Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2008 Sep 25;150(2):803–811. doi: 10.1210/en.2008-0882

Developmental and Diurnal Dynamics of Pax4 Expression in the Mammalian Pineal Gland: Nocturnal Down-Regulation Is Mediated by Adrenergic-Cyclic Adenosine 3′,5′-Monophosphate Signaling

Martin F Rath 1, Michael J Bailey 1, Jong-So Kim 1, Anthony K Ho 1, Pascaline Gaildrat 1, Steven L Coon 1, Morten Møller 1, David C Klein 1
PMCID: PMC2646524  PMID: 18818287

Abstract

Pax4 is a homeobox gene that is known to be involved in embryonic development of the endocrine pancreas. In this tissue, Pax4 counters the effects of the related protein, Pax6. Pax6 is essential for development of the pineal gland. In this study we report that Pax4 is strongly expressed in the pineal gland and retina of the rat. Pineal Pax4 transcripts are low in the fetus and increase postnatally; Pax6 exhibits an inverse pattern of expression, being more strongly expressed in the fetus. In the adult the abundance of Pax4 mRNA exhibits a diurnal rhythm in the pineal gland with maximal levels occurring late during the light period. Sympathetic denervation of the pineal gland by superior cervical ganglionectomy prevents the nocturnal decrease in pineal Pax4 mRNA. At night the pineal gland is adrenergically stimulated by release of norepinephrine from the sympathetic innervation; here, we found that treatment with adrenergic agonists suppresses pineal Pax4 expression in vivo and in vitro. This suppression appears to be mediated by cAMP, a second messenger of norepinephrine in the pineal gland, based on the observation that treatment with a cAMP mimic reduces pineal Pax4 mRNA levels. These findings suggest that the nocturnal decrease in pineal Pax4 mRNA is controlled by the sympathetic neural pathway that controls pineal function acting via an adrenergic-cAMP mechanism. The daily changes in Pax4 expression may influence gene expression in the pineal gland.

The Pax4 homeobox gene is expressed in the postnatal pineal gland and exhibits a diurnal rhythm driven by adrenergic signaling, which suppresses nocturnal transcript levels.

The Pax gene family encodes transcription factors that play crucial roles in metazoan developmental patterning and cell differentiation (1). Among the nine mammalian members of the Pax family, the homeobox genes Pax4 and Pax6 are known to be involved in development of the endocrine pancreas. Pax6 is also known to play an essential role in development of the photodetector-derived neuroendocrine structure, the pineal gland (2,3); this role is in accord with the reported expression of Pax6 in the pineal gland during early developmental stages (4).

In the mouse embryo, Pax4 is expressed in pancreatic islets. Expression rapidly declines toward the end of gestation; Pax4 mRNA is undetectable or detectable at low levels in mature rodent islets (5,6,7,8,9). Pax4 is essential for development of β-cells and appears to direct pancreatic endocrine precursor cells toward the β-cell lineage (10); in contrast, Pax6 is involved in development of pancreatic α-cells from endocrine precursors (11). At the molecular level, Pax4 has been reported to act as a transcriptional repressor (5,12,13), which acts by binding the same cis-acting promoter sequences recognized by Pax6, thereby suppressing the expression of genes that are otherwise activated by Pax6, e.g. insulin and glucagon (5,14,15,16).

Although it is clear that Pax6 is expressed in the pineal gland and it plays a critical role in developmental biology of this tissue (2,3,4), knowledge of Pax4 expression in the pineal gland is not available. In view of this, we were especially interested in the results of preliminary microarray experiments, which indicated that Pax4 is expressed in the pineal gland (S. L. Coon, D. Carter, R. Baler, and D. C. Klein, unpublished observations). This finding when viewed in the context of the biology of Pax6 and the Pax4/Pax6 relationship discussed previously prompted us to study the expression of both Pax4 and Pax6 in the pineal gland. The results of these studies reveal unexpected features of the developmental and daily patterns of expression; of special interest is the finding that the Pax4 mRNA levels increase during the day, when the pineal gland is considered to be relatively inactive in terms of circadian gene expression in general and melatonin synthesis in particular.

Materials and Methods

Animals

For the developmental series presented in Figs. 2 and 3 and supplemental Fig. S2, which is published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org, Sprague Dawley rats were obtained from timed-pregnant mothers (Charles River, Sulzfeld, Germany); the animals were housed under a 12-h light, 12-h dark schedule and decapitated at zeitgeber time (ZT) 6. Brains and eyeballs were fixed by immersion in 4% paraformaldehyde in 0.1 m phosphate buffer (pH 7.4) and cryoprotected in 25% sucrose before freezing on crushed solid CO2.

Figure 2.

Figure 2

Open in a new tab

Ontogenetic expression of Pax4 and Pax6 in the rat pineal gland. Autoradiographs of radiochemical in situ hybridization for detection of Pax4 and Pax6 mRNA in median sections of the brain in a developmental series ranging from E16 to P30. The pineal gland is marked by an arrow. Autoradiographs of sections hybridized with sense control probes are provided in supplemental Fig. S2. Scale bar, 1 mm.

Figure 3.

Figure 3

Open in a new tab

Densitometric quantification of in situ hybridization autoradiographs of ontogenetic Pax4 and Pax6 gene expression in the pineal gland. In the earliest stages, a Pax4 signal above background was not observed (dotted line). Values on graphs represent the mean ± sem of three animals at each developmental stage examined. Differential expression levels during development were detected for Pax4 (one-way ANOVA, F5,12 = 11.4; P = 0.0003); Pax4 mRNA levels at P12 and P18 were significantly higher than that of earlier stages (Tukey’s multiple comparison test, P values <0.05). Differential expression levels were also detected for Pax6 (one-way ANOVA, F10,22 = 59.2; P < 0.0001); Pax6 mRNA levels at E17 and E18 were significantly higher than those of other stages (Tukey’s multiple comparison test, P values <0.05).

For the day-night radiochemical in situ hybridization experiments presented in Fig. 4, adult male Sprague Dawley rats (200–250 g; Charles River) were housed under a 12-h light, 12-h dark schedule. Bilateral superior cervical ganglionectomy (SCGx) was performed 10 d before euthanasia (17). Animals were decapitated at ZT6 and ZT18, and brains were removed immediately and frozen on crushed solid CO2. For the in vivo experiment with isoproterenol treatment presented in Fig. 6, adult male Sprague Dawley rats (250–300 g) were housed under a 12-h light, 12-h dark schedule and injected (ip) with isoproterenol (Sigma-Aldrich, Steinheim, Germany; 10 mg/kg in PBS) or PBS at ZT5; animals were decapitated (ZT8), and brains were immediately removed and frozen on crushed solid CO2.

Figure 4.

Figure 4

Open in a new tab

Quantitative radiochemical in situ hybridization analysis of a diurnal variation in expression of Pax4 in the pineal gland of the adult rat housed under a 12-h light, 12-h dark schedule. A, Autoradiograph of a median brain section from an animal killed at midday (ZT6). B, Autoradiograph of a median brain section from an animal killed at midnight (ZT18). C, Autoradiograph of a median brain section from a superior cervical ganglionectomized animal killed at midday (ZT6). D, Autoradiograph of a median brain section from a superior cervical ganglionectomized animal killed at midnight (ZT18). E, Densitometric quantification of Pax4 mRNA in the rat pineal gland. Values on the bar graph represent the mean ± sem of four to five animals in each experimental group. Two-way ANOVA analysis identified a significant effect of time of sampling (F1,14 = 23.0; P = 0.0003) as well as SCGx (F1,14 = 25.3; P = 0.0002). Pair-wise statistical comparison identified a significant day-night difference in pineal Pax4 transcript levels in intact rats (two-tailed Student’s t test, t5 = 16.4; P < 0.0001); differences in pineal Pax4 transcript levels among intact daytime rats and SCGx rats were not detected (one-way ANOVA, F2,10 = 1.2; P = 0.33). ***, P < 0.001. Scale bar, 1 mm.

Figure 6.

Figure 6

Open in a new tab

Quantitative radiochemical in situ hybridization analysis of the effect of ip isoproterenol injection on the expression of Pax4 in the pineal gland of the adult rat. A, Autoradiograph of a median brain section from a rat injected with PBS at ZT5 and killed at ZT8. B, Autoradiograph of a median brain section from a rat injected with isoproterenol (10 mg/kg) at ZT5 and killed at ZT8. C, Densitometric quantification of Pax4 mRNA in the rat pineal gland. Values on the bar graph represent the mean ± sem of three to five animals in each experimental group. A significant difference between animals injected with isoproterenol and control animals injected with PBS was identified (two-tailed Student’s t test, t4 = 5.7; P = 0.0047). **, P < 0.01. Scale bar, 1 mm.

For the in vivo quantitative real-time RT-PCR (qRT-PCR), Northern blot analyses, and RT-PCR analyses presented in Figs. 1 and 5 and supplemental Fig. S1, female Sprague Dawley rats (150–200 g; Taconic Farms, Germantown, NY) were housed under a 14-h light, 10-h dark schedule and killed by decapitation throughout the 24-h period at time points indicated in the figures and figure legends. Tissues were immediately frozen on crushed solid CO2 and stored at −80 C.

Figure 1.

Figure 1

Open in a new tab

Expression of Pax4 in the pineal gland and retina of the adult rat. A, Northern blot analysis of Pax4 expression in tissues removed from adult animals killed at ZT7. Arrows on the upper image indicate molecular weight markers. The lower image displays the same blot hybridized for detection of 18S rRNA. B, qRT-PCR analysis of Pax4 expression in the pineal gland, retina, and pancreatic islet of adult animals killed at ZT7. PCR products were subcloned and sequenced confirming the expression of Pax4 in all three tissues. Values on the bar graph represent the mean ± sem of four to six independent RNA preparations. Statistical comparison of Pax4 expression in the three tissues revealed a significant difference (one-way ANOVA, F2,13 = 11.8; P = 0.0012); pair-wise comparison revealed significantly lower Pax4 mRNA levels in pancreatic islets compared with the pineal gland (two-tailed Student’s t test, t5 = 4.4; P = 0.0071) and retina (two-tailed Student’s t test, t5 = 6.6; P = 0.0012). **, P < 0.01.

Figure 5.

Figure 5

Open in a new tab

Circadian expression of Pax4 in the pineal gland of the adult rat. A, qRT-PCR analysis of diurnal expression of Pax4, Aanat, and Pax6 in the pineal gland of the adult rat housed under a 14-h light, 10-h dark schedule. Nine animals were killed at each of six time points throughout the 24-h period. Values on graphs represent the mean ± sem of three different pools of three glands at each time point. Significant changes in mRNA levels during the 24-h period were detected for both Pax4 (one-way ANOVA, F5,12 = 18.5; P < 0.0001) and Aanat (one-way ANOVA, F5,12 = 17.8; P < 0.0001), but not in the case of Pax6 (one-way ANOVA, F5,12 = 2.4; P = 0.097). B, Northern blot analysis of Pax4 expression in the pineal gland of adult rats housed under a 14-h light, 10-h dark schedule. Four to five animals were killed at each time point (ZT7, ZT13, ZT19, and ZT23). Arrows on the upper image indicate molecular weight markers. The lower image displays the same blot hybridized for detection of Gapdh mRNA.

For isolation of pancreatic islets, the pancreas of adult male Sprague Dawley rats (200–250 g; Taconic Farms) was infused with cold Liberase RI Enzyme solution (20 mg/ml; Roche Diagnostics, Indianapolis, IN) and digested for 30 min at 37 C. Islets were purified by filtration (0.5 mm mesh) and centrifugation in Histopaque-1077 (Sigma-Aldrich Corp., St. Louis, MO); islets were microscopically identified, collected, frozen on crushed solid CO2, and stored at −80 C. For the organ culture and pinealocyte cell culture experiments presented in Fig. 7 and supplemental Fig. S3, respectively, pineal glands were obtained from adult female Sprague Dawley rats (150–200 g; Taconic Farms).

Figure 7.

Figure 7

Open in a new tab

qRT-PCR analysis of the effect of NE (1 μm) and DBcAMP (500 μm) in combination with actinomycin D (ActD) (30 μg/ml) and puromycin (Pur) (50 μg/ml) on the expression of Pax4 in cultured pineal glands. Values on the bar graph represent the mean ± sem of three different pools of glands in each experimental group. Two-way ANOVA analysis identified a significant effect of activation of the adrenergic system, e.g. NE and DBcAMP (F2,18 = 15.8; P = 0.0001), as well as blocking of gene product synthesis, e.g. actinomycin D and puromycin (F2,18 = 47.8; P < 0.0001); pair-wise comparison identified significant differences between the untreated control and the NE-treated glands (two-tailed Student’s t test, t4 = 6.1; P = 0.0036), and between the untreated control and the DBcAMP treated glands (two-tailed Student’s t test t4 = 6.7; P = 0.0026). Differences in levels of Pax4 mRNA were not detected among control glands and glands treated with actinomycin D or puromycin (one-way ANOVA, F6,14 = 1.0; P = 0.46). **, P < 0.01.

All experiments with animals were performed in accordance with the guidelines of EU Directive 86/609/EEC (approved by the Danish Council for Animal Experiments), the National Institutes of Health Guide for Care and Use of Laboratory Animals (approved by the Governing Board of the National Research Council), and the Canadian Council on Animal Care Guidelines (approved by the Health Sciences Animal Policy and Welfare Committee of the University of Alberta).

Organ culture

Pineal glands were cultured as previously described (18,19). After 48 h incubation (37 C, 95% O2, 5%CO2), the glands were transferred to a top-loading tabletop incubator. The glands were incubated for 1 h under control conditions or in medium containing 30 μg/ml actinomycin D or 50 μg/ml puromycin; this was followed by incubation for 12 h under control conditions or in medium containing 1 μm norepinephrine (NE) or 500 μm dibutyryl cAMP (DBcAMP). After treatment, glands were placed on crushed solid CO2 and stored at −80 C.

Adenoviral transduction of pinealocytes

The procedures for culturing of pinealocytes, adenoviral transduction of constructs encoding short hairpin RNAs or full-length transcripts of inducible cAMP early repressor (Icer) and Fos-related antigen 2 (Fra2), and qRT-PCR evaluation presented in the supplemental data, were performed as previously described (20,21).

Radiochemical in situ hybridization

Cryostat sections (12 μm, adult; 14 μm, developmental series) were hybridized with 38-mer [35S]deoxy-ATP-labeled DNA probes as previously described (17,22). For hybridization, the following probes were used: 5′-TCCAATCAGATGATGCACAGGATGGGTGGTGAGGCAGG-3′, antisense, position 1053-1016 on rat Pax4 mRNA (NM_031799); 5′-CCTGCCTCACCACCCATCCTGTGCATCATCTGATTGGA-3′, sense control, position 1016-1053 on rat Pax4 mRNA (NM_031799); 5′-GCATCCTTAGTTTATCATACATGCCGTCTGCGCCCATC-3′, antisense, position 605-568 on rat Pax6 mRNA (NM_013001.2); and 5′-GATGGGCGCAGACGGCATGTATGATAAACTAAGGATGC-3′, sense control, position 568-605 on rat Pax6 mRNA (NM_013001.2).

After hybridization and washing, the sections were exposed to an x-ray film for 2 wk. Images on the x-ray film were transferred to a computer and quantified (Image 1.42; Wayne Rasband, National Institutes of Health, Bethesda, MD). ODs from at least four random sections from each animal were converted to dpm/mg tissue using simultaneously exposed 14C-standards calibrated by comparison with 35S-tissue paste standards.

qRT-PCR

Total RNA was isolated using a RiboPure RNA isolation kit (Ambion, Inc., Austin, TX) or TRIzol reagent (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s instructions. Total RNA was then subject to deoxyribonuclease treatment using TURBO DNA-free (Ambion) to remove contaminating genomic DNA. cDNA production was performed following the Superscript protocol (Invitrogen) using 1 μg deoxyribonuclease treated total RNA as starting material. Experiments were performed using a LightCycler 2.0 or a LightCycler 480 (Roche Diagnostics). Reactions (25 μl volume) contained 0.5 μm primers, Real-Time SYBR Green master mix (SuperArray Bioscience, Frederick, MD) and cDNA according to the manufacturer’s instructions. Primer sequences are given in Table 1. Assays included an initial denaturation step at 95 C for 10 min, proceeded by 40 cycles of a 95 C denaturation for 15 sec, 30 sec annealing at 63 C, then extension at 72 C for 30 sec. Product specificity was confirmed in initial experiments by agarose gel electrophoresis of the amplified products and thereafter during every qRT-PCR run by melting curve analysis (Tm). Less than 30 cycles were necessary to detect amplification. Transcript number was determined using internal standards; these were prepared by cloning the Pax4, Pax6, arylalkylamine N-acetyltransferase (Aanat), glyceraldehyde 3-phosphate dehydrogenase (Gapdh), and cyclophilin target PCR products into pGEM-T Easy vectors (Promega Corp., Madison, WI). Clone verification was performed by direct sequence analysis. For each experiment a set of 100-fold serial dilutions of each internal standard (101–107 copies/1 μl) was prepared and used to generate standard curves. Transcript number was determined using a 2-μl sample of a 10-fold dilution of cDNA prepared as mentioned previously.

Table 1.

Primer sequences for qRT-PCR and Northern blot analyses

Transcript Gene accession no. Position Forward primer 5′-3′ Reverse primer 5′-3′ Analytical technique
Pax4 NM_031799 913–984 AGATGTTCCAGTGACACCACA CACAGGAAGGAGGGAGTGG qRT-PCR
Aanat U38306 525–682 TGCTGTGGCGATACCTTCACCA CAGCTCAGTGAAGGTGAGAGAT qRT-PCR
Pax6 U69644 217–308 AACAGCGACGAAAGAGAGGA CACTCTTTGAATAGAAGATCTCACACA qRT-PCR
Cyclophilin BC091153 359–426 TCTGCACTGCCAAGACTGAG CATGCCTTCTTTCACCTTCC qRT-PCR
Gapdh BC059110 78–387 TGGTGAAGGTCGGTGTGAACGGAT TCCATGGTGGTGAAGACGCCAGTA qRT-PCR/Northern blot
Pax4 NM_031799 1–436 CTTGCCAGTTGGCTTTCTGT CCCGAAGGACTCGATTGATA Northern blot
18S rRNA X01117 474–1070 CAGCAGGCGCGCAAATTACCCAC ACGGTATCTGATCGTCTTCGAACC Northern blot
Open in a new tab

Northern blot analysis

Total RNA was prepared from frozen tissues using TRIzol. A total of 8 μg total RNA was loaded per lane in a 1% agarose/0.7 m formaldehyde gel and separated by electrophoresis in a 1 × 3[N-morholino]propanesulfonic acid (50 mm) buffer (Quality Biological, Gaithersburg, MD). Membrane transfer was performed in 20× saline-sodium citrate transfer buffer by use of the Turboblotter system (Schleicher & Schuell, Keene, NH). Probe sequences were cloned into pGEM-T Easy vectors, and clone verification was performed by direct sequence analysis. DNA probes were generated by PCR (primer sequences are given in Table 1) using the sequenced plasmids as template and labeled with 32P by random priming (Amersham Biosciences Inc., Piscataway, NJ). Hybridization, imaging, and stripping of blots were performed as previously described (22,23). Transcript sizes were determined by comparison with standard RNA markers (Invitrogen).

RT-PCR analysis

RT-PCR analysis for differentiation of Pax4 mRNA isoforms was performed by modification of a published method (24). Herculase II Fusion DNA Polymerase (Stratagene, La Jolla, CA) was used for PCR according to the manufacturer’s recommendations; pineal and retinal cDNA was prepared as described previously, and primer sequences are given in supplemental Table S1, which is published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo. endojournals.org. The PCR included 32 cycles of denaturation at 98 C for 30 sec, annealing at 62 C for 30 sec, and extension at 72 C for 45 sec. PCR products were subjected to electrophoresis in an ethidium bromide-stained 1.5% agarose gel. Product sizes were determined by comparison with a standard DNA ladder (Invitrogen).

Statistical analysis

A two-tailed Student’s t test, one-way ANOVA, two-way ANOVA, or Tukey’s multiple comparison test was used for comparing means of in situ hybridization signals (dpm/mg tissues) or the copy numbers obtained by qRT-PCR. A P value of less than 0.05 was considered to represent a statistically significant difference; for each analysis the obtained level of significance is indicated.

Results

Pax4 is highly expressed in the pineal gland and retina

Examination of Pax4 expression in the adult rat by Northern blot revealed the presence of a tissue-specific band corresponding to a transcript of approximately 1.3 kb in the pineal gland and retina (Fig. 1A); this transcript size corresponds to the full-length rat Pax4 mRNA referred to as Pax4a (24). PCR analysis revealed the presence of both Pax4a and the shorter Pax4c transcript in the pineal gland, whereas the Pax4b and Pax4d isoforms were not detected (supplemental Fig. S1). Northern blot analysis was done with a probe that should theoretically detect all four isoforms; this did not reveal any truncated isoforms indicating that Pax4a is the major isoform expressed in this tissue.

As indicated previously, Pax4 is expressed in the pancreatic islets of the adult rat (7,8,24). Here, we found that the abundance of Pax4 mRNA in pancreatic islets was more than 20-fold lower than that in the pineal gland (P < 0.01, two-tailed Student’s t test) and retina (P < 0.01, two-tailed Student’s t test; Fig. 1B).

Expression of Pax4 in the developing pineal gland

The ontogenetic expression of Pax4 in the pineal gland was investigated using radiochemical in situ hybridization; sagittal brain sections of animals ranging from embryonic d (E) 16 to postnatal d (P) 30 were studied (Fig. 2).

At E16 the pineal gland is identified as a dorsal evagination of the most caudal part of the diencephalic roof; however, at this stage a Pax4 hybridization signal was not present in the pineal gland or in any other areas of the brain. A signal was first detected at E21 in the epithalamic area, and prominent pineal expression of Pax4 was detected thereafter. The signal was seen in all parts of the gland except in small areas likely to be perivascular spaces.

Densitometric quantification of Pax4 mRNA in the pineal gland revealed an expression pattern changing during development (P < 0.001, one-way ANOVA); a low transcript level at E21 was followed by a peak during the second and third postnatal week (P < 0.05, Tukey’s test; Fig. 3), and an intermediate level at P30.

Expression of Pax6 in the developing pineal gland

Pax6 is known to be expressed in the mouse pineal gland (4). Here, we compared the developmental expression patterns of Pax6 to those of Pax4 in the pineal gland of the rat. A prominent signal was seen at E16 in the pineal recess, pretectal area, ventral thalamus, and neocortex; this pattern persisted during prenatal stages (Fig. 2). From E20, Pax6 transcripts were detected in the cerebellum. During late embryonic and postnatal development, the thalamic and neocortical signal declined and were absent in the adult; however, Pax6 mRNA was still detected in the pineal gland and in the granular layer of the cerebellum, but at a low level.

Densitometric quantification of Pax6 expression in the developing pineal gland revealed a changing temporal expression pattern (P < 0.001, one-way ANOVA; Fig 3). Maximal levels of Pax6 mRNA were detected in the prenatal pineal at E17 and E18 (P < 0.05, Tukey’s test); this was followed by a rapid decline just before birth. In the postnatal animal, low but sustained Pax6 expression was detected. Accordingly, the expression pattern of Pax6 in pineal gland exhibits an inverse temporal relationship to that of Pax4.

Diurnal expression of Pax4 in the adult pineal gland

The known day/night rhythmic nature of the expression of many genes in the pineal gland prompted us to investigate if Pax4 expression exhibits a 24-h rhythm in this tissue. In situ hybridization revealed a highly specific diurnal expression of Pax4 in the pineal gland with highest levels of mRNA during the daytime (Fig. 4, A and B). Densitometric quantification of pineal Pax4 mRNA revealed a significant day-night difference (P < 0.001, two-tailed Student’s t test; Fig. 4E) with a day to night ratio of 3.6 ± 0.2.

The daily expression pattern of Pax4 in the pineal gland was examined in detail using qRT-PCR; this revealed significant diurnal differences in Pax4 mRNA levels (one-way ANOVA, P < 0.001; Fig. 5A). An increase in Pax4 mRNA levels occurred during the light period, whereas expression declined gradually during the dark period. For comparison we measured the levels of Aanat mRNA, the abundance of which increases at night in pineal gland more than 100-fold (25,26). Aanat transcripts encode the enzyme that controls the daily rhythm in melatonin production (27). The results clearly indicate that diurnal expression patterns of Pax4 and Aanat are out of phase (Fig. 5A). In contrast, daily changes in the abundance of pineal Pax6 mRNA were not detected (P > 0.05, one-way ANOVA). Using Northern blotting, we confirmed that the daily rhythm in Pax4 mRNA reflected daily changes in the approximate 1.3-kb Pax4 transcript with low values late during the dark period (Fig. 5B).

Adrenergic regulation of Pax4 in the pineal gland

Daily rhythms in mammalian pineal function, including the daily rhythm in melatonin synthesis, are known to be controlled neurally by a pathway that includes the superior cervical ganglia (28,29,30). To determine whether the 24-h rhythm in expression of pineal Pax4 is controlled by this pathway, the superior cervical ganglia were removed (SCGx). This abolished the detected day-night rhythm in pineal Pax4 expression (two-way ANOVA, P < 0.001; Fig. 4E); the pineal Pax4 transcript levels did not differ from daytime levels in control animals (one-way ANOVA, P > 0.05; Fig. 4, C–E).

The sustained high levels of Pax4 mRNA observed in denervated pineal glands suggest that the rhythm in pineal Pax4 expression may be adrenergically regulated by the release of NE from sympathetic nerve terminals in the gland. To investigate this, rats were treated with the β-adrenergic agonist isoproterenol during the day. This significantly suppressed pineal Pax4 mRNA within 3 h to 20% the levels in control animals (P < 0.01, two-tailed Student’s t test; Fig. 6). Similarly, treatment of cultured pineal glands with NE produced a significant suppression of Pax4 mRNA (P < 0.01, two-tailed Student’s t test; Fig. 7). NE is known to elevate pineal cAMP (31), which appears to mediate many effects of NE on gene expression. Here, we found that treatment with the cAMP mimic DBcAMP also significantly reduced Pax4 mRNA (P < 0.01, two-tailed Student’s t test; Fig. 7).

To determine whether suppression of Pax4 mRNA levels by NE and DBcAMP requires mRNA and protein synthesis, the effects of actinomycin D and puromycin were investigated. These drugs significantly influenced the response of the cultured pineal glands (P < 0.001, two-way ANOVA); the level of Pax4 mRNA in glands treated with actinomycin D or puromycin and NE or DBcAMP in combination did not differ significantly from that of control glands (P > 0.05, one-way ANOVA; Fig. 7). The results indicate that both de novo mRNA and protein synthesis appear to be required for the adrenergic-cAMP suppression of pineal Pax4 transcript levels.

The finding that de novo protein synthesis is required for the inhibitory effects of NE on Pax4 expression pointed to the possibility that synthesis of an immediate early gene product was required for this to occur. Two candidates for the role of such a hypothetical inhibitory transcription factor are Icer and Fra2, which are both expressed at night in the pineal gland in response to adrenergic signaling (32,33,34). However, elevation or suppression of the transcript levels of Icer or Fra2 by adenoviral transduction of pinealocytes (20,21) had no effect on the NE-induced suppression of Pax4 transcript levels (supplemental Fig. S3).

Discussion

The finding of high expression of Pax4 in the pineal gland parenchyma of the postnatal rat provides the first body of evidence that this gene plays a role in the biology of this tissue. The finding that Pax4 is not strongly expressed in the fetal pineal gland argues against a role in development and cell fate determination, in contrast to Pax6. Rather, it would appear that Pax4 is more likely to play a role in regulating gene expression in the mature pinealocyte. This view is supported by the observation that the developmental appearance of Pax4 mRNA is coincident with that of genes required for core pineal functions (35,36,37,38,39).

The developmental pattern of Pax4 expression in the pineal gland is in marked contrast to that in the pancreas, in which the gene is strongly expressed early in development and then declines toward the end of gestation (5,6,10). Accordingly, it appears that whereas Pax4 has a developmental role in the pancreas in cell fate determination, this may not be the case in the pineal gland, where, as discussed previously, it may have a regulatory role in the differentiated pinealocyte.

In the adult pineal gland, Pax4 expression exhibits a marked diurnal rhythm with high transcript levels during the daytime. This suggests to us that it may play a role in modulating circadian gene expression. A striking feature of the rhythmic expression of Pax4 in the pineal gland is that it is unlike that of the majority of cycling genes in the pineal gland, which exhibit a zenith during the night and a nadir during the day. In view of the evidence that Pax4 is known to act as a transcriptional repressor (5), it is possible that changes in Pax4 mRNA are translated immediately into changes in Pax4 protein and that it plays a suppressive role in controlling daily changes in gene expression in the mature pineal gland. It is also possible that Pax4 protein exhibits slower changes that integrate preceding patterns of Pax4 expression. However, efforts to address this are currently frustrated by the unavailability of useful reagents to detect Pax4 protein.

The marked difference in the expression patterns of Pax4 and Pax6 strengthens the view that these transcription factors have different roles. A developmental role for Pax6 is indicated by the developmental pattern of expression described here, and by the results of studies indicating that Pax6 maintains multipotency of retinal progenitor cells (40) and that the pineal gland fails to develop in Pax6-deficient animals (2). As indicated in the introductory section, Pax4 is known to suppress Pax6 trans-activating functions in pancreatic gene expression (5,12,13,14,15). Because Pax4 was also found to be expressed in the retina of the adult, we speculate that Pax4 might counteract the actions of Pax6 in the postnatal retina and pineal gland to ensure maintenance of the fully differentiated phenotype. However, this does not exclude the possibility that Pax4 acts independently of Pax6 to modify gene expression. Unlike Pax4, the nonrhythmic nature of Pax6 leaves little reason to suspect that Pax6 is directly involved in regulation of circadian biology.

The transcriptomes of the retinal photoreceptor cell and the pinealocyte are similar in that they include transcripts dedicated to photodetection and melatonin synthesis. This reflects a common evolutionary origin of these cell types from a common ancestral photodetector (41,42). Both tissues express the same homeobox genes, including Otx2 and Crx (22,43,44,45). Although these are thought to have a primary role in regulation of developmental processes, Otx2 and Crx are also expressed in the adult (22,43), suggesting that they have a second role in maintaining phenotype. In this light the Pax4 findings provide additional support for the view that homeobox genes in general may not be exclusively dedicated to developmental events and may be essential for normal function in the mature cell.

The rhythmic expression of Pax4 in the pineal gland appears to be regulated by the sympathetic nervous system because removal of the superior cervical ganglia eliminated the rhythm in the pineal gland. Circadian information is transmitted from the endogenous circadian clock of the suprachiasmatic nucleus to the pineal gland via a multisynaptic neural pathway projecting through the superior cervical ganglia (29,30); the daily rhythm in pineal Pax4 mRNA is likely to be driven by the output of the suprachiasmatic nucleus. Daily oscillations in Aanat transcript levels and enzyme activity are known to be controlled by nocturnal release of NE from sympathetic nerve endings in the gland acting through an adrenergic/cAMP system (26,27,46,47,48). The findings of this report are consistent with the conclusion that the day-night rhythm in pineal Pax4 mRNA is also controlled by an adrenergic/cAMP mechanism.

The evidence that the inverse diurnal expression of Pax4 in the pineal gland is driven by down-regulation in response to nocturnal adrenergic stimulation is in marked contrast to numerous previous reports showing that the expression of several genes in the pineal gland peaks in the middle of the night with nocturnal expression being activated by adrenergic stimulation of the gland (19,26,32,33,49,50,51,52). Adrenergic repression of pineal gene expression has only been reported in the case of heparan sulfate 3-O-sulfotransferase 2 (53); the intracellular controlling mechanisms involved have not been resolved.

Our finding here that pineal Pax4 transcript levels are not decreased after inhibition of transcription suggests that a posttranscriptional regulatory mechanism is involved in the dynamic oscillations in pineal Pax4 expression. However, because de novo synthesis of gene products is essential for the suppressing effect of adrenergic stimulation, transcriptional induction of one or more factors seems to be involved in regulation of Pax4 mRNA levels, perhaps by inducing nocturnal degradation of the transcript. Notably, posttranscriptional regulation of pineal Aanat mRNA may involve daily oscillations in RNA-destabilizing ribonucleoproteins (54).

The advances presented in this report provide reason to pursue the biology of Pax4 in the pineal gland, including the molecular mechanisms involved in regulation of developmental and diurnal expression, and the role Pax4 plays in controlling expression of other genes in this tissue.

Supplementary Material

[Supplemental Data]
en.2008-0882_index.html (1.7KB, html)

Acknowledgments

We thank Mrs. Ursula Rentzmann for expert histological assistance.

Footnotes

This study was supported by the Lundbeck Foundation, Danish Medical Research Council (Grants 271-07-0412 and 271-06-0754), Novo Nordisk Foundation, Carlsberg Foundation, and Division of Intramural Research of the Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health.

Disclosure Statement: The authors have nothing to disclose.

First Published Online September 25, 2008

Abbreviations: Aanat, Arylalkylamine N-acetyltransferase; DBcAMP, dibutyryl cAMP; E, embryonic d; Fra2, Fos-related antigen 2; Gapdh, glyceraldehyde 3-phosphate dehydrogenase; Icer, inducible cAMP early repressor; NE, norepinephrine; P, postnatal d; qRT-PCR, quantitative real-time RT-PCR; SCGx, superior cervical ganglionectomy; ZT, zeitgeber time.

References

  1. Chi N, Epstein JA 2002 Getting your Pax straight: Pax proteins in development and disease. Trends Genet 18:41–47 [DOI] [PubMed] [Google Scholar]
  2. Estivill-Torrús G, Vitalis T, Fernández-Llebrez P, Price DJ 2001 The transcription factor Pax6 is required for development of the diencephalic dorsal midline secretory radial glia that form the subcommissural organ. Mech Dev 109:215–224 [DOI] [PubMed] [Google Scholar]
  3. Gehring WJ 2005 New perspectives on eye development and the evolution of eyes and photoreceptors. J Hered 96:171–184 [DOI] [PubMed] [Google Scholar]
  4. Walther C, Gruss P 1991 Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113:1435–1449 [DOI] [PubMed] [Google Scholar]
  5. Smith SB, Ee HC, Conners JR, German M 1999 Paired-homeodomain transcription factor PAX4 acts as a transcriptional repressor in early pancreatic development. Mol Cell Biol 19:8272–8280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Wang J, Elghazi L, Parker SE, Kizilocak H, Asano M, Sussel L, Sosa-Pineda B 2004 The concerted activities of Pax4 and Nkx2.2 are essential to initiate pancreatic β-cell differentiation. Dev Biol 266:178–189 [DOI] [PubMed] [Google Scholar]
  7. Brun T, Franklin I, St-Onge L, Biason-Lauber A, Schoenle E, Wollheim CB, Gauthier BR 2004 The diabetes-linked transcription factor Pax4 promotes β-cell proliferation and survival in rat and human islets. J Cell Biol 167:1123–1135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Brun T, Duhamel DL, Hu He KH, Wollheim CB, Gauthier BR 2007 The transcription factor PAX4 acts as a survival gene in INS-1E insulinoma cells. Oncogene 26:4261–4271 [DOI] [PubMed] [Google Scholar]
  9. Brun T, Gauthier BR 2008 A focus on the role of Pax4 in mature pancreatic islet β-cell expansion and survival in health and disease. J Mol Endocrinol 40:37–45 [DOI] [PubMed] [Google Scholar]
  10. Sosa-Pineda B, Chowdhury K, Torres M, Oliver G, Gruss P 1997 The Pax4 gene is essential for differentiation of insulin-producing β-cells in the mammalian pancreas. Nature 386:399–402 [DOI] [PubMed] [Google Scholar]
  11. St-Onge L, Sosa-Pineda B, Chowdhury K, Mansouri A, Gruss P 1997 Pax6 is required for differentiation of glucagon-producing α-cells in mouse pancreas. Nature 387:406–409 [DOI] [PubMed] [Google Scholar]
  12. Fujitani Y, Kajimoto Y, Yasuda T, Matsuoka TA, Kaneto H, Umayahara Y, Fujita N, Watada H, Miyazaki JI, Yamasaki Y, Hori M 1999 Identification of a portable repression domain and an E1A-responsive activation domain in Pax4: a possible role of Pax4 as a transcriptional repressor in the pancreas. Mol Cell Biol 19:8281–8291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kalousová A, Benes V, Paces J, Kozmik Z 1999 DNA binding and transactivating properties of the paired and homeodomain protein Pax4. Biochem Biophys Res Commun 259:510–518 [DOI] [PubMed] [Google Scholar]
  14. Campbell SC, Cragg H, Elrick LJ, Macfarlane WM, Shennan KI, Docherty K 1999 Inhibitory effect of Pax4 on the human insulin and islet amyloid polypeptide (IAPP) promoters. FEBS Lett 463:53–57 [DOI] [PubMed] [Google Scholar]
  15. Petersen HV, Jørgensen MC, Andersen FG, Jensen J, Nielsen TF, Jørgensen R, Madsen OD, Serup P 2000 Pax4 represses pancreatic glucagon gene expression. Mol Cell Biol Res Commmun 3:249–254 [DOI] [PubMed] [Google Scholar]
  16. Ritz-Laser B, Estreicher A, Gauthier BR, Mamin A, Edlund H, Philippe J 2002 The pancreatic β-cell-specific transcription factor Pax-4 inhibits glucagon gene expression through Pax-6. Diabetologia 45:97–107 [DOI] [PubMed] [Google Scholar]
  17. Møller M, Phansuwan-Pujito P, Morgan KC, Badiu C 1997 Localization and diurnal expression of mRNA encoding the β1-adrenoceptor in the rat pineal gland: an in situ hybridization study. Cell Tissue Res 288:279–284 [DOI] [PubMed] [Google Scholar]
  18. Klein DC, Weller JL 1970 Input and output signals in a model neural system: the regulation of melatonin production in the pineal gland. In Vitro 6:197–204 [DOI] [PubMed] [Google Scholar]
  19. Kim JS, Coon SL, Blackshaw S, Cepko CL, Møller M, Mukda S, Zhao WG, Charlton CG, Klein DC 2005 Methionine adenosyltransferase (MAT): adrenergic-cyclic AMP mechanism mediates control of a daily rhythm in pineal expression. J Biol Chem 280:677–684 [DOI] [PubMed] [Google Scholar]
  20. Ho AK, Terriff DL, Price DM, Wloka MT, Chik CL 2007 The role of inducible repressor proteins in the adrenergic induction of arylalkylamine-N-acetyltransferase and mitogen-activated protein kinase phosphatase-1 in rat pinealocytes. Endocrinology 148:743–751 [DOI] [PubMed] [Google Scholar]
  21. Chik CL, Wloka MT, Price DM, Ho AK 2007 The role of repressor proteins in the adrenergic induction of type II iodothyronine deiodinase in rat pinealocytes. Endocrinology 148:3523–3531 [DOI] [PubMed] [Google Scholar]
  22. Rath MF, Muñoz E, Ganguly S, Morin F, Shi Q, Klein DC, Møller M 2006 Expression of the Otx2 homeobox gene in the developing mammalian brain: embryonic and adult expression in the pineal gland. J Neurochem 97:556–566 [DOI] [PubMed] [Google Scholar]
  23. Muñoz EM, Bailey MJ, Rath MF, Shi Q, Morin F, Coon SL, Møller M, Klein DC 2007 NeuroD1: developmental expression and regulated genes in the rodent pineal gland. J Neurochem 102:887–899 [DOI] [PubMed] [Google Scholar]
  24. Tokuyama Y, Yagui K, Sakurai K, Hashimoto N, Saito Y, Kanatsuka A 1998 Molecular cloning of rat Pax4: identification of four isoforms in rat insulinoma cells. Biochem Biophys Res Commun 248:153–156 [DOI] [PubMed] [Google Scholar]
  25. Coon SL, Roseboom PH, Baler R, Weller JL, Namboodiri MA, Koonin EV, Klein DC 1995 Pineal serotonin N-acetyltransferase: expression cloning and molecular analysis. Science 270:1681–1683 [DOI] [PubMed] [Google Scholar]
  26. Roseboom PH, Coon SL, Baler R, McCune SK, Weller JL, Klein DC 1996 Melatonin synthesis: analysis of the more than 150-fold nocturnal increase in serotonin N-acetyltransferase messenger ribonucleic acid in the rat pineal gland. Endocrinology 137:3033–3044 [DOI] [PubMed] [Google Scholar]
  27. Klein DC 2007 Arylalkylamine N-acetyltransferase: “the Timezyme.” J Biol Chem 282:4233–4237 [DOI] [PubMed] [Google Scholar]
  28. Klein DC, Weller JL, Moore RY 1971 Melatonin metabolism: neural regulation of pineal serotonin:acetyl coenzyme A N-acetyltransferase activity. Proc Natl Acad Sci USA 68:3107–3110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Klein DC 1985 Photoneural regulation of the mammalian pineal gland. Ciba Found Symp 117:38–56 [DOI] [PubMed] [Google Scholar]
  30. Møller M, Baeres FMM 2002 The anatomy and innervation of the mammalian pineal gland. Cell Tissue Res 309:139–150 [DOI] [PubMed] [Google Scholar]
  31. Strada SJ, Klein DC, Weller J, Weiss B 1972 Effect of norepinephrine on the concentration of adenosine 3′,5′-monophosphate of rat pineal gland in organ culture. Endocrinology 90:1470–1475 [DOI] [PubMed] [Google Scholar]
  32. Stehle JH, Foulkes NS, Molina CA, Simonneaux V, Pévet P, Sarssone-Corsi P 1993 Adrenergic signals direct rhythmic expression of transcriptional repressor CREM in the pineal gland. Nature 365:314–320 [DOI] [PubMed] [Google Scholar]
  33. Baler R, Klein DC 1995 Circadian expression of transcription factor Fra-2 in the rat pineal gland. J Biol Chem 270:27319–27325 [DOI] [PubMed] [Google Scholar]
  34. Smith M, Burke Z, Humphries A, Wells T, Klein DC, Carter D, Baler R 2001 Tissue-specific transgenic knockdown of Fos-related antigen 2 (Fra-2) expression mediated by dominant negative Fra-2. Mol Cell Biol 21:3704–3713 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Klein DC, Namboodiri MA, Auerbach DA 1981 The melatonin rhythm generating system: developmental aspects. Life Sci 28:1975–1986 [DOI] [PubMed] [Google Scholar]
  36. Sugden D, Klein DC 1983 Regulation of rat pineal hydroxyindole-O-methyltransferase in neonatal and adult rats. J Neurochem 40:1647–1653 [DOI] [PubMed] [Google Scholar]
  37. Babila T, Schaad NC, Simonds WF, Shinohara T, Klein DC 1992 Development of MEKA (phosducin), Gβ, Gγ and S-antigen in the rat pineal gland and retina. Brain Res 585:141–148 [DOI] [PubMed] [Google Scholar]
  38. Blackshaw S, Snyder SH 1997 Developmental expression pattern of phototransduction components in mammalian pineal implies a light-sensing function. J Neurosci 17:8074–8082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pfeffer M, Stehle JH 1998 Ontogeny of a diurnal rhythm in arylalkylamine N-acetyltransferase mRNA in rat pineal gland. Neurosci Lett 248:163–168 [DOI] [PubMed] [Google Scholar]
  40. Marquardt T, Ashery-Padan R, Andrejewski N, Scardigli R, Guillemot F, Gruss P 2001 Pax6 is required for the multipotent state of retinal progenitor cells. Cell 105:43–55 [DOI] [PubMed] [Google Scholar]
  41. Klein DC 2004 The 2004 Aschoff/Pittendrigh lecture: theory of the origin of the pineal gland—a tale of conflict and resolution. J Biol Rhythms 19:264–279 [DOI] [PubMed] [Google Scholar]
  42. O'Brien PJ, Klein DC 1986 Pineal and retinal relationships. Orlando, FL: Academic Press [Google Scholar]
  43. Rath MF, Morin F, Shi Q, Klein DC, Møller M 2007 Ontogenetic expression of the Otx2 and Crx homeobox genes in the retina of the rat. Exp Eye Res 85:65–73 [DOI] [PubMed] [Google Scholar]
  44. Bovolenta P, Mallamaci A, Briata P, Corte G, Boncinelli E 1997 Implication of OTX2 in pigment epithelium determination and neural retina differentiation. J Neurosci 17:4243–4252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Chen S, Wang QL, Nie Z, Sun H, Lennon G, Copeland NG, Gilbert DJ, Jenkins NA, Zack DJ 1997 Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron 19:1017–1030 [DOI] [PubMed] [Google Scholar]
  46. Klein DC, Weller JL 1970 Indole metabolism in the pineal gland: a circadian rhythm in N-acetyl transferase. Science 169:1093–1095 [DOI] [PubMed] [Google Scholar]
  47. Klein DC, Berg GR, Weller JL 1970 Melatonin synthesis: adenosine 3′,4′-monophosphate and norepinephrine stimulate N-acetyltransferase. Science 168:979–980 [DOI] [PubMed] [Google Scholar]
  48. Gastel JA, Roseboom PH, Rinaldi PA, Weller JL, Klein DC 1998 Melatonin production: proteasomal proteolysis in serotonin N-acetyltransferase regulation. Science 279:1358–1360 [DOI] [PubMed] [Google Scholar]
  49. Carter DA 1993 Up-regulation of β 1-adrenoceptor messenger ribonucleic acid in the rat pineal gland: nocturnally, through a β-adrenoceptor-linked mechanism, and in vitro, through a novel posttranscriptional mechanism activated by specific protein synthesis inhibitors. Endocrinology 133:2263–2268 [DOI] [PubMed] [Google Scholar]
  50. Gauer F, Craft CM 1996 Circadian regulation of hydroxyindole-O-methyltransferase mRNA levels in rat pineal and retina. Brain Res 737:99–109 [DOI] [PubMed] [Google Scholar]
  51. Coon SL, McCune SK, Sugden D, Klein DC 1997 Regulation of pineal α1B-adrenergic receptor mRNA: day/night rhythm and β-adrenergic receptor/cyclic AMP control. Mol Pharmacol 51:551–557 [DOI] [PubMed] [Google Scholar]
  52. Gaildrat P, Møller M, Mukda S, Humphries A, Carter DA, Ganapathy V, Klein DC 2005 A novel pineal-specific product of the oligopeptide transporter PepT1 gene: circadian expression mediated by cAMP activation of an intronic promoter. J Biol Chem 280:16851–16860 [DOI] [PubMed] [Google Scholar]
  53. Borjigin J, Deng J, Sun X, De Jesus M, Liu T, Wang MM 2003 Diurnal pineal 3-O-sulphotransferase 2 expression controlled by β-adrenergic repression. J Biol Chem 278:16315–16319 [DOI] [PubMed] [Google Scholar]
  54. Kim TD, Kim JS, Kim JH, Myung J, Chae HD, Woo KC, Jang SK, Koh DS, Kim KT 2005 Rhythmic serotonin N-acetyltransferase mRNA degradation is essential for the maintenance of its circadian oscillation. Mol Cell Biol 25:3232–3246 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental Data]
en.2008-0882_index.html (1.7KB, html)
en.2008-0882_1.pdf (159.8KB, pdf)
en.2008-0882_2.pdf (1.8MB, pdf)
en.2008-0882_3.pdf (325KB, pdf)
en.2008-0882_4.pdf (8.2KB, pdf)

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES