Skip to main content
Genes & Nutrition logoLink to Genes & Nutrition
. 2009 Feb 27;4(1):49–57. doi: 10.1007/s12263-009-0110-0

Chronic intracerebroventricular injection of TLQP-21 prevents high fat diet induced weight gain in fast weight-gaining mice

Alessandro Bartolomucci 1,2,✉, Elena Bresciani 3, Ilaria Bulgarelli 3, Antonello E Rigamonti 4, Tiziana Pascucci 5, Andrea Levi 6, Roberta Possenti 6,7, Antonio Torsello 3, Vittorio Locatelli 3, Eugenio E Muller 4, Anna Moles 1,✉
PMCID: PMC2654049  PMID: 19247701

Abstract

The vgf gene regulates energy homeostasis and the VGF-derived peptide TLQP-21 centrally exerts catabolic effects in mice and hamsters. Here, we investigate the effect of chronic intracerebroventricular (icv) injection of TLQP-21 in mice fed high fat diet (HFD). Fast weight-gaining mice injected with the peptide or cerebrospinal fluid were selected for physiological, endocrine, and molecular analysis. TLQP-21 selectively inhibited the increase in body weight and epididymal white adipose tissue (eWAT) weight induced by HFD in control animals despite both groups having a similar degree of hyperphagia. TLQP-21 normalized the increase in leptin and decrease in ghrelin while increasing epinephrine and epinephrine/norepinephrine ratio when compared to values in controls. Finally, HFD-TLQP-21 mice showed a selective increase of eWAT β3-adrenergic receptor mRNA. Peroxisome-proliferator-activated-receptor-δ and hormone-sensing-lipase mRNA were also upregulated. In conclusion, chronic icv infusion of TLQP-21 prevented the early phase of diet-induced obesity despite overfeeding. These effects were paralleled by activation of catabolic pathways within the eWAT. Our results further support a role for TLQP-21 as a catabolic neuropeptide.

Keywords: VGF, Obesity, Neuropeptides, White adipose tissue, High fat diet

Introduction

The hypothalamus is the core of the central circuits predisposed to regulate energy homeostasis and nutrition by sensing the level and the activity of central and peripheral mediators and activating catabolic/anabolic pathways [34, 48, 62]. In particular, catabolic fasting/energy dissipating pathways downstream of hypothalamic nuclei projects to other brain area or the pituitary and leads to the coordinated activation of the sympathetic innervations to metabolic tissues, the release of epinephrine from the adrenal medulla, the thyroid axis, behavioral energy-dissipating activities as well as inhibition of feeding. Synergistic activation of these pathways finally leads to increased energy expenditure and dissipation (rise in body temperature), as well as lipolysis [34, 41, 62]. Peripheral target tissues of these pathways include metabolic tissues such as muscles, liver, as well as the brown adipose tissue (BAT) and the white adipose tissue (WAT) [14, 18, 52, 67].

In this context, the number of genes involved in the regulation of nutrition and metabolism in general, and catabolic energy dissipating pathways in particular, is enormous [6, 60] and the identification of peptides associated with higher or lower risk for obesity is rising exponentially [29, 30]. Among these genes, vgf [42] is gaining increasing interest. VGF mRNA can be upregulated by fasting in the arcuate nucleus (ARC) with leptin limiting the fasting-induced increase [33]. VGF co-localizes in the ARC with proopiomelanocortin (POMC) and modestly with peuropeptide Y (NPY) expressing neurons in the fed state. Co-localization increased with NPY and decreased with POMC in the fast state [33]. In addition, germline VGF−/− mice have a lean, hypermetabolic, and obesity resistant phenotype [32, 33]. However, the vgf gene encodes a phylogenetically highly conserved precursor protein of 615 (human) and 617 (rat, mice) amino acids [43, 61]. A major feature of VGF is the presence of specific sequence with basic amino acid residues that represent potential cleavage sites for proprotein convertases of the kexin/subtilisin-like serine proteinase family. Upon processing by the neuroendocrine-specific prohormone convertases PC1/3 and PC2, VGF may yield a number of peptides that are stored in dense core granules and secreted through regulated pathways [66]. Up to now, six VGF-peptides were shown to modulate with a remarkable peptide-specific selectivity, a diverse range of biological functions such as synaptic plasticity, apoptosis, sexual antidepressant-like behavior and inflammatory pain [2, 7, 10, 11, 35, 37, 58, 63, 64, 65, 70].

Among the different VGF-peptides, however, only the peptide designate TLQP-21 was demonstrated to exert a catabolic role [7, 37], while preliminary data showed an orexigenic effect following acute injection of the peptides designated TLQP-62 and HHPD-41 [8]. In particular, Bartolomucci et al. [7] proved that chronic icv injection of TLQP-21 increased resting energy expenditure and prevented the early phase of diet-induced obesity and associated leptin and ghrelin alterations. A later study by Jethwa et al. [36, 37] demonstrated in hamster an anorectic effect exerted by TLQP-21 which determined a decrease in body weight and adipose fat mass.

In the present study, we aimed at extending current knowledge on TLQP-21 in high fat fed mice. High fat feeding can affect a variety of brain and peripheral pathways involved in energy balance [25, 26] including beta adrenergic function [21]. Furthermore, these effects are dependent upon genetic vulnerability to diet-induced obesity and are correlated with lipid and glucose metabolism [39, 46]. To test if the effects of TLQP-21 could be related to the mice liability to weight gain, TLQP-21 was chronically injected icv in mice fed high fat diet, and post hoc selected as fast weight gaining within each experimental group. Physiological parameters, metabolic-regulating hormones as well as molecular changes in the adipose tissue were analyzed.

Materials and methods

Animals

Male Swiss CD1 mice weighting 30–35 g were purchased from Charles River (Calco, Lecco, Italy) and housed in groups of four in an environmentally controlled room (temperature, 20–22°C; Light on 07:00, off 19:00). Mice were allowed 15 days to acclimatize to the laboratory conditions. Food (3.4 Kcal/g, Mucedola s.r.l.) and water were available ad libitum. All experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). All efforts were made to minimize animal suffering and to use only the number of animals necessary to produce reliable scientific data.

Peptide

Synthetic TLQP-21 peptide [7] (Primm, Milano, Italy) at the dose of 1 mM dissolved in artificial cerebrospinal fluid (aCSF) or aCSF alone was icv delivered trough Alzet micro-osmotic pumps (Mod. 1002; final volume of 100 μl; flow rate 0.25 μl/h, corresponding to 15 μg/day of TLQP-21) connected to the Alzet brain infusion kit. The dose was selected based on previous studies [7–10]. To allow preloading, pumps were filled the day before surgery and overnight incubated in sterile saline at 37°C.

Experimental paradigm

All experiments consisted of a 4-day baseline period followed by a 14-day experimental phase in which mice were fed a standard chow and treated aCSF (n = 9) or received a high fat diet consisting of diluted powdered rodent chow plus 20% lard (calculated energy content of the dry diet 4.33 Kcal/g) and were treated with aCSF (n = 12) or TLQP-21 (n = 11).

Along the whole experimental phase, animals were individually housed and locomotor activity was monitored continuously (see below). Body weight was determined with an analytical balance (precision level 0.1 g) on day 0 (days of surgery, referred to as BASAL), day 1 and every second day. Food intake was monitored on a daily basis. Animals were terminated by decapitation, following brief CO2 exposure, on day 14 between 9:00 and 11:00 am. At autopsy, interscapular brown adipose tissue (iBAT) and epididymal white adipose tissue (eWAT) were dissected out, weighted, and snap frozen in liquid nitrogen.

Surgery

Alzet pumps and brain infusion kits were implanted under anesthesia (ketamine, 100 mg/kg, ip and xylazine, 5 mg/kg, ip). The mouse head was fixed in a stereotaxic apparatus and an incision was made in the atlanto-occipital membrane. Cannulae were implanted according to the stereotaxic co-ordinates (anteroposterior, AP −0.1 mm; mediolateral, ML ± 1.0 mm; dorsoventral, DV 3 mm form bregma) derived from the mouse brain atlas [28]. Cannulae were fixed to the mouse skull with polycarbonate cement (Hy-Bond Polycarbonate Cement, Shofu Inc, Kyoto, Japan). Localization of the cannulae was confirmed by icv injection of colorant in a subgroup of animals.

Home cage locomotor activity

The assessment of daily activity was carried out by means of an automated system that used small passive infrared sensors positioned on the top of each cage (Activiscope, New Behaviour Inc., Zürich, Switzerland).

Serum measurements

Mouse serum ghrelin was measured by a commercial radioimmunoassay (RIA) kit (Linco Research, Inc, MO, USA). Sensitivity of the assay is 93 pg/ml. The inter-assay coefficient of variation (CV) was 9.0%, and the intra-assay CV was 3.3%. Serum leptin was measured by enzyme-linked immunosorbent assay (ELISA) (Linco Research, Inc, MO, USA). Sensitivity of the assay is 0.5 ng/ml, and the inter- and intra-assay CV were 5.7 and 2.0%, respectively. Norepinephrine (NE) and epinephrine (E) levels were determined simultaneously using an HPLC system (Alliance, Waters) coupled with a coulometric detector (Model 5200A Coulochem II, ESA) provided with a 5011 high sensitivity analytical cell and 5021 conditioning cell. The potentials were set at +450 and +100 mV at the analytical and the conditioning cell, respectively. The columns, a Nova-Pack Phenyl column (3.9 × 150 mm) and a Sentry Guard Nova-Pack precolumn (3.9 × 20 mm), were purchased from Waters Corporation. The flow rate was 1.2 ml/min. The mobile phase consisted of 3% methanol in 0.1-M Na–phosphate buffer, pH 3, 0.1 mM Na2EDTA, and 0.5-mM 1-octane sulfonic acid Na salt (Sigma). For catecholamines determination, serum was treated with HClO4 3.4 M with a ratio of 1 μl serum to 50 μl HClO4.

RT-PCR

BAT and WAT were quickly dissected, collected in RNAlater (Sigma-Aldrich, St. Louis, MO, USA) and subsequently frozen and stored at −20°C until processed for RNA extraction. Total RNA was extracted from cells using TRIzol-like reagent; it is an improvement to the single-step RNA isolation method developed by Chomczynski and Sacchi [17]. RNA quality was assessed with the NanoDrop® ND-1000 Spectrophotometer (NanoDrop Technologies) (260/280 and 260/230 nm ratios) and the integrity of extracted RNA was examined by electrophoresis. Three thousands nanogram of total RNA were incubated with rDNase I (Ambion) for 20 min at 37°C to digest contaminating genomic DNA. Two hundred nanogram total RNA of each sample were subjected to reverse transcription with Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA, USA) followed by amplification with TAQ (GoTAQ, Promega, Madison, WI, USA) using specific primers based on the published sequence of peroxisome proliferator activated receptor (PPAR)-δ, β1-adrenergic receptor (AR), β2-AR, β3-AR, uncoupling protein (UCP)-1, UCP-2, UCP-3, hormone sensing lipase (HSL) (Table 1). Semiquantitative PCR analysis of total RNA yielded a DNA fragment of the expected length for all specific mRNAs. All samples were assayed in triplicate. The band density was analyzed with Kodak 1D Image Analysis Software. To normalize results for differences in RNA sampling, an aliquot of the same RT reaction was used to amplify a glyceraldehyde-6-phosphate (GADPH) 600-bp fragment (Table 1). To assure that PCR was performed in the linear amplification range, samples were initially analyzed after 15, 17, 20, 25, 27, 30, 35 and 40 cycles (data not shown). For each factor, we choose the cycle number that gave half of the maximal amplification. Negative controls of the PCR reactions were made omitting the specific primers from the mixture.

Table 1.

Nucleotide sequence of primers used in the RT-PCR assay

Gene Forward primer Reverse primer Tα (°C) No. of cycles Amplicone (bp)
PPAR-δ GTCGCACAACGCTATCCGCT CCTTCTCTGCCTGCCACA 61 35 WAT 259
β1-AR CGTCCGTCGTCTCCTTCTAC TGATGATGCCCAGTGTCTTG 53 35 BAT 154
35 WAT
β2-AR TGGTGGTGATGGTCTTTGTC GTCTTGAGGGCTTTGTGCT 58 34 BAT 187
33 WAT
β3-AR GCCGAGACTACAGACCATAACC CGAGCATAGACGAAGAGCATT 56 34 BAT 483
30 WAT
UCP-1 AACAGAAGGATTGCCGAAACT AATGAACACTGCCACACCTC 61 25 BAT 190
34 WAT
UCP-2 CAGTTCTACACCAAGGGCTCAGAG TCTGTCATGAGGTTGGCTTTCAG 62 34 BAT 320
34 WAT
UCP-3 GGAGGAGAGAGGAAATACAGAGG CCAAAGGCAGAGACAAAGTGA 58 28 BAT 218
33 WAT
HSL GAGATTGAGGTGCTGTCG TCGTGGGATTTAGAGGTC 55 26 WAT 350
GaPDH GCCATCAACGACCCCTTCATTG TGCCAGTGAGCTTCCCGTTC 53 27 BAT 603
33 WAT

Statistical analysis

Data were analyzed with univariate or multivariate (for repeated measures) ANOVA (followed by Tukey’s HSD post hoc tests) where appropriate.

Results

TLQP-21 selectively blocks weight gain and adiposity in fast body weight-gaining mice

In a previous report we proved that chronic icv injection of TLQP-21 could prevent diet-induced obesity in mice. However, obesity prone and obesity resistant populations have been described in humans and animal models [3, 6]. Mice receiving high fat diet (HFD) were classified as more than or less than average prone towards weight gain. Specifically, mice increasing (prone) or not (resistant) body weight were identified if their body weight change after 14-days HFD treatment had fallen over or below the group median (Fig. 1). Mice prone to weight gain receiving either TLQP-21 (HFD-TLQP-21, n = 6) or artificial cerebrospinal fluid (HFD-aCSF, n = 6) or mice fed standard diet (SD-aCSF, n = 9) were the focus of this study (gray dots in Fig. 1). There was no pre-existing difference in body weight between groups (SD-aCSF, 37 ± 0.7; HFD-aCSF, 35.7 ± 0.9; HFD-TLQP-21, 35.9 ± 0.8; ANOVA, ns).

Fig. 1.

Fig. 1

Selection of mice prone or resistant to weight gain following 14-day high fat diet. Mice were selected to be prone or resistant based on their final body weight gain to fall above or below the median of each experimental group. Individuals identified with a gray dot were selected and included in the analyses described in the study

As expected HFD-aCSF mice were hyperphagic, gained weight, showed high metabolic efficiency and WAT hyperplasia when compared to SD-aCSF mice (Fig. 2; ANOVA main effects: food intake: treatment F(2,16) = 10.3, P < 0.01; body weight: treatment F(2,18) = 12.0, P < 0.001; metabolic efficiency, treatment F(2,17) = 14.3, P < 0.01; WAT, treatment F(2,18) = 3.86, P < 0.05; see figure for post hoc analysis). TLQP-21 selectively inhibited the increase in body weight, metabolic efficiency and WAT weight induced by high fat diet (Fig. 2). Importantly, these metabolic effects occurred despite HFD-TLQP-21 mice had a similar level of hyperphagia than HFD-aCSF mice (Fig. 2), without any effect on locomotor activity (data not shown).

Fig. 2.

Fig. 2

Metabolic consequences of high fat diet and icv TLQP-21 treatment. The figure shows food intake (a), body weight gain (b), metabolic efficiency (c) and weight of the epididymal white adipose tissue (d) in mice fed a standard (SD) or a high fat diet (HFD) and chronically intracerebroventricularly injected with artificial cerebrospinal fluid (aCSF) or TLQP-21. ** and §§P < 0.01, * and §P < 0.05 versus SD-aCSF and versus HFD-aCSF, respectively

TLQP-21 also selectively blunted the obesity-associated increase in leptin and decrease in ghrelin shown by HFD-aCSF mice (ANOVA main effects: leptin: F(4,29) = 3.0, P < 0.05; ghrelin: F(4,27) = 2.3, P < 0.09; see Fig. 3 for post hoc analysis).

Fig. 3.

Fig. 3

Endocrine consequences on high fat diet and icv TLQP-21 treatment. The figure shows serum leptin (a), ghrelin (b), epinephrine (c) norepinephrine (d) and epinephrine/norepinephrine ratio (e) in mice fed a standard (SD) or a high fat diet (HFD) and chronically intracerebroventricularly injected with artificial cerebrospinal fluid (aCSF) or TLQP-21. * and §P < 0.05 versus SD-aCSF and versus HFD-aCSF, respectively

Finally, both HFD treated groups showed a decrease in NE while HFD-TLQP-21 had an increase in E when compared to HFD-aCSF but not to SD-aCSF (Fig. 3; ANOVA main effects: NE, treatment F(2,16) = 5.8, P < 0.05; E, treatment F(2,14) = 2.4, P = 0.1; see Fig. 3 for post hoc analysis). In addition, HFD-TLQP-21 mice also had an increased E/NE ratio (ANOVA main effects: treatment F(2,14) = 3.8, P < 0.05; see figure for post hoc analysis).

TLQP-21 selectively upregulated expression of catabolic markers in the eWAT

HFD-TLQP-21 mice showed (Fig. 4a) a selective increase of β3-AR (ANOVA main effect: treatment F(2,17) = 5.45, P < 0.05) when compared to SD-aCSF and HFD-aCSF mice. In addition, HFD-TLQP-21 mice showed increased expression of PPAR-δ (ANOVA main effect: treatment F(2,18) = 4.7, P < 0.05) and of HSL (ANOVA main effect: treatment F(2,18) = 5.4, P < 0.05) when compared to control SD-aCSF mice only. In addition, HFD-TLQP-21 mice also had a slight but not significant increase (post hocs, P < 0.09) in eWAT β2-AR and β1-AR when compared to SD-aCSF mice (ANOVA main effects: β2-AR, treatment F(2,16) = 2.9 P < 0.08; β1-AR, treatment F(2,17) = 2.9 P < 0.08). Finally, HFD also increased eWAT UCP2 expression in both HFD-TLQP-21 and HFD-aCSF mice when compared to SD-aCSF (ANOVA main effect: treatment F(2,17) = 6.3, P < 0.05). TLQP-21 had no effect on UCP1 or UCP3 expressed in eWAT (data not shown).

Fig. 4.

Fig. 4

Gene expression in adipose tissue. The figure shows gene expression (normalized over GADPH expression) in the epididymal white adipose tissue (a) and the interscapular brown adipose tissue (b) in mice fed a standard (SD) or a high fat diet (HFD) and chronically intracerebroventricularly injected with artificial cerebrospinal fluid (aCSF) or TLQP-21. * and §P < 0.05 versus SD-aCSF and versus HFD-aCSF, respectively

On the other hand, TLQP-21 was not associated with any change in gene expression in the interscapular brown adipose tissue (iBAT; Fig. 4b).

Discussion

In this study, we have demonstrated that chronic icv infusion of the VGF-derived peptide TLQP-21 prevented weight gain and associated endocrine and molecular alterations induced by high fat diet. These findings were obtained in mice post hoc selected as fast weight gaining within each experimental group. Of note, TLQP-21-treated mice despite being resistant to weight gain showed similar hyperphagia than controls. The lack of increase in adipose tissue is the more likely explanation for hormonal findings, i.e., the lack of increase in leptin and the decrease in ghrelin, which were evident instead in HFD-aCSF mice [47, 56, 69]. This study confirms our previous report [7] but partially contrasts the findings by Jethwa et al. [37] who showed that daily icv injection of TLQP-21 exerted a catabolic effect in the Siberian hamster which was associated with decreased body and WAT weight and was dependent on reduced food intake but not on increased energy expenditure. Therefore, three independent studies [7, 37]; present study) evidence a catabolic role for TLQP-21, but differ in the possible mechanism underlying the effect observed: (1) increased energy expenditure/WAT catabolic effects in our studies; (2) reduced food intake in the hamster studies. A number of methodological (repeated injections vs. chronic infusion; the dose used etc.) and species-specific (hamster have a peculiar physiological adaptation to food-shortage/short day length-induced hibernation, see [50]) issues may be advocated and should be experimentally ruled out before a conclusion can be drawn on TLQP-21 mechanism of action. Notwithstanding, the conclusion that TLQP-21 negatively affects energy balance and does have a catabolic effect on the adipose organ is emerging as a constant finding and is further strengthened by the present study.

No receptor has been so-far described for TLQP-21 and no reliable biochemical assay has been developed to detect TLQP-21; therefore, we still do not know where the peptide is expressed in the brain and where it exerts its functions (although some recent development has been obtained in peripheral immunoreactivity of VGF-peptides [19, 57] and with other VGF-derived peptides [16]). However, according to the previous studies [7, 37], TLQP-21 exerted its catabolic effects independently of any gene expression change in the hypothalamus thus allowing the conclusion that the site(s) of TLQP-21 activity lies downstream of the hypothalamic circuits.

In agreement with our previous report, resistance to obesity was associated with increased expression of catabolic mediators such as β3-AR (and to a lower extent also β1- and β2-AR) and PPAR-δ in the eWAT, while the effect was not or poorly dependent on iBAT activation [7]. In the present experiment also HLS, the rate-limiting enzyme for acylglycerol hydrolysis in adipocytes [15] was upregulated by TLQP-21, although the effect was significant only versus SD fed mice. It is known that the molecular machinery regulating energy expenditure and lipolysis in the adipose organ is under direct control of sympathetic nerves abundantly entering into this tissue, norepinephrine released from the sympathetic nerve endings stimulates mostly the β3-AR and activates HSL and UCP1 [20, 59]. Our results suggest that increased β-AR-mediated signaling may induce downstream events including activation of HSL [27] and associated lipolysis. In addition, PPAR-δ regulates fatty acid transport and oxidation and stimulates thermogenesis in adipose tissue [5, 38], which is compatible with the effects observed. Reportedly, the whole signaling pathway except for UCP1 is upregulated following TLQP-21 treatment. UCP1 was clearly upregulated in the WAT following central TLQP-21 in mice fed a standard diet [7] suggesting a transdifferentiation of white into brown adipocytes [18]. In the present study we could not replicate this finding. UCP1 has been found to be unchanged, upregulated or downregulated in the epididymal eWAT during high fat diet [49, 54, 68]. It is therefore premature to draw a definitive conclusion on its modulation and it is thus possible to tentatively conclude that in our study an interaction occurred between two different stimuli on UCP1 expression: HFD having a negative or neutral effect and TLQP-21 determining a stimulatory effect. On the contrary, without any effect of TLQP-21, the mitochondrial UCP2 was clearly upregulated by the high fat feeding [1] in agreement with its putative role in the control of ATP synthesis, regulation of fatty acid metabolism and control of reactive oxygen species production in metabolically active tissues [12, 51].

Changes of gene expression were paralleled by a decrease in serum NE, an increase of E and an increase in the E/NE ratio, thus suggesting an alteration in the normal catecholamines balance as it occurs in a number of adrenal pathological conditions [24]. It is known that denervation of adipose pads is associated with decreased NE and increased expression of β3-AR while the opposite occur with adrenalectomy [31, 53]. β3-AR are more stimulated by local NE and less by E than for example β2-AR and this is due to the reduced affinity to E of β3-AR compared to β1- and β2-AR [55]. However, E may stimulate β3-AR-induced adenylate-cyclase activity [4] and dose-dependently activate lipolysis in vivo [13]. Accordingly, the mechanism which we hypothesize for the effects of TLQP-21 on adipose tissue is the following: TLQP-21 acting centrally (mechanism still to be determined) would decrease sympathetic tone, resulting in overall decreased NE release in the eWAT nerve endings, thus determining an up-regulation of β3-AR (and to a lower extent also of β1-AR and β2-AR); additionally, TLQP-21 would determine increased E release from chromaffin cells in the adrenal medulla [of note, a recent study identified TLQP-immunostaining in E- but not in NE-chromaffin cells in the adrenal medulla of bovine, swine and rat [23]; the net result would be increased E-stimulated β-AR mediated catabolic effects in the fat pads and resulting resistance to obesity. In agreement, preliminary data from our group show that central TLQP-21 may limit immobilization-induced NE release while increasing late E release (Bartolomucci et al., unpublished observations). Alternative explanations would be that: (1) TLQP-21 may normalize the higher basal sympathetic activity described in DIO-prone rats [44, 45]; (2) chronic TLQP-21 infusion may modulate pre-existing differences in adipose tissue gene expression which can predispose mouse to be probe to obesity [39].

In conclusion, we have demonstrated that chronic icv infusion of TLQP-21 prevented diet-induced obesity despite overfeeding associated with the palatable high fat diet. Resistance to fattening was associated with: (1) overall increase of the expression of catabolic markers, the most significant being an increase in β3-AR, in the adipocyte and resulting normalization of hormonal changes usually associated with obesity, i.e., leptin increase and ghrelin decrease; (2) increased E/NE ratio which we speculate could the working mechanism of action of central TLQP-21 activity. Present results are particularly relevant because they: (1) have been obtained in a subpopulation of mice which increased body weight upon exposure to high fat diet; (2) occurred in presence of diet-induced hyperphagia; (3) replicated and extended our original findings with mice fed a standard diet and treated with TLQP-21; (4) further indicated that TLQP-21 may be an important novel target in anti-obesity drug programs [22, 40].

Acknowledgments

Supported by FIRB RBNE01JKLF_ 004 and and FILAS Regione Lazio to A.M., FIRB RBNE01JKLF_006 and FIRB RBNE013XSJ_004 to R.P.; FIRB RBNE01JKLF_008 to V.L. and Fondo di Ateneo per la Ricerca of the University of Milano-Bicocca to A.T. and V.L.; FIRB RBNE01JKLF_ 001 to E.E.M.

Contributor Information

Alessandro Bartolomucci, Phone: +39-0521906175, FAX: +39-0521905657, Email: alessandro.bartolomucci@unipr.it.

Anna Moles, Phone: +39-06-501703275, FAX: +39-06-501703331, Email: anna.moles@ipsifar.rm.cnr.it.

References

  • 1.Abu-Elheiga L, Oh W, Kordari P et al (2003) Acetyl-CoA carboxylase 2 mutant mice are protected against obesity and diabetes induced by high-fat/high-carbohydrate diets. Proc Natl Acad Sci USA 100:10207–10212 [DOI] [PMC free article] [PubMed]
  • 2.Alder J, Thakker-Varia S, Bangasser DA et al (2003) Brain-derived neurotrophic factor-induced gene expression reveals novel actions of vgf in hippocampal synaptic plasticity. J Neurosci 23:10800–10808 [DOI] [PMC free article] [PubMed]
  • 3.Archer ZA, Rayner DV, Rozman J et al (2003) Normal distribution of body weight gain in male Sprague–Dawley rats fed a high-energy diet. Obes Res 11:1376–1383 [DOI] [PubMed]
  • 4.Ballart X, Siches M, Peinado-Onsurbe J et al (2003) Isoproterenol increases active lipoprotein lipase in adipocyte medium and in rat plasma. Biochimie 85:971–982 [DOI] [PubMed]
  • 5.Barish GD, Narkar VA, Evans RM (2006) PPAR delta: a dagger in the heart of the metabolic syndrome. J Clin Invest 116:590–597 [DOI] [PMC free article] [PubMed]
  • 6.Barsh GS, Farooqi IS, O’Rahilly S (2000) Genetics of body-weight regulation. Nature 404:644–651 [DOI] [PubMed]
  • 7.Bartolomucci A, La Corte G, Possenti R et al (2006) TLQP-21, a VGF-derived peptide, increases energy expenditure and prevents the early phase of diet-induced obesity. Proc Natl Acad Sci USA 103:14584–14589 [DOI] [PMC free article] [PubMed]
  • 8.Bartolomucci A, Possenti R, Levi A et al (2007a) The role of the vgf gene and VGF-derived peptides in nutrition and metabolism. Genes Nutr 2:169–180 [DOI] [PMC free article] [PubMed]
  • 9.Bartolomucci A, Rigamonti AE, Bulgarelli I et al (2007b) Chronic intracerebroventricular TLQP-21 delivery does not modulate the GH/IGF-1-axis and muscle strength in mice. Growth Horm IGF Res 17:342–345 [DOI] [PubMed]
  • 10.Bartolomucci A, Moles A, Levi A, Possenti R (2008) Pathophysiological role of TLQP-21: gastrointestinal and metabolic functions. Eat Weight Disord 19:e49–e54 [PubMed]
  • 11.Bozdagi O, Rich E, Tronel S et al (2008) The neurotrophin-inducible gene Vgf regulates hippocampal function and behavior through a brain-derived neurotrophic factor-dependent mechanism. J Neurosci 28:9857–9869 [DOI] [PMC free article] [PubMed]
  • 12.Brand MD, Esteves TC (2005) Physiological functions of the mitochondrial uncoupling proteins UCP2 and UCP3. Cell Metab 2:85–93 [DOI] [PubMed]
  • 13.Burns TW, Mohs JM, Langley PE et al (1974) Regulation of human lipolysis. In vivo observations on the role of adrenergic receptors. J Clin Invest 53:338–341 [DOI] [PMC free article] [PubMed]
  • 14.Cannon B, Nedegaard J (2004) Brown adipose tissue: function and physiological significance. Physiol Rev 84:277–359 [DOI] [PubMed]
  • 15.Carmen GY, Víctor SM (2006) Signalling mechanisms regulating lipolysis. Cell Signal 18:401–408 [DOI] [PubMed]
  • 16.Chakraborty TR, Tkalych O, Nanno D et al (2006) Quantification of VGF- and pro-SAAS-derived peptides in endocrine tissues and the brain, and their regulation by diet and cold stress. Brain Res 1089:21–32 [DOI] [PubMed]
  • 17.Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal Biochem 162:156–159 [DOI] [PubMed]
  • 18.Cinti S (2005) The adipose organ. Prostaglandins Leukot Essent Fatty Acids 73:9–15 [DOI] [PubMed]
  • 19.Cocco C, Brancia C, Pirisi I et al (2007) VGF metabolic-related gene: distribution of its derived peptides in mammalian pancreatic islets. J Histochem Cytochem 55:619–628 [DOI] [PubMed]
  • 20.Collins S, Surwit RS (2001) The beta-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Prog Horm Res 56:309–328 [DOI] [PubMed]
  • 21.Collins S, Daniel KW, Petro AE, Surwit RS (1997) Strain-specific response to beta 3-adrenergic receptor agonist treatment of diet-induced obesity in mice. Endocrinology 138:405–413 [DOI] [PubMed]
  • 22.Costford S, Gowing A, Harper ME (2007) Mitochondrial uncoupling as a target in the treatment of obesity. Curr Opin Clin Nutr Metab Care 10:671–678 [DOI] [PubMed]
  • 23.D’Amato F, Noli B, Brancia C et al (2008) Differential distribution of VGF-derived peptides in the adrenal medulla and evidence for their selective modulation. J Endocrinol 197:359–369 [DOI] [PubMed]
  • 24.Eisenhofer G, Ehrart-Bornestein M, Bornstein SB (2003) The adrenal medulla: physiology and pathophysiology. In: Bolis CL, Licinio J, Govoni S (eds) Handbook of the autonomic nervous system in health and disease. Marcel Dekker, New York, pp 185–224
  • 25.El-Haschimi K, Pierroz DD, Hileman SM et al (2000) Two defects contribute to hypothalamic leptin resistance in mice with diet-induced obesity. J Clin Invest 105:1827–1832 [DOI] [PMC free article] [PubMed]
  • 26.Enriori PJ, Evans AE, Sinnayah P et al (2007) Diet-induced obesity causes severe but reversible leptin resistance in arcuate melanocortin neurons. Cell Metab 5:181–194 [DOI] [PubMed]
  • 27.Fortier M, Wang SP, Mauriège P et al (2004) Hormone-sensitive lipase-independent adipocyte lipolysis during beta-adrenergic stimulation, fasting, and dietary fat loading. Am J Physiol Endocrinol Metab 287:E282–E288 [DOI] [PubMed]
  • 28.Franklin KBJ, Paxinos G (1997) The mouse brain in stereotaxic coordinates. Academic, London
  • 29.Friedman JM (2004) Modern science versus the stigma of obesity. Nat Med 10:563–569 [DOI] [PubMed]
  • 30.Gao Q, Horvath TL (2007) Neurobiology of feeding and energy expenditure. Annu Rev Neurosci 30:367–398 [DOI] [PubMed]
  • 31.Granneman JG, Lahners KN (1992) Differential adrenergic regulation of beta 1- and beta 3-adrenoreceptor messenger ribonucleic acids in adipose tissues. Endocrinology 130:109–114 [DOI] [PubMed]
  • 32.Hahm S, Mizuno TM, Wu TJ et al (1999) Targeted deletion of the Vgf gene indicates that the encoded secretory peptide precursor plays a novel role in the regulation of energy balance. Neuron 23:537–548 [DOI] [PubMed]
  • 33.Hahm S, Fekete C, Mizuno TM et al (2002) VGF is required for obesity induced by diet, gold thioglucose treatment and agouti, and is differentially regulated in POMC- and NPY-containing arcuate neurons in response to fasting. J Neurosci 22:6929–6938 [DOI] [PMC free article] [PubMed]
  • 34.Horvath TL (2005) The hardship of obesity: a soft-wired hypothalamus. Nat Neurosci 8:561–565 [DOI] [PubMed]
  • 35.Hunsberger JG, Newton SS, Bennett AH et al (2007) Antidepressant actions of the exercise-regulated gene VGF. Nat Med 13:1476–1482 [DOI] [PubMed]
  • 36.Jethwa PH, Ebling FJ (2008) Role of VGF-derived peptides in the control of food intake, body weight and reproduction. Neuroendocrinology 88:80–87 [DOI] [PubMed]
  • 37.Jethwa PH, Warner A, Nilaweera KN et al (2007) VGF-derived peptide, TLQP-21, regulates food intake and body weight in Siberian hamsters. Endocrinology 148:4044–4055 [DOI] [PubMed]
  • 38.Kota BP, Huang TH, Roufogalis BD (2005) An overview on biological mechanisms of PPARs. Pharmacol Res 51:85–94 [DOI] [PubMed]
  • 39.Koza RA, Nikonova L, Hogan J et al (2006) Changes in gene expression foreshadow diet-induced obesity in genetically identical mice. PLoS Genet 2:e81 [DOI] [PMC free article] [PubMed]
  • 40.Langin D (2006) Adipose tissue lipolysis as a metabolic pathway to define pharmacological strategies against obesity and the metabolic syndrome. Pharmacol Res 53:482–491 [DOI] [PubMed]
  • 41.Leibowitz SF, Wortley KE (2004) Hypothalamic control of energy balance: different peptides, different functions. Peptides 25:473–504 [DOI] [PubMed]
  • 42.Levi A, Eldridge JD, Paterson BM (1985) Molecular cloning of a gene sequence regulated by nerve growth factor. Science 229:393–395 [DOI] [PubMed]
  • 43.Levi A, Ferri GL, Watson E et al (2004) Processing, distribution, and function of VGF, a neuronal and endocrine peptide precursor. Cellular Mol Neurobiol 24:517–533 [DOI] [PMC free article] [PubMed]
  • 44.Levin BE (1993) Sympathetic activity, age, sucrose preference, and diet-induced obesity. Obes Res 1:281–287 [DOI] [PubMed]
  • 45.Levin BE (1995) Reduced norepinephrine turnover in organs and brains of obesity-prone rats. Am J Physiol 268:R389–R394 [DOI] [PubMed]
  • 46.Levin BE (2007) Why some of us get fat and what we can do about it. J Physiol 583:425–430 [DOI] [PMC free article] [PubMed]
  • 47.Levin BE, Dunn-Meynell AA (2000) Sibutramine alters the central mechanisms regulating the defended body weight in diet-induced obese rats. Am J Physiol Regul Integr Comp Physiol 279:R2222–R2228 [DOI] [PubMed]
  • 48.Lowell BB, Spiegelman BM (2000) Toward a molecular understanding of adaptive thermogenesis. Nature 404:652–660 [DOI] [PubMed]
  • 49.Margareto J, Larrarte E, Marti A et al (2001) Martinez JA: up-regulation of a thermogenesis-related gene (UCP1) and down-regulation of PPARgamma and aP2 genes in adipose tissue: possible features of the antiobesity effects of a beta3-adrenergic agonist. Biochem Pharmacol 61:1471–1478 [DOI] [PubMed]
  • 50.Morgan PJ, Ross AW, Mercer JG et al (2006) What can we learn from seasonal animals about the regulation of energy balance? Prog Brain Res 153:325–337 [DOI] [PubMed]
  • 51.Nedergaard J, Cannon B (2003) The ‘novel’ ‘uncoupling’ proteins UCP2 and UCP3: what do they really do? Pros and cons for suggested functions. Exp Physiol 88:65–84 [DOI] [PubMed]
  • 52.Nonogaki K (2000) New insights into sympathetic regulation of glucose and fat metabolism. Diabetologia 43:533–549 [DOI] [PubMed]
  • 53.Onai T, Kilroy G, York DA et al (1995) Regulation of beta 3-adrenergic receptor mRNA by sympathetic nerves and glucocorticoids in BAT of Zucker obese rats. Am J Physiol 269:R519–R526 [DOI] [PubMed]
  • 54.Prpic V, Watson PM, Frampton IC et al (2002) Adaptive changes in adipocyte gene expression differ in AKR/J and SWR/J mice during diet-induced obesity. J Nutr 132:3325–3332 [DOI] [PubMed]
  • 55.Rayner DV (2001) The sympathetic nervous system in white adipose tissue regulation. Proc Nutr Soc 60:357–364 [DOI] [PubMed]
  • 56.Rigamonti AE, Pincelli AI, Corrà B et al (2002) Plasma ghrelin concentrations in elderly subjects: comparison with anorexic and obese patients. J Endocrinol 75:R1–R5 [DOI] [PubMed]
  • 57.Rindi G, Licini L, Necchi V et al (2007) Peptide products of the neurotrophin-inducible gene vgf are produced in human neuroendocrine cells from early development, and increase in hyperplasia and neoplasia. J Clin Endocrinol Metab 92:2811–2815 [DOI] [PubMed]
  • 58.Rizzi R, Bartolomucci A, Moles A et al (2008) The VGF-derived peptide TLQP-21: a new modulatory peptide for inflammatory pain. Neurosci Lett 441:129–133 [DOI] [PubMed]
  • 59.Robidoux J, Martin TL, Collins S (2004) Beta-adrenergic receptors and regulation of energy expenditure: a family affair. Annu Rev Pharmacol Toxicol 44:297–323 [DOI] [PubMed]
  • 60.Robinson SW, Dinulescu DM, Cone RD (2000) Genetic models of obesity and energy balance in the mouse. Ann Rev Genet 34:687–745 [DOI] [PubMed]
  • 61.Salton SR, Ferri GL, Hahm S et al (2000) VGF: a novel role for this neuronal and neuroendocrine polypeptide in the regulation of energy balance. Front Neuroendocrinol 21:199–219 [DOI] [PubMed]
  • 62.Schwartz MW, Woods SC, Porte D Jr et al (2000) Central nervous system control of food intake. Nature 404:661–671 [DOI] [PubMed]
  • 63.Severini C, Ciotti MT, Biondini L et al (2008) TLQP-21, a neuroendocrine VGF-derived peptide, prevents cerebellar granule cells death induced by serum and potassium deprivation. J Neurochem 104:534–544 [DOI] [PubMed]
  • 64.Succu S, Cocco C, Mascia MS et al (2004) Pro-VGF-derived peptides induce penile erection in male rats: possible involvement of oxytocin. Eur J Neurosci 20:3035–3040 [DOI] [PubMed]
  • 65.Thakker-Varia S, Krol JJ, Nettleton J et al (2007) The neuropeptide VGF produces antidepressant-like behavioral effects and enhances proliferation in the hippocampus. J Neurosci 27:12156–12167 [DOI] [PMC free article] [PubMed]
  • 66.Trani E, Giorgi A, Canu N et al (2002) Isolation and characterization of VGF peptides in rat brain. Role of PC1/3 and PC2 in the maturation of VGF precursor. J Neurochem 81:565–574 [DOI] [PubMed]
  • 67.Uyama N, Geerts A, Reynaert H (2004) Neural connections between the hypothalamus and the liver. Anat Rec A Discov Mol Cell Evol Biol 280:808–820 [DOI] [PubMed]
  • 68.Watson PM, Commins SP, Beiler RJ et al (2000) Differential regulation of leptin expression and function in A/J vs. C57BL/6J mice during diet-induced obesity. Am J Physiol Endocrinol Metab 279:E356–E365 [DOI] [PubMed]
  • 69.Wren AM, Bloom SR (2007) Gut hormones and appetite control. Gastroenterology 132:2116–2130 [DOI] [PubMed]
  • 70.Yamaguchi H, Sasaki K, Satomi Y et al (2007) Peptidomic identification and biological validation of neuroendocrine regulatory peptide-1 and -2. J Biol Chem 282:26354–26360 [DOI] [PubMed]

Articles from Genes & Nutrition are provided here courtesy of BMC

RESOURCES