Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Mar 13.
Published in final edited form as: Plasmid. 2006 Jun 13;56(2):102–111. doi: 10.1016/j.plasmid.2006.05.001

Genetic characterization of the conjugative DNA processing system of enterococcal plasmid pCF10

Jack H Staddon 1, Edward M Bryan 1,1, Dawn A Manias 1, Yuqing Chen 1, Gary M Dunny 1,*
PMCID: PMC2655108  NIHMSID: NIHMS95040  PMID: 16774784

Abstract

Conjugation is a major contributor to lateral gene transfer in bacteria, and pheromone-inducible conjugation systems in Enterococcus faecalis play an important role in the dissemination of antibiotic resistance and virulence in enterococci and related bacteria. We have genetically dissected the determinants of DNA processing of the enterococcal conjugative plasmid pCF10. Insertional inactivation of a predicted relaxase gene pcfG, via insertion of a splicing-deficient group II intron, severely reduced pCF10 transfer. Restoration of intron splicing ability by genetic complementation restored conjugation. The pCF10 origin of transfer (oriT) was localized to a 40-nucleotide sequence within a non-coding region with sequence similarity to origins of transfer of several other plasmids in gram positive bacteria. Deletion of the oriT reduced pCF10 transfer by more than five orders of magnitude without affecting pCF10-dependent mobilization of co-resident oriT-containing plasmids. Although the host range for pCF10 replication is limited to enterococci, we found that the pCF10 conjugation system promotes mobilization of oriT-containing plasmids to multiple bacterial genera. Therefore, this transfer system may have applications for gene delivery to a variety of poorly-transformed bacteria.

Keywords: Pheromone, Mobilization, Relaxase, Origin of transfer, Intron

1. Introduction

Since its identification in 1981 from an Enterococcus faecalis isolate from New York Hospital (Dunny et al., 1981), the 67.7 kb pCF10 plasmid has been a useful model for the study of conjugation in gram positive bacteria (Hirt et al., 2005). pCF10 belongs to a family of pheromone-inducible plasmids that include pAD1, pAM373, and pPD1 and which so far appears to be restricted to the genus Enterococcus (Clewell and Dunny, 2002). Members of this family are of clinical interest because of the virulence (Hirt et al., 2002) and antibiotic resistance determinants (Kak and Chow, 2002) they carry. In addition to promoting the spread of tetracycline resistance and virulence in E. faecalis, a pCF10-like plasmid was directly involved in conjugative mobilization of vancomycin resistance in E. faecium in a hospital environment (Heaton et al., 1996). E. faecalis strain V583, a multi-resistant strain whose complete genome sequence has been determined, contains a plasmid called pTEF2, with a high degree of sequence identity to pCF10 (Paulsen et al., 2003); no experimental analysis of pTEF2 conjugation has been reported. Although the pheromone-responsive regulation systems controlling expression of conjugation functions have been studied extensively, much less is known about the molecular mechanisms by which these plasmids are transferred from donor cells to recipients.

Based on our previously reported comparative sequence analysis (Hirt et al., 2005), the pCF10 and pTEF2 proteins involved in replication, pheromone sensing, and aggregation have significant identity to homologs encoded by other pheromone plasmids in E. faecalis, while the putative mating apparatus and conjugative DNA processing genes of pCF10 and pTEF2 have more similarity to genes encoded by conjugative elements of Streptococcus agalactiae and Lactococcus lactis. The pcfG gene of pCF10 (Fig. 1), predicted to encode a relaxase protein, is most closely related (at both the DNA and protein sequence levels) to the ItrB gene of the lactococcal conjugative element pRS01 (Mills et al., 1994). An interesting feature of ltrB is that the wild-type allele is interrupted by the self-splicing, mobile group II intron Ll.ltrB, the first fully functional group II intron identified in bacteria (Mills et al., 1996). We recently showed that Ll.ltrB efficiently targets DNA of a conserved relaxase domain in pcfG for insertion by a retro-transposition mechanism (Staddon et al., 2004). L1.1trB splices out of pcfG mRNA, such that the host bacterium retains conjugation proficiency. In the present study, we inserted a splicing-deficient derivative of Ll.ltrB into pcfG, which severely reduced conjugation proficiency. This defect was restored by introduction of a helper plasmid providing a protein that restores splicing of the mutant intron. We also localized the pCF10 oriT to a 40-nucleotide sequence between pcfE and pcfF through the use of deletion experiments and mobilization assays. Interestingly pCF10 mobilized plasmids containing the pCF10 oriT in matings with L. lactis and S. agalactiae, even though pCF10 is unable to be stably maintained in non-enterococcal host strains.

Fig. 1.

Fig. 1

Open in a new tab

(A) Linear map of the conjugative DNA processing region of pCF10. For a complete map of this plasmid, see (Hirt et al., 2005). (B) Determination of the minimum pCF10 oriT. Cloned segments of pCF10 DNA are represented by horizontal bars. The position of these segments relative to pcfE and pcfF is shown at the top; note the expanded scale of the lower half of this illustration. The horizontal bar representing the insert in pORIT_16 is magnified, with arrows indicating a perfect 10bp inverted repeat present within the sequence. The boundaries of progressively smaller inserts are shown relative to the insert in pORIT_16. pDL281 is the vector-only control for pMSP2281 while pDL278 is the vector-only control for all other constructs. Transconjugant per donor (T/D) ratios, normalized to pCF10 transfer in the same experiment, and transconjugant per recipient (T/R) ratios are given on the right. Geometric means ± standard deviations for two (pMPS2281 and pDL281) or three (pORIT series and pDL278) independent experiments are given on the right. *Mobilized by pCF10 from OG1RF to OG1ES. †Mobilized by pCF11 from UV202 to OG1ES. **When this region was deleted from pCF10, transfer was abolished.

2. Materials and methods

2.1. General molecular techniques

Plasmid isolations were done using the Qiagen miniprep kits (Valencia, CA). Restriction enzymes were purchased from New England Biolabs (Beverly, MA) or Promega (Madison, WI) and used according to the manufacturers’ instructions. Oligonucleotides and primers were purchased from Integrated DNA Technologies (Coralville, Iowa). PCR was done using a Perkin-Elmer GeneAmp PCR System 2400 (Wellesley, MA), an Eppendorf Mastercycler (Hamburg, Germany), or a TechneTC-412 thermocycler (Burlington, New Jersey), generally with Bio-X-Act polymerase (Bioline, Randolph, MA). Buffer formulations were based on those of the PCR Optimization Kit (Roche Diagnostics GmbH, Mannheim, Germany). DNA sequences were determined by automated dideoxynucleotide sequencing (Advanced Genetic Analysis Center and Microchemical Facility, University of Minnesota).

2.2. Bacterial strains and growth conditions

Escherichia coli DH5α (Gibco-BRL) and E. coli EC1000, a strain that expresses the pWV01 RepA protein (Leenhouts et al., 1996), were used in cloning. All intron insertion experiments were conducted in E. faecalis. Conjugation assays of pCF10 and pCF10 derivatives utilized E. faecalis strains as donors and L. lactis LM2301RF, S. agalactiae COH31r, and several E. faecalis strains (see below) as recipients.

Enterococcus faecalis UV202 is resistant to rifampicin and fusidic acid and is recombination deficient (Yagi and Clewell, 1980). Four plasmid-free E. faecalis strains derived from OG1 were also used in this study. OG1ES is resistant to erythromycin and streptomycin (Staddon et al., 2004). Because of the high degree of natural resistance of other OG1 strains to streptomycin and their exquisite sensitivity to erythromycin, erythromycin alone was typically used to select for OG1ES in mating assays. OG1SSp is resistant to streptomycin and spectinomycin (Dunny et al., 1978). OG1RF is resistant to rifampicin and fusidic acid (Dunny et al., 1991). CK104 is an OG1RF derivative with a deletion of upp, the gene that encodes uracil phosphoribosyltransferase (UPRT) (Kristich et al., 2005). UPRT is required for the metabolism of 5-fluoro-uracil (5-FU) to its toxic metabolite, 5-fluoro-deoxyuridylate. The deletion of upp from the chromosome allows for 5-FU counterselection of plasmids that express UPRT. L. lactis LM2301RF (obtained from L. McKay, Univ. of Minnesota) is resistant to rifampicin and to fusidic acid. S. agalactiae COH31r (obtained from C. Rubens, Children’s Hospital, Seattle, WA) is resistant to rifampicin.

Enterococcus faecalis and S. agalactiae strains were grown in Todd-Hewitt broth (THB). L. lactis was grown in M17 supplemented with 0.5% glucose. E. coli was grown in Luria broth (LB) or in Brain Heart Infusion broth (BHI).

Antibiotics were used at the following concentrations, except when otherwise noted. For E. faecalis: erythromycin, 10 (μg/ml for the plasmid marker and 100 (μg/ml for the chromosomal marker; fusidic acid, 25 (μg/ml; kanamycin, 500–1000 (μg/ml; rifampicin, 200(μg/ml; spectinomycin, 500–1000 μg/ml for plasmid and 150–250 μg/ml for chromosomal marker; streptomycin, 767(μg/ml; tetracycline, 10(μg/ml. For L. lactis: rifampicin, 100(μg/ml; fusidic acid, 25 (μg/ml; spectinomycin, 300 (μg/ml. For S. agalactiae: rifampicin, 200(μg/ml; spectinomycin, 1000(μg/ml. For E. coli: erythromycin, 300 (μg/ml in LB, 75 (μg/ml in BHI; spectinomycin, 30–50 ng/ml. L. lactis was grown at 30 °C. All other strains were grown at 37 °C. E. coli strains were generally grown with aeration.

2.3. Plasmids used in this study

2.3.1. Self-transmissible plasmids

Two conjugative plasmids that encode tetracycline resistance, pCF10 (Dunny et al., 1981) and its derivative, pCF11 (Dunny et al., 1982), were used in this study. pCF11 has a constitutively elevated transfer phenotype, probably due to a point mutation in the pheromone-responsive regulatory region (Bae et al., 2004).

2.3.2. Plasmids used in oriT mobilization studies

Plasmids used in oriT mobilization assays were derivatives of pDL278 and pDL281, both of which encode spectinomycin resistance. Plasmid pDL281 is identical to the pDL278 shuttle plasmid (Dunny et al., 1991) except for the deletion of part of the pDL278 multicloning site between the HindIII and SphI sites (Zhou et al., 2000). Plasmid pMSP2281 was constructed by PCR amplifying the 3′ portion of pcfE and much of the pcfE–pcfF intergenic region (pCF10 nucleotides 32638–32896) subcloned into the pGEMT-Easy vector (Promega) and then cloned into the AhdI site of pDL281. Primers used to amplify the pCF10 sequence were based on the sequence of pTEF2 (Paulsen et al., 2003), resulting in a guanosine instead of an adenosine at position 12 of the insert (pCF10 nucleotide 32,649). Other inserts were obtained by PCR of pCF10 (pORIT_1, nucleotides 32,638–32,896; pORIT_5, nucleotides 32,776–32,896), or by annealing single-stranded oligonucleotides (pORIT_14, nucleotides 32,820–32,840; pORIT_15, nucleotides 32,819–32,861; pORIT_16, nucleotides 32,819–32,858; pORIT_17, nucleotides 32,840–32,861; pORIT_18, nucleotides 32,819–32,849). These inserts were cloned into the multicloning sites of pDL278 or the pDL278 derivative, pORIT_5. DH5α was generally used as an intermediate host during cloning, although in some cases newly-constructed plasmids were directly electroporated into E. faecalis OG1RF. Insert-vector junctions with intervening inserts were sequenced and overall plasmid integrity tested by restriction enzyme digest. Restriction enzyme digests of pORIT_16 were consistent with the deletion of approximately 400 nucleotide in the vector sequence counterclockwise to the multicloning site. This region includes the T1T2 terminator region, which is composed of two tandem copies (pDL278 nucleotides 5063–5561, 5561–6059) of the 3′ portion of the rrnB ribosomal RNA operon of E. coli. This deletion did not affect the pCF10 insert sequence, nor did it have any discernable effect on pORIT_16 replication.

2.3.3. pCF10ΔoriT

Fifty-four nucleotides in the pcfE–pcfF intergenic region (pCF10 nucleotides 32,812–32,866) were deleted and replaced with a PstI site (CTGCAG), using an improved allelic exchange system recently described in detail (Kristich et al., 2005). DNA from upstream and downstream of the region to be deleted was PCR amplified and cloned into pCJK2, a pORI280 (Leenhouts et al., 1996) derivative. Primers used to amplify the upstream fragment incorporated XmaI and PstI restriction enzyme sites while primers used to amplify the downstream fragment incorporated PstI and XbaI sites, simplifying stepwise cloning into pCJK2. The resulting plasmid, pCJK2::ΔoriT, was electroporated into EC1000, followed by plasmid isolation, confirmation of the DNA sequence by dideoxynucleotide sequencing, and electroporation into E. faecalis CK104/(pCF10, pVE6007). Transformants (CK104/(pCF10, pVE6007, pCJK2::ΔoriT)) were selected at 30°C in 200 μl THB supplemented with 0.5M sucrose and erythromycin (induction at 50ng/ml for 1.5h; selection at 5μg/ml for 1.5h). A shift in temperature to 37°C for 4h (abolishing pCJK2::ΔoriT replication) in the continued presence of erythromycin selected for integration of pCJK2:: Δ oriT into pCF10 by single cross-over recombination. Transformants were plated out on THB plates supplemented with X-Gal (250μg/ml) and erythromycin (10μg/ml) and incubated overnight. A resulting blue colony was grown overnight in THB supplemented with erythromycin. The culture was then diluted by a factor of 108–109 and incubated at 37°C for 30 h in BHI supplemented with tetracycline in the absence of erythromycin to allow for excision of the integrated pCJK2::ΔoriT from pCF10. The resulting culture was then plated out on BHI plates supplemented with tetracycline and 5-FU (130μg/ml). Bacteria from these plates were subsequently replated on BHI plates, supplemented with tetracycline, 5-FU (130μg/ml), and X-Gal (250μg/ml). White colonies were picked and plated on BHI plates that also contained tetracycline, 5-FU, and X-Gal. PCR was used to screen for the deletion of oriT in pCF10. The precise deletion, with replacement by the PstI site, was confirmed by automated DNA sequencing of PCR product from the CK104/(pCF10ΔoriT) strain used in subsequent experiments. Plasmid pORIT_15 was electroporated into both CK104/(pCF10) and CK104/(pCF10ΔoriT) strains for use in the experiments presented in Table 2.

Table 2.

Ability of pCF10ΔoriT to mobilize an oriT-containing plasmid

Donor genotype Plasmid selected T/D ratio
CK104(pCF10ΔoriT, pORIT_15) pCF10ΔoriT <7.1 × 10−8; <6.1 × 10−8
pORIT_15 2.1 × 10−2; 6.2 × 10−2
CK104(pCF10, pORIT_15) pCF10 7.5 × 10−3; 9.7 × 10−2
pORIT_15 1.5 × 10−2; 2.2 × 10−2
Open in a new tab

Transconjugant per donor (T/D) ratios of conjugation experiments, given as the result of each independent experiment. OG1ES was the recipient strain in all cases.

2.3.4. Plasmids used in pcfG functional analysis

Plasmid pCF10::Ll.ltrBΔORF-Kan consists of a splicing-deficient Ll.ltrB derivative inserted into the Ll.ltrB target site in pcfG. This plasmid was constructed by introducing pLEIItd+KR” ΔORF (Staddon et al., 2004) and pCOMΔA13.16 (Klein et al., 2004) into OG1RF/(pCF10) by electroporation. PLEIItd+KR” ΔORF encodes for the splicing-deficient Ll.ltrBΔORF-Kan intron (Staddon et al., 2004). Plasmid pCOMΔA13.16 confers production of LtrA for Ll.ltrBΔORF-Kan splicing and insertion into pcfG. Following Ll.ltrBΔORF-Kan insertion into pcfG, pCF10::Ll.ltrBΔORF-Kan was conjugated to the plasmid-free OG1SSp strain. Insertion of Ll.ltrBΔORF-Kan into pCF10 and the absence of pLEIItd+KR” ΔORF were confirmed by PCR. The sequence of the 3′ intron–exon junction between Ll.ltrBΔORF-Kan and pCF10 was confirmed by automated sequencing (Advanced Genetic Analysis Center, University of Minnesota). Plasmid pMSP3545ltrA contains a complete wild-type copy of ltrA cloned under the control of the nisin promoter of pMSP3545 (Bryan et al., 2000) and was used to complement splicing of Ll.ltrBΔORF-Kan expressed from pCF10::Ll.ltrBΔORF-Kan.

2.4. Electroporation

Electroporation of plasmids into E. coli and E. faecalis utilized the Bio-Rad Gene Pulser, Philadelphia, Pennsylvania (1.7kV, 200Ω, and 25μF; 1 mm diameter cuvettes) as previously described (Staddon et al., 2004).

2.5. Conjugation and mobilization assays

Cultures of donor and plasmid-free recipient E. faecalis strains were grown overnight in THB+ antibiotics. Donor and recipient cultures were washed in THB to remove antibiotics before being mixed for matings. Overnight cultures were generally diluted 1:9 or 1:10 in fresh THB and pre-incubated to ensure that cultures were in exponential phase during the matings. In experiments involving pCF10, donor cells were induced with cCF10 (20–50 ng/ml). Pre-incubation of the slower-growing UV202/(pCF11) strain was generally not done, nor was cCF10 induction performed with pCF11. Donor and recipient bacteria were combined in THB with an approximate 1:10 donor to recipient ratio and incubated at 37°C. Quantitation of colony forming units (CFU) on THB agar with relevant selective antibiotics followed. Transconjugant to donor ratios were calculated by dividing the number of CFU/ml resistant to both a recipient chromosomal marker and a plasmid-mediated marker by the number of CFU resistant to donor antibiotic markers. Since the transfer frequency of pCF10 can vary more the 10-fold in replicate experiments carried out under identical conditions, we normalized the frequency of mobilization of oriT-containing non-conjugative plasmids to that of pCF10 transfer from the same donor strain in the mobilization experiments reported here. Microsoft Excel was used to calculate geometric means and standard deviations in genetic assays utilizing conjugation.

Conjugative transfer of pCF10::Ll.ltrBΔORF-Kan was tested in the presence and absence of pMSP3545ltrA, which was introduced by electroporation into the donor strain. pMSP3545ltrA was induced with nisin, 25 ng/ml. Induction of the donor strains with cCF10 (±nisin) was done for 3 h prior to a 30-min broth mating with recipients and the transfer levels of pCF10::Ll.ltrBΔORF-Kan compared to the transfer levels of wild-type pCF10. All pCF10::Ll.ltrBΔORF and pCF10 mating assays utilized OG1SSp donor hosts and OG1RF recipients.

Plasmid pMSP2281 (and the vector-only pDL281 control) were tested for their ability to be mobilized in 1–2h matings by pCF11 in matings between UV202 donor strains and OG1ES. Donor to recipient CFU ratios in these assays ranged from 1:17 to 1:241. Two independent experiments were done for each mating. Plasmids in the pORIT series and their pDL278 control were tested for their ability to be mobilized by pCF10 in matings between OG1RF donor strains and OG1ES. In these experiments, donor and recipient overnight cultures were diluted 1:9 or 1:10 in fresh medium and incubated for 3–3.5 h at 37°C. Donor strains were supplemented with cCF10 (50 ng/ml). Cultures were then mixed at a 1:9 or 1:10 donor to recipient ratio by volume and incubated for 30 min at 37°C. Donor to recipient CFU ratios ranged between 1:10 and 1:38. To control for possible variations in pCF10 induction levels, mobilization levels were normalized by dividing the transconjugant to donor ratio of the mobilized plasmid by the transconjugant to donor ratio of pCF10 in the same experiment. Three independent mobilization assays were done with each member of the pORIT series and with pDL278.

Surface matings of pORIT_16 from E. faecalis OG1ES/(pCF10, pORIT_16) to E. faecalis OG1RF, L. lactis LM2301RF, and S. agalactiae COH31r were done as follows. One milliliter aliquots of overnight cultures was washed thoroughly to remove antibiotics, diluted 1:9 with fresh media, and incubated for 3h. OG1ES/(pCF10, pORIT_16) was supplemented with cCF10 (50 ng/ml) during the 3-h incubation. Next, 20 μl donor culture and 200 μl recipient culture were mixed on antibiotic free plates and incubated overnight at 37°C for 20 h. Plates were washed with potassium phosphate-buffered saline (KPBS), followed by dilutions in KPBS and enumeration of CFUs on the selective plates. GM17 (M17 medium (Becton Dickinson) + 0.5% glucose) plates were used in matings that involved L. lactis and when selecting for L. lactis. THB agar plates were used with all other species. Two independent experiments of each mating pair were done. Enumerations were done by making parallel triplicate serial dilutions of each culture and plating three replicate plates from the appropriate dilutions of each dilution series. Suspected transconjugant colonies were patched serially to eliminate contamination. Purified colonies were submitted to PCR analysis (using Bio-X-Act polymerase in Techne TC 412 thermocycler). Primers that anneal to the pUC multicloning site flanking the oriT in pORIT_16 (5′ CCCAGTCACGACGTTGTAAAACG 3′, 5′ GGA AACAGCTATGACCATGATTAC 3′) were used. Donor strain OG1ES/(pCF10, pORIT_16) and the recipient plasmid-free strains were used as positive and negative controls, respectively. Plasmid content of three transconjugants showing positive PCR reactions was confirmed by restriction enzyme digests of plasmid preparations from pure transconjugant cultures. Single vector-only plate matings from E. faecalis OG1ES/(pCF10, pDL278) to L. lactis LM2301RF and to S. agalactiae COH31r were done as negative controls.

2.6. Computer analyses

Protein and DNA searches and sequence alignments (Altschul et al., 1997) utilized online software at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/). Multiple sequence alignments of DNA and protein utilized a Seqweb version of GCG (Wisconsin Package) and online alignment tools available at the Baylor College of Medicine website (http://searchlauncher.bcm.tmc.edu/multi-align), the Canadian Bioinformatics Resource website (http://www.cbr.nrc.ca), and/or the multialign sequence program by Florence Corpet (http://prodes.toulouse.inra.fr/multalin/) (Corpet, 1988). Searches for inverted repeats utilized the DNA Strider program (Douglas, 1995).

3. Results

3.1. pcfG is essential for conjugation

pcfG encodes a 561 amino acid protein with sequence similarity to relaxases (Staddon et al., 2004). We used a splicing-deficient version of the Ll.ltrB group II intron, Ll.ltrBΔORF, to insertionally inactivate pcfG. Ll.ltrBΔORF is splicing-deficient due to the deletion of most the Ll.ltrB intron-encoded protein gene ltrA (Cousineau et al., 1998). The resulting plasmid, pCF10::Ll.ltrBΔORF, was reduced in conjugation efficiency by more than five orders of magnitude compared to wild-type pCF10 (Table 1). The effect on conjugation was specific to the insertion event since the presence in trans of plasmid pMSP3545ltrA, which encodes LtrA from a nisin-inducible promoter and allows the defective intron to splice, restored conjugative transfer (Table 1).

Table 1.

Effect of pcfG insertional mutagenesis on pCF10 transfer

Plasmid T/D ratio
pCF10 4.0 × 10−3; 5.7 × 10−2
pCF10::Ll.ltrBΔORF-Kan <4.6 × 10−8; <1.1 × 10−7
pCF10::Ll.ltrBΔORF-Kan, pMSP3545ltrA (nisin induction) 1.1 × 10−3; 2.6 × 10−2
Open in a new tab

Transconjugant per donor (T/D) ratios are given from two independent experiments.

3.2. The pcfE-pcfF intergenic region contains a functional oriT

Origins of transfer are often located in intergenic regions upstream of their cognate relaxase genes (Francia et al., 2004). There is a 245 bp intergenic region between pcfE and pcfF (Fig. 1A). We cloned a 259-bp segment corresponding to pCF10 nucleotides 32,638-32,896 (Hirt et al., 2005) most of this region (as well as the 3′ portion of pcfE) into shuttle vectors pDL278 and pDL281. The resulting plasmids, pORIT_l, and pMSP2281, were both mobilized at high frequency in broth matings between enterococcal strains (Fig. 1B). Mobilization was independent of homologous recombination, as demonstrated by the high-frequency transfer of pMSP2281 in experiments using the recombination-deficient UV202 as the donor strain (Fig. 1).

Deletion analysis demonstrated that the minimum functional oriT resides within the 40 bp sequence contained in pORIT_16 (Fig. 1B). A 20 bp sequence containing a perfect 10-nucleotide inverted repeat is necessary but not sufficient for mobilization, as demonstrated by the inability of pCF10 to mobilize pORIT_17 and pORIT_14. Additional nucleotides to the right of the inverted repeat are also required for high frequency mobilization, as demonstrated by the low transfer frequency of pOR-IT_18 (Fig. 1B).

3.3. Deletion of the functional oriT abolishes pCF10 conjugation

The enterococcal pheromone plasmid pAD1 has two origins of transfer (Francia and Clewell, 2002). To determine whether the pcfE–pcfF intergenic region contains the sole functional oriT in pCF10, a 54-bp region encompassing the entire minimum oriT described above (Fig. 1) was replaced by a PstI restriction enzyme site (Section 2.). The resulting plasmid, pCF10ΔoriT, was reduced in conjugation frequency by more than five orders of magnitude compared with pCF10 (Table 2). This reduction was not due to polar effects on other genes since the deletion had no effect on pORIT_15 mobilization (Table 2). Therefore, the pcfE–pcfF intergenic region contains the sole functional oriT for the pCF10 pheromone-inducible conjugation system.

3.4. pCF10 mobilizes pOBIT plasmids to Lactococcus lactis and Streptococcus agalactiae

Plate mating assays were performed to determine whether pCF10 is capable of mobilizing oriT-containing plasmids to related bacterial species; we carried out plate matings because the pheromone-inducible aggregation system required for efficient mating in liquid cultures only functions with enterococcal recipient strains. E. faecalis OG1ES/(pCF10 pORIT_16) was mated with L. lactis LM2301RF and S. agalactiae COH31r. Mobilization frequencies to L. lactis recipients were about 1%–10% those of plate matings using E. faecalis recipients. S. agalactiae showed a recipient ability of about 1% relative to L. lactis. In all cases the oriT-containing plasmid was transferred at frequencies two to five orders of magnitude greater than that of the pDL278 vector control (Table 3). Mobilization was confirmed by colony PCR and restriction enzyme digests of oriT-containing plasmid DNA isolated from transconjugant bacteria (data not shown).

Table 3.

pCF10-mediated mobilization in plate matings within and between species

Mobilized plasmid Recipient T/R ratio
pORIT_16 L. lactis LM2301RF 4.4 × 1−3; 2.2 × 10−4
pDL278 L. lactis LM2301RF 4.9 × 10−9a
pORIT_16 S. agalactiae COH3lr 3.8 × 1−6; 7.7 × 10−6
pDL278 S. agalactiae COH3lr 9.6 × 10−9a
pORIT_16 E. faecalis OG1RF 1.7 × 10−2; 8.7 × 10−3
Open in a new tab

Donor strains were OG1ES/(pCF10, pORIT_16) or OG1ES/(pCF10, pDL278). Transconjugant per recipient (T/R) ratios are given for each individual experiment.

a

Plasmid content of these putative transconjugants not confirmed by PCR; they may represent background spontaneous antibiotic resistance mutations.

4. Discussion

We used a splicing-deficient version of Ll.ltrB deleted for ltrA to create an insertion mutation in pcfG that was complemented by a co-resident plasmid that expresses LtrA. Ll.ltrB insertion into DNA target sites depends upon a combination of LtrA-target site and intron RNA-target site interactions (Singh et al., 2002). EBS (exon binding site) and ∂ nucleotides within the intron base pair with IBS (intron binding site) and ∂′ nucleotides flanking the intron insertion site (Mohr et al., 2000). Since Ll.ltrB targets a conserved DNA motif found in pcfG and several other relaxase genes (Staddon et al., 2004), we used an intron with the wild-type EBS and ∂ nucleotide sequence to inactivate pcfG. Splicing-deficient versions of Ll.ltrB have been engineered by the modification of EBS and ∂ nucleotides to knock out specific chromosomal genes in E. coli (Perutka et al., 2004) and L. lactis (Frazier et al., 2003). Similar techniques could be applied for mutagenesis in other gram positive bacteria, perhaps using Ll.ltrB derivatives cloned into pORIT plasmids for delivery by conjugation.

The sharp reduction in conjugation caused by Ll.ltrBΔORF insertion in pcfG and its restoration by expression of ltrA in trans indicates that pcfG plays a central role in conjugation. The PcfG sequence is related to relaxases of the IncP type, with the highest similarity to relaxases in gram positive bacteria, such as the pRS01 relaxase, ltrB (Staddon et al., 2004). The pCF10 oriT is 75% identical to a sequence found in the pRS01 oriT (Mills et al., 1998). There is also nucleotide identity with sequences of other mobile genetic elements, particularly in a highly conserved stretch of six nucleotides to the right of inverted repeats (Fig. 2). Interestingly, relaxase nic sites in pC221, pC223 (Caryl et al., 2004), and RP4 (a plasmid found in gram negative bacteria; Pansegrau et al., 1988) are located within homologs of this conserved sequence (Fig. 2). Perhaps functional constraints imposed by protein–DNA interactions to the right of the inverted repeat have selected for conservation of this sequence in pCF10. Additional nucleotide(s) to the right of the conserved GCTTGC sequence are clearly required for optimal pCF10 oriT function since pORIT_18, whose oriT insert includes but does not extend beyond the conserved sequence, was poorly mobilized by pCF10 (Fig. 1). In spite of the high degree of conservation between the pCF10 and pRS01 relaxases and oriT sequences, preliminary results from our laboratory (Y. Chen and G. Dunny, unpublished) indicate that the two oriT regions do not function efficiently with the heterologous DNA processing proteins. Thus, comparative analysis of the conjugative DNA processing systems of pRS01 and pCF10 may yield interesting insights into the molecular basis for the specificity of relaxosome formation.

Fig. 2.

Fig. 2

Open in a new tab

Alignment of the minimal pCF10 oriT with other origins of transfer. The pCF10 oriT sequence corresponds to the insert in pORIT_16. Horizontal arrows indicate inverted repeats, vertical arrows (⇓) show experimentally demonstrated nick sites. Nucleotide conservation with the pCF10 sequence is indicated in bold. The pRS01 sequence is part of a 446 bp functional oriT sequence (Mills et al., 1998), while the Tn5252 sequence is part of a 2-kb sequence that includes the relaxase substrate (Srinivas et al., 1997). Nick sites have been experimentally demonstrated in pC221, pC223, and RP4 (Pansegrau et al., 1988; Caryl et al., 2004). The single asterisk is explained in the legend to Fig. 1.

Mobilization of oriT-containing plasmids to E. faecalis, L. lactis, and S. agalactiae recipient strains suggests that the pCF10 oriT system may be generally useful as a gene delivery system. Plasmid pORIT_16 transfer to L. lactis LM2301RF corresponded to approximately 5 × 105 transconjugants per plate mating, 10–100× greater than the electrotransformation efficiency of 1 μg of purified pDL278 into L. lactis (Dunny et al., 1991). The improved efficiency that conjugation offers over electrotransformation is even more dramatic in E. faecalis, where pORIT_16 mobilization resulted in over 108 transconjugants per plate mating. This is three to four orders of magnitude greater than the electrotransformation efficiency in E. faecalis of another plasmid with the same replicon (pVA380-l) (Dunny et al., 1991). The improved efficiency of conjugation over electroporation will be particularly helpful in the delivery of suicide vectors for mutagenesis of gram positive bacteria. Allelic exchange in gram positive bacteria often requires a two-step process (Biswas et al., 1993; Leenhouts et al., 1996). The first step involves selection of plasmid transformants under conditions that permit replication of the plasmid. In the second step conditions, such as temperature, is changed so that the transformed plasmid can no longer autonomously replicate, allowing for the selection of single cross-over co-integration. Highly efficient conjugation systems may obviate the need for this laborious two-step process for allelic exchange, as well as facilitating the efficient delivery of transposons for random mutagenesis.

The mobilization of oriT-containing plasmids to L. lactis and S. agalactiae demonstrate that the pCF10 mating apparatus can support DNA transfer to these species. Interestingly, several putative mating pore and DNA processing proteins encoded by pCF10 have greater sequence similarity to proteins encoded in L. lactis and S. agalactiae than to their counterparts encoded by other enterococcal pheromone plasmids (Hirt et al., 2005). Our observation that pCF10 mobilizes oriT plasmids to other species is consistent with a role for cross-species gene transfer in the evolution of pCF10 and suggests that lateral gene transfer is responsible for the widespread distribution of pcfG-like relaxase genes in gram-positive bacteria (Staddon et al, 2004).

Acknowledgments

The authors thank Larry McKay of the University of Minnesota for the generous gift of L. lactis LM2301RF, Craig Rubens of the University of Washington for the generous gift of S. agalactiae COH3r, and Chris Kristich from our laboratory for supplying strains and integrative plasmids prior to publication. This work was supported by PHS Grant 1RO1-GM49530 from the NIH to G.M.D. J.H.S. was supported by NIH training Grants T32AI07421, T32GM08347, and MSTP grant T32GM08244. E.M.B. was supported by NIH training Grant T32AI07421.

References

  1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bae T, Kozlowicz BK, Dunny GM. Characterization of cis-acting prgQ mutants: evidence for two distinct repression mechanisms by Qa RNA and PrgX protein in pheromone-inducible enterococcal plasmid pCF10. Mol Microbiol. 2004;51:271–281. doi: 10.1046/j.1365-2958.2003.03832.x. [DOI] [PubMed] [Google Scholar]
  3. Biswas I, Gruss A, Ehrlich SD, Maguin E. High-efficiency gene inactivation and replacement system for gram-positive bacteria. J Bacteriol. 1993;175:3628–3635. doi: 10.1128/jb.175.11.3628-3635.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bryan EM, Bae T, Kleerebezem M, Dunny GM. Improved vectors for nisin-controlled expression in gram-positive bacteria. Plasmid. 2000;44:183–190. doi: 10.1006/plas.2000.1484. [DOI] [PubMed] [Google Scholar]
  5. Caryl JA, Smith MC, Thomas CD. Reconstitution of a staphylococcal plasmid-protein relaxation complex in vitro. J Bacteriol. 2004;186:3374–3383. doi: 10.1128/JB.186.11.3374-3383.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Clewell DB, Dunny GM. Conjugation and genetic exchange in enterococci. In: Gilmore MS, Clewell DB, Courvalin P, Dunny GM, Murray BE, Rice LB, editors. The Enterococci: Pathogenesis, Molecular Biology and Antibiotic Resistance. American Society for Microbiology Press; Washington, DC: 2002. pp. 265–300. [Google Scholar]
  7. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16:10881–10890. doi: 10.1093/nar/16.22.10881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cousineau B, Smith D, Lawrence-Cavanagh S, Mueller JE, Yang J, Mills D, Manias D, Dunny G, Lambowitz AM, Belfort M. Retrohoming of a bacterial group II intron: mobility via complete reverse splicing, independent of homologous DNA recombination. Cell. 1998;94:451–462. doi: 10.1016/s0092-8674(00)81586-x. [DOI] [PubMed] [Google Scholar]
  9. Douglas SE. DNA strider. An inexpensive sequence analysis package for the Macintosh. Mol Biotechnol. 1995;3:37–45. doi: 10.1007/BF02821333. [DOI] [PubMed] [Google Scholar]
  10. Dunny G, Funk C, Adsit J. Direct stimulation of the transfer of antibiotic resistance by sex pheromones in Streptococcus faecalis. Plasmid. 1981;6:270–278. doi: 10.1016/0147-619x(81)90035-4. [DOI] [PubMed] [Google Scholar]
  11. Dunny G, Yuhasz M, Ehrenfeld E. Genetic and physiological analysis of conjugation in Streptococcus faecalis. J Bacteriol. 1982;151:855–859. doi: 10.1128/jb.151.2.855-859.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dunny GM, Brown BL, Clewell DB. Induced cell aggregation and mating in Streptococcus faecalis: evidence for a bacterial sex pheromone. Proc Natl Acad Sci USA. 1978;75:3479–3483. doi: 10.1073/pnas.75.7.3479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dunny GM, Lee LN, LeBlanc DJ. Improved electroporation and cloning vector system for gram-positive bacteria. Appl Environ Microbiol. 1991;57:1194–1201. doi: 10.1128/aem.57.4.1194-1201.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Francia MV, Clewell DB. Transfer origins in the conjugative Enterococcus faecalis plasmids pAD1 and pAM373: identification of the pAD1 nic site, a specific relaxase and a possible TraG-like protein. Mol Microbiol. 2002;45:375–395. doi: 10.1046/j.1365-2958.2002.03007.x. [DOI] [PubMed] [Google Scholar]
  15. Francia MV, Varsaki A, Garcillan-Barcia MP, Latorre A, Drainas C, de la Cruz F. A classification scheme for mobilization regions of bacterial plasmids. FEMS Microbiol Rev. 2004;28:79–100. doi: 10.1016/j.femsre.2003.09.001. [DOI] [PubMed] [Google Scholar]
  16. Frazier CL, San Filippo J, Lambowitz AM, Mills DA. Genetic manipulation of Lactococcus lactis by using targeted group II introns: generation of stable insertions without selection. Appl Environ Microbiol. 2003;69:1121–1128. doi: 10.1128/AEM.69.2.1121-1128.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Heaton MP, Discotto LF, Pucci MJ, Handwerger S. Mobilization of vancomycin resistance by transposon-mediated fusion of a Van A plasmid with an Enterococcus faecium sex pheromone-response plasmid. Gene. 1996;171:9–17. doi: 10.1016/0378-1119(96)00022-4. [DOI] [PubMed] [Google Scholar]
  18. Hirt H, Manias DA, Bryan EM, Klein JR, Marklund JK, Staddon JH, Paustian ML, Kapur V, Dunny GM. Characterization of the pheromone response of the Enterococcus faecalis conjugative plasmid pCF10: complete sequence and comparative analysis of the transcriptional and pheno-typic responses of pCF10-containing cells to pheromone induction. J Bacteriol. 2005;187:1044–1054. doi: 10.1128/JB.187.3.1044-1054.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hirt H, Schlievert PM, Dunny GM. In vivo induction of virulence and antibiotic resistance transfer in Enterococcus faecalis mediated by the sex pheromone-sensing system of pCF10. Infect Immun. 2002;70:716–723. doi: 10.1128/iai.70.2.716-723.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kak V, Chow JW. Acquired antibiotic resistances in enterococci. In: Gilmore MS, Clewell DB, Courvalin P, Dunny GM, Murray BE, Rice LB, editors. The Enterococci. Pathogenesis, Molecular Biology, and Antibiotic Resistance. American Society for Microbiology Press; Washington, DC: 2002. pp. 355–383. [Google Scholar]
  21. Klein JR, Chen Y, Manias DA, Zhuo J, Zhou L, Peebles CL, Dunny GM. A conjugation-based system for genetic analysis of group II intron splicing in Lactococcus lactis. J Bacteriol. 2004;186:1991–1998. doi: 10.1128/JB.186.7.1991-1998.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kristich CJ, Manias DA, Dunny GM. Development of a method for markerless genetic exchange in Enterococcus faecalis and its use in construction of a srtA mutant. Appl Environ Microbiol. 2005;71:5837–5849. doi: 10.1128/AEM.71.10.5837-5849.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Leenhouts K, Buist G, Bolhuis A, ten Berge A, Kiel J, Mie-rau I, Dabrowska M, Venema G, Kok J. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol Gen Genet. 1996;253:217–224. doi: 10.1007/s004380050315. [DOI] [PubMed] [Google Scholar]
  24. Mills DA, Choi CK, Dunny GM, McKay LL. Genetic analysis of regions of the Lactococcus lactis subsp lactis plasmid pRS10 involved in conjugative transfer. Appl Environ Microbiol. 1994;60:4413–4420. doi: 10.1128/aem.60.12.4413-4420.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mills DA, McKay LL, Dunny GM. Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci. J Bacteriol. 1996;178:3531–3538. doi: 10.1128/jb.178.12.3531-3538.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Mills DA, Phister TG, Dunny GM, McKay LL. An origin of transfer (oriT) on the conjugative element pRS01 from Lactococcus lactis subsp lactis ML3 . Appl Environ Microbiol. 1998;64:1541–1544. doi: 10.1128/aem.64.4.1541-1544.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mohr G, Smith D, Belfort M, Lambowitz AM. Rules for DNA target-site recognition by a lactococcal group II intron enable retargeting of the intron to specific DNA sequences. Genes Dev. 2000;14:559–573. [PMC free article] [PubMed] [Google Scholar]
  28. Pansegrau W, Ziegelin G, Lanka E. The origin of conjugative IncP plasmid transfer: interaction with plasmid-encoded products and the nucleotide sequence at the relaxation site. Biochim Biophys Acta. 1988;951:365–374. doi: 10.1016/0167-4781(88)90108-x. [DOI] [PubMed] [Google Scholar]
  29. Paulsen IT, Banerjei L, Myers GS, Nelson KE, Seshadri R, Read TD, Fouts DE, Eisen JA, Gill SR, Heidelberg JF, Tettelin H, Dodson RJ, Umayam L, Brinkac L, Beanan M, Daugherty S, DeBoy RT, Durkin S, Kolonay J, Madupu R, Nelson W, Vamathevan J, Tran B, Upton J, Hansen T, Shetty J, Khouri H, Utterback T, Radune D, Ketchum KA, Dougherty BA, Fraser CM. Role of mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science. 2003;299:2071–2074. doi: 10.1126/science.1080613. [DOI] [PubMed] [Google Scholar]
  30. Perutka J, Wang W, Goerlitz D, Lambowitz AM. Use of computer-designed group II introns to disrupt Escherichia coli DExH/D-box protein and DNA helicase genes. J Mol Biol. 2004;336:421–439. doi: 10.1016/j.jmb.2003.12.009. [DOI] [PubMed] [Google Scholar]
  31. Singh RN, Saldanha RJ, D’Souza LM, Lambowitz AM. Binding of a group II intron-encoded reverse transcriptase/maturase to its high affinity intron RNA binding site involves sequence-specific recognition and autoregulates translation. J Mol Biol. 2002;318:287–303. doi: 10.1016/S0022-2836(02)00054-2. [DOI] [PubMed] [Google Scholar]
  32. Srinivas P, Kilic AO, Vijayakumar MN. Site-specific nicking in vitro at oriT by the DNA relaxase of Tn5252. Plasmid. 1997;37:42–50. doi: 10.1006/plas.1996.1268. [DOI] [PubMed] [Google Scholar]
  33. Staddon JH, Bryan EM, Manias DA, Dunny GM. Conserved target for group II intron insertion in relaxase genes of conjugative elements of gram-positive bacteria. J Bacteriol. 2004;186:2393–2401. doi: 10.1128/JB.186.8.2393-2401.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yagi Y, Clewell DB. Recombination-deficient mutant of Streptococcus faecalis. J Bacteriol. 1980;143:966–970. doi: 10.1128/jb.143.2.966-970.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhou L, Manias DA, Dunny GM. Regulation of intron function: efficient splicing in vivo of a bacterial group II intron requires a functional promoter within the intron. Mol Microbiol. 2000;37:639–651. doi: 10.1046/j.1365-2958.2000.02033.x. [DOI] [PubMed] [Google Scholar]

RESOURCES