Skip to main content
World Journal of Gastroenterology logoLink to World Journal of Gastroenterology
. 2009 Jan 28;15(4):484–488. doi: 10.3748/wjg.15.484

Application of Stool-PCR test for diagnosis of Helicobacter pylori infection in children

Tahereh Falsafi 1,2, Raha Favaedi 1,2, Fatemeh Mahjoub 1,2, Mehri Najafi 1,2
PMCID: PMC2653372  PMID: 19152455

Abstract

AIM: To evaluate the usefulness of stool-PCR test for diagnosis of Helicobacter pylori (H pylori) infection in pediatric populations.

METHODS: Based on endoscopic features (including nodular gastritis, erosive duodenitis and ulcer) and/or a positive rapid urease test (RUT) obtained during endoscopy, 28 children from a group of children admitted to the Children's Medical Center of Tehran for persistent upper gastrointestinal problems were selected to compare biopsy-based tests with stool-PCR. Their gastric activity and bacterial density were graded by the updated Sydney system, and their first stool after endoscopy was stored at -70°C. Biopsies were cultured on modified campy-blood agar plates and identified by gram-staining, biochemical tests, and PCR. Two methods of phenol-chloroform and boiling were used for DNA extraction from H pylori isolates. Isolation of DNA from stool was performed using a stool DNA extraction kit (Bioneer Inc, Korea). PCR was performed using primers for detection of vacA, cagA, and 16srRNA genes in both isolates and stool.

RESULTS: Sixteen out of 28 child patients (57%) were classified as H pylori positive by biopsy-based tests, of which 11 (39%) were also positive by stool-PCR. Sensitivity and specificity of stool-PCR was 62.5% and 92.3% respectively. H pylori was observed in histological sections for 10 out of 11 stool-positive patients. Association was observed between higher score of H pylori in histology and positivity of stool-PCR. Also association was observed between the more severe form of gastritis and a positive stool-PCR.

CONCLUSION: Association between higher score of H pylori in histology and a positive stool-PCR make it a very useful test for detection of H pylori active infection in children. We also suggest that a simple stool-PCR method can be a useful test for detection of H pylori virulence genes in stool.

Keywords: Helicobacter pylori, Non-invasive diagnosis, Stool-PCR, Histology, Score, Children, Iran

INTRODUCTION

Helicobacter pylori (H pylori) infection in humans is associated with gastritis, gastric ulcer, and gastric cancers[1,2]. Infection occurs mainly in childhood and infected individuals usually carry it for life unless treated[3,4]. Epidemiology of infection by H pylori has been characterized by a linear increase with age in western industrial countries and by a large number of children and juveniles being infected in developing countries[5]. Currently used methods for diagnosis of H pylori infection, such as culture, histology, and rapid urease test (RUT) are very sensitive and highly specific tests, but require invasive sampling. The non-invasive methods, such as serology and urea breath test (UBT), are also sensitive and specific; however, positive results obtained by serology do not necessarily indicate current infection by H pylori[6,7]. UBT requires an expensive instrument, which is not always available in routine clinical laboratories, especially in developing countries. In addition the performance of the test has been associated with some disadvantages for infants and very young children, as well as patients with certain neurological disorders[6,7]. H pylori is not an intestinal pathogen, and therefore is expected to be present in low concentrations in stool; however, it can be detected in stool specimens by H pylori stool-antigen (HpSA) test, PCR, or even culture[8–12]. The HpSA test has been shown to be very useful, especially in children; however, various commercial tests have shown some discrepancies in different geographical areas[13–15]. Stool-culture is a very specific method; however, the massive numbers of diverse micro-organisms in stool makes it very difficult in routine practice[8,12]. Stool-PCR may also be a very useful method in detection of H pylori infection, but reported success rates for the detection of H pylori DNA in feces vary from 25% to 100%[6,8]. This variability is probably due to H pylori degradation in the gastrointestinal tract and/or the presence of inhibitors such as complex polysaccharides[16,17]. The purpose of this study was to evaluate the usefulness of the stool-PCR test for diagnosis of H pylori infection in pediatric populations.

MATERIALS AND METHODS

Patients

Based on endoscopic features (including nodular gastritis, erosive duodenitis, or ulcers) and/or a positive rapid urease test obtained during endoscopy, 28 children from a group of children admitted to a children’s medical center in Tehran for persistent upper gastrointestinal problems were selected to compare biopsy-based tests and stool-PCR. Of these patients, two antral biopsies similar to that of RUT were obtained for culture and histology, and the first stool after endoscopy but before antibiotic therapy was collected and stored at -70°C. These children were asked to have a vegetable free diet 24 h before sampling. Stool samples were also collected from a few healthy children that showed no symptoms. Patients who tested positive by culture or positive by both RUT and histology were considered as positive controls and those who tested negative by all three endoscopy-based tests were considered as negative ones.

Biopsy-based tests

Culture of biopsy samples was performed as previously described[12,18]. Briefly, antral biopsies were placed in a modified campy-thio medium and incubated at 37°C under a micro-aerobic atmosphere. After 3 d, 20 μL of the enrichment culture was streaked onto modified campy-blood agar and incubated for 5-10 d until colonies were evident. The grown colonies were identified by gram-staining, oxidase, urease, and nitrate-reduction tests.

RUT was performed using urea broth as previously described. The RUT result was read either within 2 h at endoscopy room or after overnight incubation under a micro-aerobic atmosphere at 37°C according to the previously described protocol[12,18]. Histological examination of the biopsies was performed after H&E, and Geimsa staining H pylori density, gastritis, and inflammation were graded according to the modified Sydney system[19,20]. The cases of gastritis with follicular formation were classified as follicular gastritis either with or without activity[20].

DNA extraction and PCR

Two methods of phenol-chloroform and boiling were used for DNA extraction from H pylori isolates. For the first one, a pool of colonies in 2 mL sterile 0.9% NaCL, was centrifuged at 10 000 g, the pellet was resuspended in 400 μL of extraction buffer (10 mmol/L Tris-HCL, pH 8.0; 5 mmol/L EDTA, 0.1% sodium dodecyl sulfate), and proteinase K at final concentration of 0.5 mg/mL was added to homogenizates. Samples were incubated at 55°C for 2-4 h before incubation at 95°C for 10 min. DNA was purified by phenol-chloroform, precipitated by absolute ethanol at -20°C in presence of 0.3 mol/L sodium acetate, pelleted by centrifugation at 12 000 g for 30 min and allowed to dry in air. The pellet in sterile double-distilled water was quantified by measuring the optical density at 260 nm and stored at -20°C until they were used as PCR templates. For the second method, a loopful of colonies was suspended in 1 mL of phosphate buffer saline (PBS, pH 7.6), washed by centrifugation at 14 000 g for 2 min, and resuspended in 50 μL of sterile, double distilled water. Tubes were then boiled at 95°C for five minutes and 2 μL of 1/5 dilution of this extract (containing approximately 20 ng of DNA) was immediately used as template for PCR. Isolation of DNA from stool was performed using a stool DNA extraction kit (Bioneer Inc, Korea), where substances inhibiting PCR were removed by filtration according to the manufacturer’s instructions. Stool-PCR controls were 3 uninfected feces from the H pylori-negative patient (as determined by endoscopy-based tests) seeded or not seeded with known concentrations (equivalent to McFarland No. 5) of 26695 H pylori ATCC strain.

PCR primers (Faza Biotech Inc, Iran) were designed on the basis of published sequences of H pylori 16SrRNA, vacA, and cagA[8,21]. Table 1 resumes the sequences and experimental details for PCR.

Table 1.

Primers sequences and PCR conditions

Primers Sequences Product size (bp) PCR conditions
16sRNA 5'GCTAAGAGATCAGCCTATGTCC3' 500 95°C 5 min (1 cycle); 94°C for 1 min, 55°C for 1 min
5'TGGCAATCAGCGTCAGGTAATG3' 72°C for 2 min (39 cycles); 72°C for 7 min
VacA (s) 5'ATGGAAATACAACAAACACAC3' s1: 259 95°C 4 min (1 cycle); 95°C for 1 min, 52°C for 1 min
5'CTGCTTGAATGCGCCAAAC3' s2: 286 72°C for 1 min (35 cycles); 72°C for 10 min
vacA (m) 5'CAATCTGTCCAATCAAGCGAG34 m1: 570 95°C 4 min (1 cycle); 95°C for 1 min, 52°C for 1 min
5'GCGTCTAAATAATTCCAAGG3' m2: 642 72°C for 1 min (35 cycles); 72°C for 10 min
cagA 5'AATACACCAACGCCTCCA3' 400 94°C for 4 min (1 cycle); 94°C for 1 min, 59°C for 1 min
5'TTGTTGCCGCTTTTGCTCTC3' 72°C for 1 min (35 cycles); 72°C for 10 min

RESULTS

The H pylori status

Sixteen out of 28 child patients (57%) were classified as H pylori positive by biopsy-based tests. Of 16 H pylori positive children 6 were positive by culture, 5 were positive by all of the 3 tests, and 5 were positive by RUT plus histology.

PCR results

DNA isolated from culture positive controls showed amplification for H pylori specific primer(s) including vacA (s, m), cagA, and 16srRNA. Stool-PCR positive controls, which were 3 uninfected feces from the H pylori-negative patient containing known concentrations of 26 695 H pylori ATCC strain, showed amplification for H pylori DNA only after purification by column chromatography procedure. No amplification was observed for the negative stool-PCR controls (stool specimens from H pylori-negative patients), even after purification procedure. Eleven biopsied children showed positive stool-PCR of which 10 were positive by biopsy-based tests (Table 2). Sensitivity and specificity of stool-PCR were 62.5% and 92.3% respectively.

Table 2.

Comparison between the results of biopsy-based tests and Stool-PCR

n/Status Culture RUT Histology Stool-PCR
1/negative Negative Nd Negative Negativea
2/negative Negative Nd Negative Negativea
3/negative Negative Nd Negative Negativea
4/negative Negative Negative Negative Negativea
5/negative Negative Negative Negative Negativea
6/positive Positive Negative Negative Negativeb
7/negative Negative Negative Negative Negativea
8/positive Negative Positive Positive Positivec
9/negative Negative Positive Negative Negativea
10/negative Negative Negative Negative Negativea
11/positive Positive Positive Negative Negativeb
12/positive Positive Positive Positive Positivec
13/positive Positive Positive Negative Negativeb
14/positive Negative Positive Positive Positivec
15/positive Positive Positive Positive Positivec
16/positive Positive Positive Positive Positivec
17/positive Positive Positive Positive Positivec
18/positive Positive Positive Positive Positivec
19/negative Negative Negative Negative Negativea
20/positive Negative Positive Positive Positivec
21/negative Negative Negative Negative Negativea
22/negative Negative Negative Negative Negativea
23/positive Positive Positive Negative Negativeb
24/positive Positive Positive Negative Negativeb
25/positive Positive Positive Negative Positivec
26/positive Negative Positive Positive Positivec
27/negative Negative Positive Negative Positived
28/positive Negative Positive Positive Negativeb

Nd: Not-determined; a: True negative; b: False negative; c: True positive; d: False positive. Sensitivity: c/c + b = 62.5; Specificity: a/a + d = 92.3%.

In this work, detection of H pylori specific virulence genes in both isolates and stool (Table 3) was compared. Also, association between endoscopic features, pathology, score of bacteria, and a positive stool-PCR was studied (Table 4). H pylori was observed in histological sections of 10 out of 11 stool-positive patients and association was observed between higher score of H pylori in histology and a positive stool-PCR.

Table 3.

Comparison of detected genes in DNA from isolates and DNA from stool

Detected genes in
n/Status Isolate
Stool
16sRNA vacA cagA 16sRNA vacA cagA
1/negative - - - - - -
2/negative - - - - - -
3/negative - - - - - -
4/negative - - - - - -
5/negative - - - - - -
6/positivea + + - - - -
7/negative - - - - - -
8/positiveb,c - - - - - +
9/negativeb - - - - - -
10/negative - - - - - -
11/positivea,b - + + - - -
12/positivea,b,c - - + - + -
13/positivea,b + - - - - -
14/positiveb,c - - - - + -
15/positivea,b,c - + - - + -
16/positivea,b,c + + + + + -
17/positivea,b,c - - + + + -
18/positivea,b,c - - + + + -
19/negative - - - - - -
20/positiveb,c - - - + + -
21/negative - - - - - -
22/negative - - - - - -
23/positivea,b - - + - - -
24/positivea,b - - + - - -
25/positivea,b - - + - + -
26/positiveb,c - - - - + -
27/negativeb - - - + - -
28/positiveb,c - - - - - -

a: Culture positive; b: RUT positive; c: Histology positive.

Table 4.

Relationship between endoscopic features of patients, histopathology, score of H pylori and detection of DNA in stool

n/Status Endoscopic feature Histopa-thology Score of H pylori Stool PCR
1/negative Non-ulcer NSPC 0 Negative
2/negative Non-ulcer NST 0 Negative
3/negative Non-ulcer Mild chronic gastritis 0 Negative
4/negative Non-ulcer Follicular gastritis 0 Negative
5/negative Non-ulcer Follicular gastritis + activity 0 Negative
6/positive Non-ulcer NSPC 0 Negative
7/negative Non-ulcer Mild chronic gastritis 0 Negative
8/positive Non-ulcer Follicular gastritis 4 Positive
9/negative Ulcer NST 0 Negative
10/negative Non-ulcer NSPC 0 Negative
11/positive Non-ulcer Follicular gastritis 0 Negative
12/positive Non-ulcer Follicular gastritis + activity 4 Positive
13/positive Non-ulcer Follicular gastritis 0 Negative
14/positive Non-ulcer Moderate chronic gastritis 1 Positive
15/positive Multiple ulcers Moderate chronic gastritis 4 Positive
16/positive Non-ulcer Moderate chronic gastritis 2 Positive
17/positive Ulcer Grading was not possible 1 Positive
18/positive Non-ulcer Follicular gastritis + activity 5 Positive
19/positive Non-ulcer Mild chronic gastritis 0 Negative
20/positive Non-ulcer Follicular gastritis 3 Positive
21/negative Non-ulcer NSPC 0 Negative
22/negative Non-ulcer NSPC 0 Negative
23/positive Non-ulcer Moderate chronic gastritis 0 Negative
24/positive Non-ulcer Mild chronic gastritis 0 Negative
25/positive Non-ulcer Mild chronic gastritis 0 Positive
26/positive Non-ulcer Follicular gastritis 2 Positive
27/negative Multiple ulcers Mild chronic gastritis 0 Positive
28/positive Non-ulcer Moderate chronic gastritis 3 Negative

NSPC: No significant pathologic change; NST: No suitable tissue.

DISCUSSION

In our previous study[12], we successfully cultured H pylori from stool; however, the sensitivity of stool-culture was low. Using PCR, we detected H pylori specific genes in isolates and stool in sick and healthy children. However, when fecal extracts were not subjected to column chromatography, there were no results even for the positive controls. This suggests that the method of DNA extraction used in this work efficiently removed the PCR inhibitors. Various methods has been used for the removing of inhibitors or for the purification of DNA such as the removal of PCR inhibitors by a polypropylene filter, dilution of fecal suspension, and DNA purification by various biochemical techniques; in many studies with filtration of stool and column chromatography, high sensitivity was observed[8,10,11,14,22–24].

In this work, by detection of various H pylori specific genes in stools, 62.5% sensitivity and 92.3% specificity was observed for stool-PCR (Table 2). Nevertheless, by PCR only one or two out of three H pylori specific genes were detectable (Table 3). While this permits us to think that the absence of amplification is related to the absence of the detecting gene from the genome or the absence of intact template DNA (in stool), it would be a premature conclusion, since PCR-based absence of an ORF does not necessarily mean its absence from the genome. Also, in a highly recombining genome like

H pylori, PCR primer annealing sites can pose problems and amplifications may not be generated[25,26]. Thus, we think that for genotyping of H pylori from stool, using more than one primer for each gene may enhance detection rate. Many investigators have proposed semi-nested or nested PCR as more sensitive methods for stool-PCR[8,10]. Although these methods reduce background, their disadvantages would be presence of false positive results due to detection of dead bacteria in stool even in low amounts. Sensitivity and specificity of stool-PCR method in this work were acceptable, suggesting that PCR method used in this work was quite adequate for this evaluation.

H pylori is not an intestinal pathogen, and therefore is expected to be present in low concentrations in stool; however, the status of the infection of H pylori may influence its density in stool. Thus, we compared histological scoring of H pylori with pathological grading and also with the results of stool-PCR. Concordance was observed between higher score of H pylori in histological sections and a positive stool-PCR (Table 4). Also, association was observed between the more severe form of gastritis and a positive stool-PCR. Therefore, the degree of stomach colonization by H pylori may be important for successful detection of DNA in stool samples. Otherwise, the amount of bacteria excreted in stool may reveal information on the status of H pylori infection. Consequently, the association between a higher score of H pylori in histology and a positive stool-PCR make it a very useful test for detection of pediatric H pylori infection.

COMMENTS

Background

A reliable non-invasive test for detection of Helicobacter pylori (H pylori) infection in routine practice is essential, especially for children since the application of biopsy-based tests is more difficult for them. Serological tests do not necessarily indicate active infection by H pylori, and urea breath test (UBT) is expensive and not available in routine clinical laboratories, especially in developing countries. The H pylori stool-antigen (HpSA) test has been shown to be very useful, especially in children; however, various commercial tests have shown some discrepancies in different geographical areas. Stool-PCR may be a very useful test in specific detection of H pylori. In this study, we evaluated the performance of stool-PCR in diagnosis of active infection in children.

Research frontiers

Stool-PCR is a very useful method for detection of H pylori genes in stool. It is interesting because H pylori specific genes, including virulence genes and the genes involved in its resistance to antibiotics, can be detected by this method. Furthermore, a positive stool-PCR has significance in relation to the status of stomach colonization by H pylori.

Innovations and breakthroughs

A stool-PCR method such that used in this work may represent a very specific test for diagnosis of H pylori infection. This is the first study to report association between a positive stool-PCR and the degree of stomach colonization, manifested by higher score of H pylori in histology.

Applications

A simple PCR method such that used in this work will be quite adequate for detection of H pylori infection.

Peer review

In this study, Falsafi et al. evaluated the performance of stool-PCR test for diagnosis of current H pylori infection in children. The content of the article can be interesting for gastroenterologists who work with the pediatric population, especially with very young children and patients with certain neurological disorders. Stool-PCR may be a very useful method in detection of H pylori infection.

Acknowledgments

We thank MRS Shahla Tafreshi and MRS Masoumeh Madadi for technical assistance. Mavenat Pajouheshy of Alzahra University, Vanak, Tehran has supported this work.

Peer reviewer: Vasiliy I Reshetnyak, MD, PhD, Professor, Scientist Secretary of the Scientific Research Institute of General Reanimatology, 25-2, Petrovka str., 107031, Moscow, Russia

S- Editor Tian L L- Editor Li M E- Editor Ma WH

References

  • 1.Fischbach W, Chan AO, Wong BC. Helicobacter pylori and Gastric Malignancy. Helicobacter. 2005;10 Suppl 1:34–39. doi: 10.1111/j.1523-5378.2005.00338.x. [DOI] [PubMed] [Google Scholar]
  • 2.Wundisch T, Thiede C, Morgner A, Dempfle A, Gunther A, Liu H, Ye H, Du MQ, Kim TD, Bayerdorffer E, et al. Long-term follow-up of gastric MALT lymphoma after Helicobacter pylori eradication. J Clin Oncol. 2005;23:8018–8024. doi: 10.1200/JCO.2005.02.3903. [DOI] [PubMed] [Google Scholar]
  • 3.Elitsur Y, Yahav J. Helicobacter pylori infection in pediatrics. Helicobacter. 2005;10 Suppl 1:47–53. doi: 10.1111/j.1523-5378.2005.00332.x. [DOI] [PubMed] [Google Scholar]
  • 4.Kusters JG, van Vliet AH, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev. 2006;19:449–490. doi: 10.1128/CMR.00054-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kikuchi S, Dore MP. Epidemiology of Helicobacter pylori Infection. Helicobacter. 2005;10 Suppl 1:1–4. doi: 10.1111/j.1523-5378.2005.00335.x. [DOI] [PubMed] [Google Scholar]
  • 6.Krogfelt KA, Lehours P, Megraud F. Diagnosis of Helico-bacter pylori Infection. Helicobacter. 2005;10 Suppl 1:5–13. doi: 10.1111/j.1523-5378.2005.00341.x. [DOI] [PubMed] [Google Scholar]
  • 7.Monteiro L, de Mascarel A, Sarrasqueta AM, Bergey B, Barberis C, Talby P, Roux D, Shouler L, Goldfain D, Lamouliatte H, et al. Diagnosis of Helicobacter pylori infection: noninvasive methods compared to invasive methods and evaluation of two new tests. Am J Gastroenterol. 2001;96:353–358. doi: 10.1111/j.1572-0241.2001.03518.x. [DOI] [PubMed] [Google Scholar]
  • 8.Kabir S. Detection of Helicobacter pylori in faeces by culture, PCR and enzyme immunoassay. J Med Microbiol. 2001;50:1021–1029. doi: 10.1099/0022-1317-50-12-1021. [DOI] [PubMed] [Google Scholar]
  • 9.Roth DE, Taylor DN, Gilman RH, Meza R, Katz U, Bautista C, Cabrera L, Velapatino B, Lebron C, Razuri M, et al. Posttreatment follow-up of Helicobacter pylori infection using a stool antigen immunoassay. Clin Diagn Lab Immunol. 2001;8:718–723. doi: 10.1128/CDLI.8.4.718-723.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Makristathis A, Pasching E, Schutze K, Wimmer M, Rotter ML, Hirschl AM. Detection of Helicobacter pylori in stool specimens by PCR and antigen enzyme immunoassay. J Clin Microbiol. 1998;36:2772–2774. doi: 10.1128/jcm.36.9.2772-2774.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Monteiro L, Gras N, Megraud F. Magnetic immuno-PCR assay with inhibitor removal for direct detection of Helicobacter pylori in human feces. J Clin Microbiol. 2001;39:3778–3780. doi: 10.1128/JCM.39.10.3778-3780.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Falsafi T, Valizadeh N, Najafi M, Ehsani A, Khani A, Landarani Z, Falahi Z. Culture of Helicobacter pylori from stool samples in children. Can J Microbiol. 2007;53:411–416. doi: 10.1139/W06-144. [DOI] [PubMed] [Google Scholar]
  • 13.Li YH, Guo H, Zhang PB, Zhao XY, Da SP. Clinical value of Helicobacter pylori stool antigen test, ImmunoCard STAT HpSA, for detecting H pylori infection. World J Gastroenterol. 2004;10:913–914. doi: 10.3748/wjg.v10.i6.913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Makristathis A, Barousch W, Pasching E, Binder C, Kuderna C, Apfalter P, Rotter ML, Hirschl AM. Two enzyme immunoassays and PCR for detection of Helicobacter pylori in stool specimens from pediatric patients before and after eradication therapy. J Clin Microbiol. 2000;38:3710–3714. doi: 10.1128/jcm.38.10.3710-3714.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Manes G, Balzano A, Iaquinto G, Ricci C, Piccirillo MM, Giardullo N, Todisco A, Lioniello M, Vaira D. Accuracy of the stool antigen test in the diagnosis of Helicobacter pylori infection before treatment and in patients on omeprazole therapy. Aliment Pharmacol Ther. 2001;15:73–79. doi: 10.1046/j.1365-2036.2001.00907.x. [DOI] [PubMed] [Google Scholar]
  • 16.Delgado S, Suarez A, Otero L, Mayo B. Variation of microbiological and biochemical parameters in the faeces of two healthy people over a 15 day period. Eur J Nutr. 2004;43:375–380. doi: 10.1007/s00394-004-0485-z. [DOI] [PubMed] [Google Scholar]
  • 17.van Tongeren SP, Slaets JP, Harmsen HJ, Welling GW. Fecal microbiota composition and frailty. Appl Environ Microbiol. 2005;71:6438–6442. doi: 10.1128/AEM.71.10.6438-6442.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Falsafi T, Valizadeh N, Sepehr S, Najafi M. Application of a stool antigen test to evaluate the incidence of Helicobacter pylori infection in children and adolescents from Tehran, Iran. Clin Diagn Lab Immunol. 2005;12:1094–1097. doi: 10.1128/CDLI.12.9.1094-1097.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994. Am J Surg Pathol. 1996;20:1161–1181. doi: 10.1097/00000478-199610000-00001. [DOI] [PubMed] [Google Scholar]
  • 20.Zaitoun AM. The prevalence of lymphoid follicles in Helicobacter pylori associated gastritis in patients with ulcers and non-ulcer dyspepsia. J Clin Pathol. 1995;48:325–329. doi: 10.1136/jcp.48.4.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Park CY, Kwak M, Gutierrez O, Graham DY, Yamaoka Y. Comparison of genotyping Helicobacter pylori directly from biopsy specimens and genotyping from bacterial cultures. J Clin Microbiol. 2003;41:3336–3338. doi: 10.1128/JCM.41.7.3336-3338.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.MacKay WG, Williams CL, McMillan M, Ndip RN, Shepherd AJ, Weaver LT. Evaluation of protocol using gene capture and PCR for detection of Helicobacter pylori DNA in feces. J Clin Microbiol. 2003;41:4589–4593. doi: 10.1128/JCM.41.10.4589-4593.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sen N, Yilmaz O, Simsek I, Kupelioglu AA, Ellidokuz H. Detection of Helicobacter pylori DNA by a simple stool PCR method in adult dyspeptic patients. Helicobacter. 2005;10:353–359. doi: 10.1111/j.1523-5378.2005.00326.x. [DOI] [PubMed] [Google Scholar]
  • 24.Liang S, Redlinger T. A protocol for isolating putative Helicobacter pylori from fecal specimens and genotyping using vacA alleles. Helicobacter. 2003;8:561–567. doi: 10.1046/j.1523-5378.2003.00177.x. [DOI] [PubMed] [Google Scholar]
  • 25.Hanage WP, Fraser C, Spratt BG. The impact of homologous recombination on the generation of diversity in bacteria. J Theor Biol. 2006;239:210–219. doi: 10.1016/j.jtbi.2005.08.035. [DOI] [PubMed] [Google Scholar]
  • 26.Kraft C, Suerbaum S. Mutation and recombination in Helicobacter pylori: mechanisms and role in generating strain diversity. Int J Med Microbiol. 2005;295:299–305. doi: 10.1016/j.ijmm.2005.06.002. [DOI] [PubMed] [Google Scholar]

Articles from World Journal of Gastroenterology : WJG are provided here courtesy of Baishideng Publishing Group Inc

RESOURCES