Skip to main content
NCBI home page
The Journal of Clinical Endocrinology and Metabolism logoLink to The Journal of Clinical Endocrinology and Metabolism
. 2008 Dec 2;94(2):504–510. doi: 10.1210/jc.2007-2694

Single Nucleotide Transcription Factor 7-Like 2 (TCF7L2) Gene Polymorphisms in Antiislet Autoantibody-Negative Patients at Onset of Diabetes

Jeesuk Yu 1, Andrea K Steck 1, Sunanda Babu 1, Liping Yu 1, Dongmei Miao 1, Kim McFann 1, John Hutton 1, George S Eisenbarth 1, Georgeanna Klingensmith 1
PMCID: PMC2646512  PMID: 19050058

Abstract

Context: There is controversy as to whether type 2 diabetes genetic susceptibility contributes to type 1 diabetes, and it is not known what proportion of islet autoantibody-negative new onset subjects have type 2 diabetes risk alleles.

Objectives: We designed this study to evaluate whether two type 2 diabetes-associated single nucleotide polymorphisms (SNPs) of transcription factor 7-like 2 (TCF7L2) gene are associated with the development of islet autoantibody-negative diabetes vs. islet autoantibody-positive diabetes in young patients and whether these SNPs are associated with specific clinical phenotypes.

Design: Autoantibody against glutamic acid decarboxylase 65, islet cell antibody 512bdc (form of IA-2), insulin, ZnT8 transporter, and cytoplasmic islet cell antibody were assayed in patients with new onset diabetes seen at the Barbara Davis Center using sera obtained within 2 wk of diagnosis. We genotyped two noncoding variants in the TCF7L2 gene, rs12255372 and rs7903146, in diabetic subjects and normal controls.

Results: A total of 140 patients (15.7%) were negative for all islet autoantibodies among 893 subjects less than age 25 at the onset of diabetes. The allele and genotype frequencies of two SNPs showed that these are associated (odds ratio up to 4) with the development of diabetes in the autoantibody-negative diabetic cohort, but not in the autoantibody-positive diabetic cohort.

Conclusion: TCF7L2 type 2 diabetes susceptibility alleles are associated with islet autoantibody-negative but not autoantibody-positive new onset diabetes in young patients.

Transcription factor 7-like 2 (TCF7L2) type 2 diabetes susceptibility alleles are associated with islet autoantibody negative, but not autoantibody positive, new onset diabetes in young patients.

In early 2006, Grant et al. (1) reported that genetic variants within the transcription factor 7-like 2 (TCF7L2) gene were associated with the development of type 2 diabetes in Icelandic, Danish, and American samples. Subsequently, many studies confirmed that TCF7L2 is a major susceptibility gene for type 2 diabetes in various ethnic groups (2,3,4,5,6,7,8). Although the physiological consequences of carrying the TCF7L2 risk allele remain unclear, some studies showed an impaired insulin secretion (1,4,5). A progressive loss of insulin secretion might be an essential component predisposing carriers of TCF7L2 risk allele to develop type 2 diabetes.

So far, TCF7L2 has not been associated with susceptibility to type 1A diabetes (immune-mediated type 1 diabetes), and there has been no major contribution reported with maturity-onset diabetes of the young or neonatal diabetes (9,10,11).

TCF7L2 belongs to a subfamily of TCF7-like high-mobility group box-containing transcription factors and maps to chromosome 10q25. TCF7L2 is known to encode a transcription factor that plays a role in the Wnt signaling pathway (12). This pathway is crucial for the regulation of the glucagon gene expression and the secretion of its product glucagon-like peptide-1 by the intestinal endocrine cells.

Because TCF7L2 seems to have an effect on insulin secretion and blood glucose homeostasis, it may also be an important genetic susceptibility factor for other types of diabetes, i.e. islet autoantibody-negative diabetes in children.

We designed this study to evaluate whether two specific single nucleotide polymorphisms (SNPs) of TCF7L2 gene, rs12255372 and rs7903146, are associated with the development of islet autoantibody-negative diabetes in children and young patients (onset less than 25 yr of age) vs. islet autoantibody-positive diabetes and whether these SNPs are associated with specific clinical phenotypes.

Subjects and Methods

Subjects

A total of 893 subjects less than 25 yr of age at the onset of diabetes (463 males, 430 females; 0.92 to 24.65 yr of age at onset) were assayed for three antiislet autoantibodies [anti-GAD65, anti-ICA512bdc (form of IA-2), and antiinsulin] using sera obtained within 2 wk of diagnosis at the Barbara Davis Center for Childhood Diabetes between October 1992 and October 2004. The study design is shown in Fig. 1. Subjects negative for all three above autoantibodies were subsequently tested for IA-2ic autoantibodies (an alternative splice variant of IA-2 compared with ICA512bdc), cytoplasmic islet cell antibody (ICA), and autoantibodies to the ZnT8, a newly recognized autoantigen (13), using the same initial sera collected within 2 wk of diagnosis. The subjects without any of the above autoantibodies were classified into the antibody-negative diabetes mellitus (AbnDM) group, and the subjects with any of these autoantibodies were classified into the antibody-positive diabetes mellitus (AbpDM) group. The genotyping of two type 2 diabetes-associated noncoding variants in the TCF7L2 gene, rs12255372 and rs7903146, was performed in 113 autoantibody-negative and 573 autoantibody-positive diabetic subjects with DNA available. We also analyzed human leukocyte antigen (HLA) class II polymorphisms in 409 patients with diabetes (110 from the AbnDM and 299 from the AbpDM) on the basis of DNA sample availability. As normal controls, 305 subjects from the general population were analyzed. Subjects gave written informed consent for autoantibody testing and genetic analysis with Institutional Review Board approval.

Figure 1.

Figure 1

Open in a new tab

Study design for antiislet autoantibodies and genotyping of two sequence variants in TCF7L2 gene. Antiislet autoantibodies including GAA, ICA512AA, and IAA were measured for all 893 enrolled study subjects. The subjects without ICA512AA were tested with an IA-2ic construct. We also tested for autoantibody against ICA and ZnT8 in those negative for the above autoantigens, and 140 newly diagnosed diabetic patients were confirmed as negative for all tested antiislet autoantibodies. We genotyped two type 2 diabetes-associated noncoding variants in the TCF7L2 gene, rs12255372 and rs7903146, in 113 autoantibody-negative diabetic subjects and 573 autoantibody-positive diabetic subjects as well as 305 normal controls.

The follow-up (FU) analyses were done on data collected from FU visits 24–36 months after initial diagnosis from available subjects. Glycosylated hemoglobin (HbA1c) was measured by the DCA 2000 analyzer (Bayer Laboratories, Elkhart, IN). Almost all of the subjects were on insulin treatment. At 2 yr of FU, there were 7 of 573 (1%) autoantibody-positive subjects and 18 of 113 (16%) autoantibody-negative subjects not on insulin; those subjects were either on oral hypoglycemic drugs or on a diet at the time of FU. At the most recent visit (average FU of 6.1 yr), the numbers stayed about the same: there were 8 of 573 (1%) autoantibody-positive subjects and 19 of 113 (17%) autoantibody-negative subjects not on insulin. There were no statistically significant differences in genotype distribution between antibody-negative patients on insulin vs. not on insulin for either SNP.

Antiislet autoantibody assay

Blood samples from patients were collected within 2 wk of diagnosis of diabetes for the analysis of antiislet autoantibodies.

Glutamic acid decarboxylase (GAD) autoantibody (GAA) and ICA512 autoantibody (ICA512AA) assays

GAA and ICA512AA were measured by a combined radiobinding assay as previously described (14). In brief, labeled recombinant GAD65 and ICA512bdc were produced by in vitro transcription/translation with different labeling (3H-GAD65 and 35S-ICA512bdc). The radioassay was performed on a 96-well filtration plate (Fisher Scientific, Loughborough, UK). We counted radioactivity on a TopCount 96-well plate β-counter (PerkinElmer Life Sciences, Wilmington, DE) and expressed the levels of both antibodies as an index. The interassay coefficients of variation are 10 and 5% for GAA and ICA512AA, respectively (n = 50). The upper limits of normal nondiabetic sera (0.032 for GAA; 0.049 for ICA512AA) were established as the 99th percentile of 198 healthy normal controls. The sensitivity and specificity for GAA were 76 and 99%, respectively, and those for ICA512AA were 64 and 100%, respectively, in the Diabetes Autoantibody Standardization Program workshop (DASP, 2005). IA-2ic, an alternate construct of ICA512, was kindly provided by Dr. Ezio Bonifacio (Diabetes Research Institute, Munich, Germany), and we measured autoantibody to IA-2ic for the samples without ICA512AA. In the DASP workshop in 2005, the sensitivity and specificity for IA-2ic were 68 and 100%, respectively.

Insulin autoantibody (IAA) assay

IAA was measured by a micro-radiobinding assay (mIAA) as described previously (15). Briefly, 125I-human insulin (Amersham, Little Chalfont, UK) was incubated with patient’s serum with and without cold human insulin (Humalog; Eli Lilly and Co., Indianapolis, IN), followed by precipitation with protein A/G Sepharose. An index was determined based on the difference in counts per minute between wells without and with cold insulin. The positive cutoff point of 0.010 was the 99th percentile of 106 normal controls. The interassay coefficient of variation is 20% (n = 100) at low positive levels, and the sensitivity and specificity for mIAA in the DASP workshop in 2005 were 58 and 99%, respectively.

ICA measurement

ICA was measured in subjects negative for GAD, ICA512, IA-2ic, and insulin at Dr. William Winter’s laboratory in Gainesville, Florida, by indirect immunofluorescence method using cryostat-cut frozen sections of human blood type O pancreas. The results were expressed in Juvenile Diabetes Foundation (JDF) units, and a value equal to or more than 10 JDF units was considered positive (16,17).

ZnT8 autoantibody assay

Autoantibody reacting with the newly identified autoantigen, ZnT8, was also assayed in subjects without any of the above autoantibodies using a radiobinding assay (13).

Selection of two SNPs in TCF7L2 gene and genotyping

Two TCF7L2 SNPs, rs12255372 and rs7903146, were analyzed using TaqMan allelic discrimination genotyping assay (real-time PCR, TaqMan; Applied Biosystems, Foster City, CA). The call rate for both assays was more than 95%, and the duplicate concordance rate was above 99%. Both SNPs were in Hardy-Weinberg equilibrium.

The context sequence of rs12255372 was TGCCCAGGAATATCCAGGCAAGAAT[G/T]ACCATATTCTGATAATTACTCAGGC, and the context sequence of rs7903146 was TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG.

HLA typing

HLA class II polymorphisms were typed in 110 AbnDM and 299 AbpDM patients, based on DNA sample availability. Genomic DNA samples were obtained from peripheral white blood cells. HLA class II subtyping was performed by PCR amplification of the polymorphic exon 2 of the HLA-DQA1-DQB1 gene and hybridization of amplified DNA using sequence-specific oligonucleotide probes (Applied Biosystems; and Dynal Biotech, Oslo, Norway). HLA-DRB1 was subtyped by sequencing of the PCR-amplified exon 2 with alleles called by Matchmaker (Celera Genomics, Rockville, MD).

Statistical analysis

Results of the antibody-negative diabetes group were compared with those of the control group and AbpDM cohort. Categorical variables were analyzed using Fisher’s exact test. Continuous variables were compared using Kruskal-Wallis test or independence samples t test. Body mass index (BMI) z-score was calculated on the basis of gender and age using the program Epi Info version 3.3.2 (Centers for Disease Control and Prevention, Atlanta, GA). Statistical analyses were performed using Prism software (GraphPad Software Inc., San Diego, CA) and SAS software version 9.1 (SAS Institute Inc., Cary, NC).

Results

Clinical characteristics and antiislet autoantibody results

Study design for the assays of antiislet autoantibodies and genotyping of two sequence variants in TCF7L2 gene are explained in Fig. 1.

Clinical characteristics of the study subjects are described in Table 1. Autoantibody-negative diabetic patients and controls were more likely to be Hispanic (25–27%) and less often Caucasian (58–65%) than antibody-positive diabetic subjects (13% Hispanic and 80% Caucasian). The average age of onset in the AbpDM cohort was significantly lower than that in AbnDM cohort by approximately 2 yr (P = 0.0002).

Table 1.

Clinical characteristics of study subjects

AbnDM (n = 113) AbpDM (n = 573) Normal controls (n = 305) P values (AbnDM vs. AbpDM)
Gender (M:F:U) 57:56:0 302:271:0 154:140:11
Ethnicity (C:H:AA:AI:As:U) 65:28:9:1:2:8 458:74:21:5:3:12 197:81:1:0:0:26
Onset age (yr) 12.41 ± 4.47 113 10.72 ± 4.39 573 0.0002
Initial BMI z-score 0.65 ± 1.44 87 −0.25 ± 1.38 471 <0.0001
FU BMI z-score 0.73 ± 0.91 57 0.65 ± 0.83 412 NS
Initial HbA1c (%) 11 ± 2.74 103 11.27 ± 2.21 522 NS
FU HbA1c (%) 8.33 ± 2.43 68 8.55 ± 1.52 455 NS
Initial systolic BP (mm Hg) 117 ± 16.3 86 107 ± 14.5 437 <0.0001
Initial diastolic BP (mm Hg) 68 ± 11.7 86 65 ± 11.0 438 0.0117
FU systolic BP (mm Hg) 113 ± 15.5 67 110 ± 13.7 443 0.0313
FU diastolic BP (mm Hg) 64 ± 11.2 67 61 ± 11.0 443 0.0346
Open in a new tab

Data represent mean ± sd or number. P values by independence samples t test. M, Males; F, females; U, unknown; C, Caucasians; H, Hispanics; AA, African-Americans; AI, American Indians; As, Asians; BP, blood pressure; FU, follow-up data between 2 and 3 yr after the diagnosis of diabetes; NS, not significant. 

As expected, the initial mean BMI z-score was significantly higher in the AbnDM cohort than that in the AbpDM cohort (0.65 vs. −0.25; P < 0.0001). The initial and FU systolic and diastolic blood pressures also showed a small but statistically significant difference between the two groups (P < 0.05). In contrast, there was no statistical difference in the mean FU BMI z-score, or initial and FU mean HbA1c between AbnDM and AbpDM cohort (Table 1).

HLA class II alleles were dramatically different between the two diabetic groups. The protective allele of type 1 diabetes, DQB*0602, was much more frequent in the AbnDM group compared with the AbpDM group (11.8 vs. 2.0%; P < 0.001), and DR3/4, the highest risk genotype of type 1 diabetes, was much more frequent in the AbpDM group (24.4 vs. 10%; P < 0.01) (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Distribution (%) of HLA in the study group. HLA class II alleles were present very differently between the two diabetic groups. The protective DQB*0602 allele was much more frequent in the AbnDM group compared with the AbpDM group (11.8 vs. 2%; P < 0.001), and DR3/4, the most high-risk genotype of type 1 diabetes, was much more frequent in the AbpDM group (10 vs. 24.4%; P < 0.01).

TCF7L2 SNPs results

The genotyping results of two common noncoding variants in the TCF7L2 gene, rs12255372 and rs7903146, showed that both type 2 diabetes-associated T allele and T/T genotype of each SNP were more frequent in the AbnDM group compared with AbpDM or normal controls (odds ratio up to 3.40; P < 0.01) (Table 2). The T/T genotype of each SNP had the highest odds ratio compared with heterozygotes and compared with the G/G (rs12255372 SNP) or C/C genotype (rs7903146) with odds ratio up to 3.40 (Table 2). Alleles and genotype frequencies in only Caucasians less than 18 yr of age gave basically the same results as for the overall group (supplemental Table 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://jcem.endojournals.org). Analyses of genotypes in only non-Hispanic Caucasians showed the same differential association of the T alleles and T/T genotypes with the AbnDM group (odds ratio up to 4.10; P < 0.01) (Fig. 3). When analyzing the cohort of subjects without HLA DR3/4 genotype, the T alleles and T/T genotypes of both SNPs were still statistically more frequent in the AbnDM group (odds ratio up to 3.64; P < 0.001) (Fig. 3). Stratified analyses in only the DR3/4 subgroup were limited due to the small sample size (there were only 11 subjects in the AbnDM group with HLA DR3/4); diabetic subjects (AbnDM and AbpDM groups combined) were more likely to have the TCF7L2 risk genotypes compared with controls.

Table 2.

Association of alleles and genotypes of TCF7L2 SNPs with AbnDM vs. AbpDM or normal controls (NC)

AbnDM (n = 113) AbpDM (n = 573) NC (n = 305) Odds ratio (95% confidence interval)
AbnDM vs. AbpDM AbnDM vs. NC AbnDM vs. (AbpDM + NC) AbpDM vs. NC
rs12255372
 Alleles
  G 144 (0.637) 838 (0.731) 458 (0.751) 1.00 (reference) 1.00 (reference) 1.00 (reference) 1.00 (reference)
  T 82 (0.363) 308 (0.269) 152 (0.249) 1.55 (1.15–2.09)a 1.72 (1.24–2.38)a 1.60 (1.20–2.15)a 1.11 (0.88–1.39)
 Genotypes
  G/G 47 (0.416) 306 (0.534) 170 (0.557) 1.00 (reference) 1.00 (reference) 1.00 (reference) 1.00 (reference)
  G/T 50 (0.442) 226 (0.394) 118 (0.387) 1.44 (0.93–2.22) 1.53 (0.97–2.43) 1.47 (0.97–2.24) 1.06 (0.79–1.41)
  T/T 16 (0.142) 41 (0.072) 17 (0.056) 2.54 (1.32–4.89)a 3.40 (1.60–7.25)a 2.79 (1.49–5.24)a 1.34 (0.74–2.43)
rs7903146
 Alleles
  C 141 (0.624) 840 (0.733) 451 (0.739) 1.00 (reference) 1.00 (reference) 1.00 (reference) 1.00 (reference)
  T 85 (0.376) 306 (0.267) 159 (0.261) 1.66 (1.23–2.23)a 1.71 (1.24–2.37)a 1.67 (1.25–2.24)b 1.03 (0.83–1.29)
 Genotypes
  C/C 47 (0.416) 308 (0.538) 170 (0.557) 1.00 (reference) 1.00 (reference) 1.00 (reference) 1.00 (reference)
  C/T 47 (0.416) 224 (0.391) 111 (0.364) 1.38 (0.89–2.13) 1.53 (0.96–2.45) 1.43 (0.93–2.19) 1.11 (0.83–1.50)
  T/T 19 (0.168) 41 (0.072) 24 (0.079) 3.04 (1.63–5.67)b 2.86 (1.45–5.67)a 2.97 (1.64–5.38)b 0.94 (0.55–1.61)
Open in a new tab
a

P < 0.01. 

b

P < 0.001 (by Fisher’s exact test). 

Figure 3.

Figure 3

Open in a new tab

Distribution (%) of rs7903146 genotypes in Caucasian (top) and non-DR3/4 only (bottom). Genotypes in non-Hispanic Caucasians showed the same differential association of the T allele and T/T genotype of two sequence variants in the AbnDM group (odds ratio up to 4.10, comparing AbnDM vs. normal controls of rs7903146; P < 0.01) (top). The genotyping results for the cohort of subjects without HLA DR3/4 also showed that the T allele and T/T genotype in each SNP were statistically more frequent in the AbnDM group (odds ratio up to 3.64, comparing AbnDM vs. AbpDM for rs7903146; P < 0.001) (bottom). NC, Normal controls.

The T allele of rs7903146 was in strong linkage disequilibrium with T allele of rs12255372 [D (Linkage disequilibrium) = 0.21, r2 = 0.80 in AbnDM cohort; D = 0.23, r2 = 0.91 in Caucasian AbnDM cohort]. Because the two SNPs give the same information, results for SNP rs12255372 are shown in supplemental Figs. 1 and 2.

There were no statistically significant differences in genotype distribution between single antibody-positive patients vs. multiple antibody-positive patients (at least two positive antibodies) for either SNP; genotype distribution for rs7903146 was C/C 49 and 56%, C/T 43 and 37%, and T/T 8 and 7%, respectively.

We did not find an association of the TCF7L2 genotype with age of onset, initial and FU BMI z-scores, initial HbA1c, and initial and FU blood pressures (systolic and diastolic) in both the AbnDM and AbpDM cohorts. Of interest, there was a difference in the FU HbA1c level in the AbnDM cohort by TCF7L2 genotype. The subjects with T/T genotype of rs12255372 and/or T/T genotype of rs7903146 had a significantly lower FU HbA1c level (P < 0.05 in rs12255372; P < 0.01 in rs7903146). For rs7903146, T/T homozygotes had a mean HbA1c of 6.49% compared with 8.93% for C/T and 8.40% for C/C genotypes (Fig. 4). HbA1c levels at onset were not statistically different between these groups (supplemental Fig. 3). The antibody-positive cohort did not differ in FU HbA1c relative to TCF7L2 genotypes.

Figure 4.

Figure 4

Open in a new tab

FU HbA1c levels by genotypes for rs7903146. The subjects with T/T genotype of rs7903146 had significantly lower FU HbA1c levels (P < 0.01). For the rs7903146, T/T homozygotes had a mean HbA1c of 6.49% compared with 8.93% for C/T and 8.40% for C/C genotypes. In contrast, there was no difference in FU HbA1c levels by TCF7L2 genotypes in the antibody-positive cohort.

Discussion

Multiple groups are studying the genetic etiology of type 2 diabetes (18,19). Since the report that genetic variants within TCF7L2 on chromosome 10q are associated with the development of type 2 diabetes (1), there have been many replicative papers confirming that TCF7L2 is a major gene of type 2 diabetes in various ethnic groups (2,3,4,5,6,7,8).

We found that a significant percentage of children with diabetes were antiislet autoantibody negative at the time of disease onset, even among the very young. In older children a larger percentage of new onset children are islet autoantibody negative (20). We performed this case-control study in 893 newly diagnosed diabetic subjects and 305 normal controls using two TCF7L2 SNPs (rs12255372 and rs7903146) to evaluate whether TCF7L2 gene is associated with the development of islet autoantibody-negative diabetes in young patients compared with islet autoantibody-positive diabetes or normal controls. Our antiislet autoantibody assay cutoff points are each set at the 99th percentile for normal controls. With four assays, this would give a 4% false-positive rate among autoantibody-positive subjects. We studied all autoantibody-negative individuals with the presumption that this group is heterogeneous, including patients with childhood onset type 2 diabetes. This study showed that both previously defined type 2 diabetes-associated SNP variants (T allele of rs12255372 and rs7903146) in the TCF7L2 gene were associated with autoantibody-negative diabetes. In contrast, these alleles were not associated with autoantibody-positive diabetes. The odds ratio became higher when we analyzed only non-Hispanic Caucasian subjects. Although our study groups had significantly different ethnic background, the results were overall the same when we analyzed Caucasians separately. From these results we can confirm that polymorphisms of the TCF7L2 gene are strongly associated with the development of autoantibody-negative diabetes, even among children (with different diabetes etiologies and presumably enriched for type 2 diabetes), but are not associated with the immune-mediated islet autoantibody-positive diabetes (type 1A diabetes). To our knowledge, this is the first study to describe an association of TCF7L2 with autoantibody-negative diabetes in children. In a study of obese children by Körner et al. (21), three TCF7L2 risk alleles (rs7901695, rs7903146, and rs12255372) were associated with higher fasting and 120-min blood glucose levels. Another study in obese children by Roth et al. (22) showed an association of pancreatic β-cell function index (HOMA-B% index) with rs7903146 TT carriers, but no evidence of an association of this SNP with increased homeostasis model assessment of insulin resistance levels.

Initially, the TCF7L2 gene was thought to promote the development of diabetes through regulation of proglucagon gene expression in enteroendocrine cells via the Wnt signaling pathway (1,12), but recently there have been several reports suggesting other pathogenic mechanisms of TCF7L2 leading to glucose intolerance or type 2 diabetes such as reduced insulin secretion (5,23,24,25,26,27,28) or combined effects of insulin resistance and reduced insulin secretion (7,29) or impairment of β-cell proinsulin processing (30). We believe we will need larger numbers and formal metabolic evaluation to define insulin sensitivity, resistance, and stimulated insulin secretion to evaluate potential mechanisms.

Although our population with autoantibody-negative diabetes in young individuals is relatively small, we analyzed whether there are differences in age of onset, initial and FU BMI z-scores, initial and FU HbA1c, and initial and FU blood pressures (systolic and diastolic) in both the AbnDM and AbpDM cohorts by genotypes of each TCF7L2 SNP. In contrast to the report that the rs7903146 T at-risk allele is associated with decreased BMI and earlier age at diagnosis in the type 2 diabetic subjects (6), there was no effect of this genotype on age of onset, initial and FU BMI z-scores, initial HbA1c, and initial and FU blood pressures in both the AbnDM and the AbpDM cohort in this study. However, there was a difference in the FU HbA1c levels in the AbnDM cohort by genotype. The subjects with T/T genotype of rs12255372 and/or T/T genotype of rs7903146 had significantly lower FU HbA1c levels, implying that they are more responsive to current therapy. These HbA1c results should, however, be interpreted with caution because the number of subjects with T/T genotype is small and several phenotypes have been tested. Additional studies with longer FU will be required to confirm that the autoantibody-negative diabetes associated with the risk genotypes of TCF7L2 has a milder metabolic clinical course in young individuals.

Supplementary Material

[Supplemental Data]
jc.2007-2694_index.html (1.1KB, html)

Acknowledgments

We thank David Winter for measurement of ICAs.

Footnotes

This work was supported by grants from the National Institutes of Health (DK32083, DK32493, T32DK063687), the Diabetes Endocrine Research Center (P30 DK57516), the Immune Tolerance Network (NO1-AI-15416), the Autoimmunity Prevention Center (U19 AI050864), the American Diabetes Association, the Juvenile Diabetes Foundation, the Children’s Diabetes Foundation, and the Brehm coalition. This work was also supported by the Korea Research Foundation Grant funded by the Korean Government (MOEHRD) (KRF-2005-214-E00048).

Disclosure Statement: J.H. is an inventor on U.S. Patent Application Serial No. 60/882,815. All other authors have nothing to declare.

First Published Online December 2, 2008

Abbreviations: AbnDM, Antibody-negative diabetes mellitus; AbpDM, antibody-positive diabetes mellitus; BMI, body mass index; GAA, GAD autoantibody; GAD, glutamic acid decarboxylase; HbA1c, glycosylated hemoglobin; HLA, human leukocyte antigen; IAA, insulin autoantibody; ICA, cytoplasmic islet cell antibody; ICA512AA, ICA512 autoantibody; mIAA, micro-radiobinding IAA assay; SNP, single nucleotide polymorphism; TCF7L2, transcription factor 7-like 2.

References

  1. Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu A, Sainz J, Helgason A, Stefansson H, Emilsson V, Helgadottir A, Styrkarsdottir U, Magnusson KP, Walters GB, Palsdottir E, Jonsdottir T, Gudmundsdottir T, Gylfason A, Saemundsdottir J, Wilensky RL, Reilly MP, Rader DJ, Bagger Y, Christiansen C, Gudnason V, Sigurdsson G, Thorsteinsdottir U, Gulcher JR, Kong A, Stefansson K 2006 Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet 38:320–323 [DOI] [PubMed] [Google Scholar]
  2. Groves CJ, Zeggini E, Minton J, Frayling TM, Weedon MN, Rayner NW, Hitman GA, Walker M, Wiltshire S, Hattersley AT, McCarthy MI 2006 Association analysis of 6,736 U.K. subjects provides replication and confirms TCF7L2 as a type 2 diabetes susceptibility gene with a substantial effect on individual risk. Diabetes 55:2640–2644 [DOI] [PubMed] [Google Scholar]
  3. Zhang C, Qi L, Hunter DJ, Meigs JB, Manson JE, van Dam RM, Hu FB 2006 Variant of transcription factor 7-like 2 (TCF7L2) gene and the risk of type 2 diabetes in large cohorts of U.S. women and men. Diabetes 55:2645–2648 [DOI] [PubMed] [Google Scholar]
  4. Scott LJ, Bonnycastle LL, Willer CJ, Sprau AG, Jackson AU, Narisu N, Duren WL, Chines PS, Stringham HM, Erdos MR, Valle TT, Tuomilehto J, Bergman RN, Mohlke KL, Collins FS, Boehnke M 2006 Association of transcription factor 7-like 2 (TCF7L2) variants with type 2 diabetes in a Finnish sample. Diabetes 55:2649–2653 [DOI] [PubMed] [Google Scholar]
  5. Saxena R, Gianniny L, Burtt NP, Lyssenko V, Giuducci C, Sjögren M, Florez JC, Almgren P, Isomaa B, Orho-Melander M, Lindblad U, Daly MJ, Tuomi T, Hirschhorn JN, Ardlie KG, Groop LC, Altshuler D 2006 Common single nucleotide polymorphisms in TCF7L2 are reproducibly associated with type 2 diabetes and reduce the insulin response to glucose in nondiabetic individuals. Diabetes 55:2890–2895 [DOI] [PubMed] [Google Scholar]
  6. Cauchi S, Meyre D, Dina C, Choquet H, Samson C, Gallina S, Balkau B, Charpentier G, Pattou F, Stetsyuk V, Scharfmann R, Staels B, Frühbeck G, Froguel P 2006 Transcription factor TCF7L2 genetic study in the French population. Expression in human β-cells and adipose tissue and strong association with type 2 diabetes. Diabetes 55:2903–2908 [DOI] [PubMed] [Google Scholar]
  7. Chandak GR, Janipalli CS, Bhaskar S, Kulkarni SR, Mohankrishna P, Hattersley AT, Frayling TM, Yajnik CS 2007 Common variants in the TCF7L2 gene are strongly associated with type 2 diabetes mellitus in the Indian population. Diabetologia 50:63–67 [DOI] [PubMed] [Google Scholar]
  8. Kimber CH, Doney ASF, Pearson ER, McCarthy MI, Hattersley AT, Leese GP, Morris AD, Palmer CNA 2007 TCF7L2 in the Go-DARTS study: evidence for a gene dose effect on both diabetes susceptibility and control of glucose levels. Diabetologia 50:1186–1191 [DOI] [PubMed] [Google Scholar]
  9. Field SF, Howson JMM, Smyth DJ, Walker NM, Dunger DB, Todd JA 2007 Analysis of the type 2 diabetes gene, TCF7L2, in 13,795 type 1 diabetes cases and control subjects. Diabetologia 50:212–213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Qu HQ, Polychronakos C 2007 The TCF7L2 locus and type 1 diabetes. BMC Med Genet 8:51 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cauchi S, Vaxillaire M, Choquet H, Durand E, Duval A, Polak M, Froguel P 2007 No major contribution of TCF7L2 sequence variants to maturity onset of diabetes of the young (MODY) or neonatal diabetes mellitus in French white subjects. Diabetologia 50:214–216 [DOI] [PubMed] [Google Scholar]
  12. Yi F, Brubaker PL, Jin T 2005 TCF-4 mediates cell type-specific regulation of proglucagon gene expression by β-catenin and glycogen synthase kinase-3β. J Biol Chem 280:1457–1464 [DOI] [PubMed] [Google Scholar]
  13. Wenzlau JM, Juhl K, Yu L, Moua O, Sarkar SA, Gottlieb P, Rewers M, Eisenbarth GS, Jensen J, Davidson HW, Hutton JC 2007 The cation efflux transporter ZnT8 (Slc30A8) is a major autoantigen in human type 1 diabetes. Proc Natl Acad Sci USA 104:17040–17045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Yu L, Rewers M, Gianani R, Kawasaki E, Zhang Y, Verge C, Chase P, Klingensmith G, Erlich H, Norris J, Eisenbarth GS 1996 Antiislet autoantibodies usually develop sequentially rather than simultaneously. J Clin Endocrinol Metab 81:4264–4267 [DOI] [PubMed] [Google Scholar]
  15. Yu L, Robles D, Abiru N, Kaur P, Rewers M, Keleman K, Eisenbarth GS 2000 Early expression of antiinsulin autoantibodies of human and the NOD mouse: evidence for early determination of subsequent diabetes. Proc Natl Acad Sci USA 97:1701–1706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Schatz D, Krischer J, Horne G, Riley W, Spillar R, Silverstein J, Winter W, Muir A, Derovanesian D, Shah S, Malone J, Maclaren N 1994 Islet cell antibodies predict insulin-dependent diabetes in United States school age children as powerfully as in unaffected relatives. J Clin Invest 93:2403–2407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Krischer JP, Cuthbertson DD, Yu L, Orban T, MaClaren N, Jackson R, Winter WE, Schatz DA, Palmer JP, Eisenbarth GS, the Diabetes Prevention Trial-Type 1 Study Group 2003 Screening strategies for the identification of multiple antibody-positive relatives of individuals with type 1 diabetes. J Clin Endocrinol Metab 88:103–108 [DOI] [PubMed] [Google Scholar]
  18. Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, Erdos MR, Stringham HM, Chines PS, Jackson AU, Prokunina-Olsson L, Ding CJ, Swift AJ, Narisu N, Hu T, Pruim R, Xiao R, Li XY, Conneely KN, Riebow NL, Sprau AG, Tong M, White PP, Hetrick KN, Barnhart MW, Bark CW, Goldstein JL, Watkins L, Xiang F, Saramies J, Buchanan TA, Watanabe RM, Valle TT, Kinnunen L, Abecasis GR, Pugh EW, Doheny KF, Bergman RN, Tuomilehto J, Collins FS, Boehnke M 2007 A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316:1341–1345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Salonen JT, Uimari P, Aalto JM, Pirskanen M, Kaikkonen J, Todorova B, Hyppönen J, Korhonen VP, Asikainen J, Devine C, Tuomainen TP, Luedemann J, Nauck M, Kerner W, Stephens RH, New JP, Ollier WE, Gibson JM, Payton A, Horan MA, Pendleton N, Mahoney W, Meyre D, Delplanque J, Froguel P, Luzzatto O, Yakir B, Darvasia A 2007 Type 2 diabetes whole-genome association study in four populations: the DiaGen consortium. Am J Hum Genet 81:338–345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Wang J, Miao D, Babu S, Yu J, Barker J, Klingensmith G, Rewers M, Eisenbarth GS, Yu L 2007 Prevalence of autoantibody-negative diabetes is not rare at all ages and increases with older age and obesity. J Clin Endocrinol Metab 92:88–92 [DOI] [PubMed] [Google Scholar]
  21. Körner A, Berndt J, Stumvoll M, Kiess W, Kovacs P 2007 TCF7L2 gene polymorphisms confer an increased risk for early impairment of glucose metabolism and increased height in obese children. J Clin Endocrinol Metab 92:1956–1960 [DOI] [PubMed] [Google Scholar]
  22. Roth CL, Hinney A, Reinehr T, Schreiner F, Nguyen TT, Müller T, Scholl C, Woelfle J, Karpushova A, Schäfer H, Nöthen MM, Hebebrand J 2008 TCF7L2 polymorphism rs7903146 and predisposition for type 2 diabetes mellitus in obese children. Horm Metab Res 40:713–717 [DOI] [PubMed] [Google Scholar]
  23. Cauchi S, Meyre D, Choquet H, Dina H, Born C, Marre M, Balkau B, Froguel P, for the DESIR study group 2006 TCF7L2 variation predicts hyperglycemia incidence in a French general population. The data from an epidemiological study on the insulin resistance syndrome (DESIR) study. Diabetes 55:3189–3192 [DOI] [PubMed] [Google Scholar]
  24. Munoz J, Lok KH, Gower BA, Fernandez JR, Hunter GR, Lara-Castro C, Luca MD, Garvey AT 2006 Polymorphism in the transcription factor 7-like 2 (TCF7L2) gene is associated with reduced insulin secretion in nondiabetic women. Diabetes 55:3630–3634 [DOI] [PubMed] [Google Scholar]
  25. Raitakari OT, Rönnemaa T, Huupponen R, Viikari L, Fan M, Marniemi J, Hutri-Kähönen N, Viikari JSA, Lehtimäkimd T 2007 Variation of the transcription factor 7-like 2 (TCF7L2) gene predicts impaired fasting glucose in healthy young adults: the Cardiovascular Risk in Young Finns Study. Diabetes Care 30:2299–2301 [DOI] [PubMed] [Google Scholar]
  26. Florez JC, Jablonsk KA, Bayley N, Pollin TI, de Bakker PIW, Shuldiner AR, Knowler WC, Nathan DM, Altshuler D, for the Diabetes Prevention Program Research Group 2006 TCF7L2 polymorphisms and progression to diabetes in the diabetes prevention program. N Engl J Med 355:241–250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lyssenko V, Lupi R, Marchetti P, Guerra SD, Orho-Melander M, Almgren P, Sjögren M, Ling C, Eriksson KF, Lethagen ÅL, Mancarella R, Berglund G, Tuomi T, Nilsson P, Prato SD, Groop L 2007 Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest 117:2155–2163 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Schäfer SA, Tschritter O, Machicao F, Thamer C, Stefan N, Gallwitz B, Holst JJ, Dekker JM, t'Hart LM, Nijpels G, van Haeften TW, Häring HU, Fritsche A 2007 Impaired glucagon-like peptide-1-induced insulin secretion in carriers of transcription factor 7-like 2 (TCF7L2) gene polymorphisms. Diabetologia 50:2443–2450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Damcott CM, Pollin TI, Reinhart LJ, Ott SH, Shen H, Silver KD, Mitchell BD, Shuldiner AR 2006 Polymorphisms in the transcription factor 7-like 2 (TCF7L2) gene are associated with type 2 diabetes in the Amish. Replication and evidence for a role in both insulin secretion and insulin resistance. Diabetes 55:2654–2659 [DOI] [PubMed] [Google Scholar]
  30. Loos RJ, Franks PW, Francis RW, Barroso I, Gribble FM, Savage DB, Ong KK, O'Rahilly S, Wareham NJ 2007 TCF7L2 polymorphisms modulate proinsulin levels and β-cell function in a British Europid population. Diabetes 56:1943–1947 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental Data]
jc.2007-2694_index.html (1.1KB, html)
jc.2007-2694_1.pdf (11.1KB, pdf)
jc.2007-2694_2.pdf (12.1KB, pdf)
jc.2007-2694_3.pdf (51.5KB, pdf)
jc.2007-2694_4.pdf (65.9KB, pdf)

Articles from The Journal of Clinical Endocrinology and Metabolism are provided here courtesy of The Endocrine Society

RESOURCES