budding, since these factors appear to be involved in a signaling loop in other tissues: Wnt5a is required for Bmp4 expression in developing mouse lung (Li et al., 2002) and Bmp4 is required for Wnt5a expression in the genital tubercle (Oishi et al., 2003).
Hoxa13, which is required at least in part for normal prostatic bud patterning (Warot et al., 1997), appears to functionally overlap Wnt5a during uterine development (Mericskay et al., 2004) and has recently been shown to control Wnt5a expression in mouse dermal fibroblasts (Rinn et al., 2008). The pattern of Wnt5a expression overlaps with Hoxa13 in the UGS (Warot et al., 1997), raising the possibility that Hoxa13 may interact with Wnt5a during prostatic budding. Further characterization of the regulatory loop between these signaling molecules may provide clues for how patterning of ventral, as well as dorsolateral and anterior prostatic budding, is achieved.
Supplementary Material
MEFs were loaded with Calcium Green-1 AM dye and intracellular free calcium was monitored in real-time by fluorescence imaging. MEFs were treated sequentially with saline vehicle (control, A), and either recombinant mouse WNT5A protein (rmWNT5A, 250 ng/ml, B), WNT5A inhibitory antibody (anti-WNT5A-IgG, 1000 ng/ml, C), or anti-WNT5A-IgG + rmWNT5A (D). MEF fluoromicrograms (Inset, Panels A and B), were obtained at the end of the treatment period with vehicle or rmWNT5A, respectively. Results are representative of three independent observations.
The intracellular free calcium concentration of MEFs was monitored in real-time by fluorescence imaging of cells loaded with Calcium Green-1 AM dye. MEFs were incubated with media containing vehicle (HBSS) to establish a baseline intracellular calcium concentration (Fig. 4A). Exposure of MEFs to rmWNT5A (250 ng/ml) mobilized intracellular calcium within 20 sec, followed by intracellular calcium depletion (Fig. 4B). Fluoromicrograms of MEFs captured 90 sec after exposure to rmWNT5A (Fig. 4B, inset), show an obvious decrease in intracellular calcium content compared to MEFs treated with control media (Fig. 4A, inset). Mobilization of intracellular calcium by WNT5A in MEFs was similar to the response produced by WNT5A in F9 teratocarcinoma cells and cardiac neural crest cells (Ma and Wang, 2006; Schleiffarth et al., 2007). The intracellular calcium concentration of MEFs was not changed substantially by exposure to anti-WNT5A-IgG (1000 ng/ml, Fig. 4C). However, rmWNT5A did not mobilize calcium in the presence of anti-WNT5A-IgG, even after prolonged incubation in culture (Fig. 4D).
ACKNOWLEDGEMENTS
This publication was supported by National Institutes of Health grants F31-HD049323 (SHA), F32-ES014284 (CMV), R37-ES01332 (REP), and T32-ES07015 (Molecular and Environmental Toxicology Center; contribution number XXXX). The authors thank Dr. Terry Yamaguchi (NCI, Frederick, MD) for providing Wnt5a null breeders and Wnt5a probe for in situ hybridization, and thank Dr. Ralph Albrecht and the Biological & Bio-materials Preparation, Imaging, and Characterization Laboratory (UW-Madison) for assistance with scanning electron microscopy.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Benedict JC, Lin TM, Loeffler IK, Peterson RE, Flaws JA. Physiological role of the aryl hydrocarbon receptor in mouse ovary development. Toxicol Sci. 2000;56:382–388. doi: 10.1093/toxsci/56.2.382. [DOI] [PubMed] [Google Scholar]
- Castelo-Branco G, Sousa KM, Bryja V, Pinto L, Wagner J, Arenas E. Ventral midbrain glia express region-specific transcription factors and regulate dopaminergic neurogenesis through Wnt-5a secretion. Mol Cell Neurosci. 2006;31:251–262. doi: 10.1016/j.mcn.2005.09.014. [DOI] [PubMed] [Google Scholar]
- Cheng CW, Yeh JC, Fan TP, Smith SK, Charnock-Jones DS. Wnt5a-mediated non-canonical Wnt signalling regulates human endothelial cell proliferation and migration. Biochem Biophys Res Commun. 2008;365:285–290. doi: 10.1016/j.bbrc.2007.10.166. [DOI] [PubMed] [Google Scholar]
- Cook C, Vezina CM, Allgeier SH, Shaw A, Yu M, Peterson RE, Bushman W. Noggin is required for normal lobe patterning and ductal budding in the mouse prostate. Dev Biol. 2007;312:217–230. doi: 10.1016/j.ydbio.2007.09.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cunha GR, Chung LW. Stromal-epithelial interactions--I. Induction of prostatic phenotype in urothelium of testicular feminized (Tfm/y) mice. J Steroid Biochem. 1981;14:1317–1324. doi: 10.1016/0022-4731(81)90338-1. [DOI] [PubMed] [Google Scholar]
- Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ, Sugimura Y. The endocrinology and developmental biology of the prostate. Endocr Rev. 1987;8:338–362. doi: 10.1210/edrv-8-3-338. [DOI] [PubMed] [Google Scholar]
- Cunha GR, Lung B. The possible influence of temporal factors in androgenic responsiveness of urogenital tissue recombinants from wild-type and androgen-insensitive (Tfm) mice. J Exp Zool. 1978;205:181–193. doi: 10.1002/jez.1402050203. [DOI] [PubMed] [Google Scholar]
- Dejmek J, Safholm A, Kamp Nielsen C, Andersson T, Leandersson K. Wnt-5a/Ca2+-induced NFAT activity is counteracted by Wnt-5a/Yes-Cdc42-casein kinase 1alpha signaling in human mammary epithelial cells. Mol Cell Biol. 2006;26:6024–6036. doi: 10.1128/MCB.02354-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doles J, Cook C, Shi X, Valosky J, Lipinski R, Bushman W. Functional compensation in Hedgehog signaling during mouse prostate development. Dev Biol. 2006;295:13–25. doi: 10.1016/j.ydbio.2005.12.002. [DOI] [PubMed] [Google Scholar]
- Donjacour AA, Thomson AA, Cunha GR. FGF-10 plays an essential role in the growth of the fetal prostate. Dev Biol. 2003;261:39–54. doi: 10.1016/s0012-1606(03)00250-1. [DOI] [PubMed] [Google Scholar]
- Fabian JR, Kane CM, Abel KJ, Gross KW. Expression of the mouse Ren-1 gene in the coagulating gland: localization and regulation. Biol Reprod. 1993;48:1383–1394. doi: 10.1095/biolreprod48.6.1383. [DOI] [PubMed] [Google Scholar]
- Fujimoto N, Akimoto Y, Suzuki T, Kitamura S, Ohta S. Identification of prostatic-secreted proteins in mice by mass spectrometric analysis and evaluation of lobe-specific and androgen-dependent mRNA expression. J Endocrinol. 2006;190:793–803. doi: 10.1677/joe.1.06733. [DOI] [PubMed] [Google Scholar]
- Gat U, DasGupta R, Degenstein L, Fuchs E. De Novo hair follicle morphogenesis and hair tumors in mice expressing a truncated beta-catenin in skin. Cell. 1998;95:605–614. doi: 10.1016/s0092-8674(00)81631-1. [DOI] [PubMed] [Google Scholar]
- Goldstein JL, Wilson JD. Genetic and hormonal control of male sexual differentiation. J Cell Physiol. 1975;85:365–377. doi: 10.1002/jcp.1040850405. [DOI] [PubMed] [Google Scholar]
- Greene RR, Burrill MW, Ivy AC. Experimental intersexuality. The effect of antenatal androgens on sexual development in female rats. Amer J Anat. 1939;65:415–469. [Google Scholar]
- Grishina IB, Kim SY, Ferrara C, Makarenkova HP, Walden PD. BMP7 inhibits branching morphogenesis in the prostate gland and interferes with Notch signaling. Dev Biol. 2005;288:334–347. doi: 10.1016/j.ydbio.2005.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hogan BL. Morphogenesis. Cell. 1999;96:225–233. doi: 10.1016/s0092-8674(00)80562-0. [DOI] [PubMed] [Google Scholar]
- Joesting MS, Cheever TR, Volzing KG, Yamaguchi TP, Wolf V, Naf D, Rubin JS, Marker PC. Secreted frizzled related protein 1 is a paracrine modulator of epithelial branching morphogenesis, proliferation, and secretory gene expression in the prostate. Dev Biol. 2008;317:161–173. doi: 10.1016/j.ydbio.2008.02.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kwong J, Chan FL, Jiang S, Guo Y, Imasato Y, Sakai H, Koropatnick J, Chin JL, Xuan JW. Differential expression of PSP94 in rat prostate lobes as demonstrated by an antibody against recombinant GST-PSP94. J Cell Biochem. 1999;74:406–417. [PubMed] [Google Scholar]
- Lamm ML, Catbagan WS, Laciak RJ, Barnett DH, Hebner CM, Gaffield W, Walterhouse D, Iannaccone P, Bushman W. Sonic hedgehog activates mesenchymal Gli1 expression during prostate ductal bud formation. Dev Biol. 2002;249:349–366. doi: 10.1006/dbio.2002.0774. [DOI] [PubMed] [Google Scholar]
- Lamm ML, Podlasek CA, Barnett DH, Lee J, Clemens JQ, Hebner CM, Bushman W. Mesenchymal factor bone morphogenetic protein 4 restricts ductal budding and branching morphogenesis in the developing prostate. Dev Biol. 2001;232:301–314. doi: 10.1006/dbio.2001.0187. [DOI] [PubMed] [Google Scholar]
- Lasnitzki I, Mizuno T. Prostatic induction: interaction of epithelium and mesenchyme from normal wild-type mice and androgen-insensitive mice with testicular feminization. J Endocrinol. 1980;85:423–428. doi: 10.1677/joe.0.0850423. [DOI] [PubMed] [Google Scholar]
- Li C, Xiao J, Hormi K, Borok Z, Minoo P. Wnt5a participates in distal lung morphogenesis. Dev Biol. 2002;248:68–81. doi: 10.1006/dbio.2002.0729. [DOI] [PubMed] [Google Scholar]
- Lin TM, Ko K, Moore RW, Buchanan DL, Cooke PS, Peterson RE. Role of the aryl hydrocarbon receptor in the development of control and 2,3,7,8-tetrachlorodibenzo-p-dioxin-exposed male mice. J Toxicol Environ Health A. 2001;64:327–342. doi: 10.1080/152873901316981312. [DOI] [PubMed] [Google Scholar]
- Lin TM, Ko K, Moore RW, Simanainen U, Oberley TD, Peterson RE. Effects of aryl hydrocarbon receptor null mutation and in utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure on prostate and seminal vesicle development in C57BL/6 mice. Toxicol Sci. 2002;68:479–487. doi: 10.1093/toxsci/68.2.479. [DOI] [PubMed] [Google Scholar]
- Lin TM, Rasmussen NT, Moore RW, Albrecht RM, Peterson RE. Region-specific inhibition of prostatic epithelial bud formation in the urogenital sinus of C57BL/6 mice exposed in utero to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Sci. 2003;76:171–181. doi: 10.1093/toxsci/kfg218. [DOI] [PubMed] [Google Scholar]
- Liu F, Chu EY, Watt B, Zhang Y, Gallant NM, Andl T, Yang SH, Lu MM, Piccolo S, Schmidt-Ullrich R, Taketo MM, Morrisey EE, Atit R, Dlugosz AA, Millar SE. Wnt/beta-catenin signaling directs multiple stages of tooth morphogenesis. Dev Biol. 2008;313:210–224. doi: 10.1016/j.ydbio.2007.10.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu F, Thirumangalathu S, Gallant NM, Yang SH, Stoick-Cooper CL, Reddy ST, Andl T, Taketo MM, Dlugosz AA, Moon RT, Barlow LA, Millar SE. Wnt-beta-catenin signaling initiates taste papilla development. Nat Genet. 2007;39:106–112. doi: 10.1038/ng1932. [DOI] [PubMed] [Google Scholar]
- Lu Y, Zhang J, Dai J, Dehne LA, Mizokami A, Yao Z, Keller ET. Osteoblasts induce prostate cancer proliferation and PSA expression through interleukin-6-mediated activation of the androgen receptor. Clin Exp Metastasis. 2004;21:399–408. doi: 10.1007/s10585-005-0056-6. [DOI] [PubMed] [Google Scholar]
- Ma L, Wang HY. Suppression of cyclic GMP-dependent protein kinase is essential to the Wnt/cGMP/Ca2+ pathway. J Biol Chem. 2006;281:30990–31001. doi: 10.1074/jbc.M603603200. [DOI] [PubMed] [Google Scholar]
- Mericskay M, Kitajewski J, Sassoon D. Wnt5a is required for proper epithelial-mesenchymal interactions in the uterus. Development. 2004;131:2061–2072. doi: 10.1242/dev.01090. [DOI] [PubMed] [Google Scholar]
- Mills JS, Needham M, Thompson TC, Parker MG. Androgen-regulated expression of secretory protein synthesis in mouse ventral prostate. Mol Cell Endocrinol. 1987;53:111–118. doi: 10.1016/0303-7207(87)90197-3. [DOI] [PubMed] [Google Scholar]
- Murdoch B, Chadwick K, Martin M, Shojaei F, Shah KV, Gallacher L, Moon RT, Bhatia M. Wnt-5A augments repopulating capacity and primitive hematopoietic development of human blood stem cells in vivo. Proc Natl Acad Sci U S A. 2003;100:3422–3427. doi: 10.1073/pnas.0130233100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Noramly S, Freeman A, Morgan BA. beta-catenin signaling can initiate feather bud development. Development. 1999;126:3509–3521. doi: 10.1242/dev.126.16.3509. [DOI] [PubMed] [Google Scholar]
- Oishi I, Suzuki H, Onishi N, Takada R, Kani S, Ohkawara B, Koshida I, Suzuki K, Yamada G, Schwabe GC, Mundlos S, Shibuya H, Takada S, Minami Y. The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells. 2003;8:645–654. doi: 10.1046/j.1365-2443.2003.00662.x. [DOI] [PubMed] [Google Scholar]
- Podlasek CA, Barnett DH, Clemens JQ, Bak PM, Bushman W. Prostate development requires Sonic hedgehog expressed by the urogenital sinus epithelium. Dev Biol. 1999a;209:28–39. doi: 10.1006/dbio.1999.9229. [DOI] [PubMed] [Google Scholar]
- Podlasek CA, Clemens JQ, Bushman W. Hoxa-13 gene mutation results in abnormal seminal vesicle and prostate development. J Urol. 1999b;161:1655–1661. [PubMed] [Google Scholar]
- Raynaud A. Recherches embryologiques et histologiques sur la différenciation sexuelle normale de la souris. Bull. Biol. Fr. Belg. 1942 Suppl. 29:1–114. [Google Scholar]
- Rinn JL, Wang JK, Allen N, Brugmann SA, Mikels AJ, Liu H, Ridky TW, Stadler HS, Nusse R, Helms JA, Chang HY. A dermal HOX transcriptional program regulates site-specific epidermal fate. Genes Dev. 2008;22:303–307. doi: 10.1101/gad.1610508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roarty K, Serra R. Wnt5a is required for proper mammary gland development and TGF-beta-mediated inhibition of ductal growth. Development. 2007;134:3929–3939. doi: 10.1242/dev.008250. [DOI] [PubMed] [Google Scholar]
- Schleiffarth JR, Person AD, Martinsen BJ, Sukovich DJ, Neumann A, Baker CV, Lohr JL, Cornfield DN, Ekker SC, Petryk A. Wnt5a is required for cardiac outflow tract septation in mice. Pediatr Res. 2007;61:386–391. doi: 10.1203/pdr.0b013e3180323810. [DOI] [PubMed] [Google Scholar]
- Schulte G, Bryja V, Rawal N, Castelo-Branco G, Sousa KM, Arenas E. Purified Wnt-5a increases differentiation of midbrain dopaminergic cells and dishevelled phosphorylation. J Neurochem. 2005;92:1550–1553. doi: 10.1111/j.1471-4159.2004.03022.x. [DOI] [PubMed] [Google Scholar]
- Shi X, Gipp J, Bushman W. Anchorage-independent culture maintains prostate stem cells. Dev Biol. 2007;312:396–406. doi: 10.1016/j.ydbio.2007.09.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takeda H, Chang C. Immunohistochemical and in-situ hybridization analysis of androgen receptor expression during the development of the mouse prostate gland. J Endocrinol. 1991;129:83–89. doi: 10.1677/joe.0.1290083. [DOI] [PubMed] [Google Scholar]
- Takeda H, Lasnitzki I, Mizuno T. Change of mosaic pattern by androgens during prostatic bud formation in XTfm/X+ heterozygous female mice. J Endocrinol. 1987;114:131–137. doi: 10.1677/joe.0.1140131. [DOI] [PubMed] [Google Scholar]
- Teuliere J, Faraldo MM, Deugnier MA, Shtutman M, Ben-Ze'ev A, Thiery JP, Glukhova MA. Targeted activation of beta-catenin signaling in basal mammary epithelial cells affects mammary development and leads to hyperplasia. Development. 2005;132:267–277. doi: 10.1242/dev.01583. [DOI] [PubMed] [Google Scholar]
- Thielen JL, Volzing KG, Collier LS, Green LE, Largaespada DA, Marker PC. Markers of prostate region-specific epithelial identity define anatomical locations in the mouse prostate that are molecularly similar to human prostate cancers. Differentiation. 2007;75:49–61. doi: 10.1111/j.1432-0436.2006.00115.x. [DOI] [PubMed] [Google Scholar]
- Thomsen MK, Butler CM, Shen MM, Swain A. Sox9 is required for prostate development. Dev Biol. 2008;316:302–311. doi: 10.1016/j.ydbio.2008.01.030. [DOI] [PubMed] [Google Scholar]
- Timms BG, Howdeshell KL, Barton L, Bradley S, Richter CA, vom Saal FS. Estrogenic chemicals in plastic and oral contraceptives disrupt development of the fetal mouse prostate and urethra. Proc Natl Acad Sci U S A. 2005;102:7014–7019. doi: 10.1073/pnas.0502544102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verbny Y, Zhang CL, Chiu SY. Coupling of calcium homeostasis to axonal sodium in axons of mouse optic nerve. J Neurophysiol. 2002;88:802–816. doi: 10.1152/jn.2002.88.2.802. [DOI] [PubMed] [Google Scholar]
- Vezina CM, Allgeier SH, Fritz WA, Moore RW, Strerath M, Bushman W, Peterson RE. Retinoic acid induces prostatic bud formation. Dev Dyn. 2008a doi: 10.1002/dvdy.21526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vezina CM, Hicks Allgeier SM, Moore RW, Lin TM, Bemis JC, Gasiewicz TA, Peterson RE. Spatiotemporal Patterns of Aryl Hydrocarbon Receptor Signaling and Prostatic Budding in 2,3,7,8-Tetrachlorodibenzo-p-Dioxin-Exposed Mice. Toxicol Sci. 2008b In Press. [Google Scholar]
- vom Saal FS. Sexual differentiation in litter-bearing mammals: influence of sex of adjacent fetuses in utero. J Anim Sci. 1989;67:1824–1840. doi: 10.2527/jas1989.6771824x. [DOI] [PubMed] [Google Scholar]
- Warot X, Fromental-Ramain C, Fraulob V, Chambon P, Dolle P. Gene dosage-dependent effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and urogenital tracts. Development. 1997;124:4781–4791. doi: 10.1242/dev.124.23.4781. [DOI] [PubMed] [Google Scholar]
- Widelitz RB, Jiang TX, Lu J, Chuong CM. beta-catenin in epithelial morphogenesis: conversion of part of avian foot scales into feather buds with a mutated beta-catenin. Dev Biol. 2000;219:98–114. doi: 10.1006/dbio.1999.9580. [DOI] [PubMed] [Google Scholar]
- Xuan JW, Kwong J, Chan FL, Ricci M, Imasato Y, Sakai H, Fong GH, Panchal C, Chin JL. cDNA, genomic cloning, and gene expression analysis of mouse PSP94 (prostate secretory protein of 94 amino acids) DNA Cell Biol. 1999;18:11–26. doi: 10.1089/104454999315583. [DOI] [PubMed] [Google Scholar]
- Yamaguchi TP, Bradley A, McMahon AP, Jones S. A Wnt5a pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development. 1999;126:1211–1223. doi: 10.1242/dev.126.6.1211. [DOI] [PubMed] [Google Scholar]
- Zhang TJ, Hoffman BG, Ruiz de Algara T, Helgason CD. SAGE reveals expression of Wnt signalling pathway members during mouse prostate development. Gene Expr Patterns. 2006;6:310–324. doi: 10.1016/j.modgep.2005.07.005. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
MEFs were loaded with Calcium Green-1 AM dye and intracellular free calcium was monitored in real-time by fluorescence imaging. MEFs were treated sequentially with saline vehicle (control, A), and either recombinant mouse WNT5A protein (rmWNT5A, 250 ng/ml, B), WNT5A inhibitory antibody (anti-WNT5A-IgG, 1000 ng/ml, C), or anti-WNT5A-IgG + rmWNT5A (D). MEF fluoromicrograms (Inset, Panels A and B), were obtained at the end of the treatment period with vehicle or rmWNT5A, respectively. Results are representative of three independent observations.
The intracellular free calcium concentration of MEFs was monitored in real-time by fluorescence imaging of cells loaded with Calcium Green-1 AM dye. MEFs were incubated with media containing vehicle (HBSS) to establish a baseline intracellular calcium concentration (Fig. 4A). Exposure of MEFs to rmWNT5A (250 ng/ml) mobilized intracellular calcium within 20 sec, followed by intracellular calcium depletion (Fig. 4B). Fluoromicrograms of MEFs captured 90 sec after exposure to rmWNT5A (Fig. 4B, inset), show an obvious decrease in intracellular calcium content compared to MEFs treated with control media (Fig. 4A, inset). Mobilization of intracellular calcium by WNT5A in MEFs was similar to the response produced by WNT5A in F9 teratocarcinoma cells and cardiac neural crest cells (Ma and Wang, 2006; Schleiffarth et al., 2007). The intracellular calcium concentration of MEFs was not changed substantially by exposure to anti-WNT5A-IgG (1000 ng/ml, Fig. 4C). However, rmWNT5A did not mobilize calcium in the presence of anti-WNT5A-IgG, even after prolonged incubation in culture (Fig. 4D).






