Abstract
The frequency of prophage carriage was tested in a collection of 108 clinical isolates of Streptococcus pneumoniae. A PCR-based assay was developed to allow classification of the prophage into the three groups recently identified according to genome comparisons (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). Use of the assay showed that more than half of the isolates studied were lysogenic with prophage belonging to group 1 being the most abundant (56%), followed by those belonging to group 2 (26%) and those belonging to group 3 (11%). Four polylysogenic strains harboring a group 1 and a group 2 prophage were identified. Interestingly, lysogenic strains were found in 8 out of the 12 internationally distributed, relevant clones of S. pneumoniae contained in our strain collection. The high percentage of clinical pneumococcal isolates harboring prophage strongly suggests an important contribution to the diversification of the genome architecture in this species as well as a role for bacteriophage in the virulence/and or fitness of S. pneumoniae, although further studies using a significant number of isolates belonging to the most relevant pneumococcal clones are needed.
Streptococcus pneumoniae is a gram-positive human pathogen and is the leading cause of pneumonia, meningitis, and bloodstream infections in the elderly and of middle ear infections in young children. The abundance of temperate bacteriophage in Streptococcus pneumoniae clinical isolates has been reported in different studies in the past (3, 24). The most recent work suggested that prophage is present in 76% of the clinical strains (24). Until recently, the complete nucleotide sequence of only three pneumococcal phage had been published (18, 19, 23). Prophages have been intensively studied in several pathogenic streptococci (7). In S. pneumoniae, the presence of highly similar prophages in several clinical isolates of different capsular serotypes has been reported, although no role has been assigned to their presence (11).
In the last few years, the relatively low cost and the development of new sequencing technologies have provided the sequences of numerous S. pneumoniae genomes that contain temperate bacteriophage (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). As a result of the genetic analysis of the genome of S. pneumoniae temperate bacteriophage, we have designed specific primers to test for the presence of prophage. In our report, a collection of 108 S. pneumoniae isolates was assembled as a representative population of the genetic heterogeneity of invasive pneumococci as well as of those that are carried asymptomatically in the human nasopharynx. Our aim was to study the presence of temperate bacteriophage and their distribution in a collection of S. pneumoniae clinical isolates covering the most common serogroups/serotypes and sequence types (STs). The specificity of the primers allowed us to detect the presence in individual strains of those bacteriophage identified in our previous report (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). Our results showed that bacteriophage is distributed in almost all serotypes studied. Interestingly, we found that strains appearing to be identical under high-resolution typing methods were sometimes shown to carry different phage contents.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
A total of 108 S. pneumoniae strains, representative of the pneumococcal population, were assembled. The collection contains isolates of all the serotypes included in the 23-valent polysaccharide vaccine (Table 1). We used multilocus sequence typing (MLST) data to maximize the genetic diversity of the selected strains. Our collection contained clinical strains that were isolated mainly in Scotland and deposited in the Scottish Meningococcus and Pneumococcus Reference Laboratory (SMPRL; Stobhill Hospital, Glasgow, United Kingdom). Strains CGSSp3BS71, CGSSp6BS73, CGSSp9BS68, CGSSp11BS70, CGSSp14BS69, CGSSp18BS74, CGSSp19BS75, and CGSSp23BS72, whose genomes have been recently sequenced, were kindly provided by Allegheny General Hospital, Allegheny-Singer Research Institute, Center for Genomic Sciences, Pittsburgh, PA (13). Strain OXC141 (http://www.sanger.ac.uk/Projects/S_pneumoniae/) was provided by A. Brueggemann (University of Oxford).
TABLE 1.
Pneumococcal strains used in this work and prophage contenta
| Strain (prophage)b | Year of isolation | Serotype or serogroupc | ST | Origind | PCR amplification of phage genes in group:
|
Induction with mitomycin C | ||
|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | ||||||
| 00-3645 | 2000 | 1 | 227 | Blood | − | − | − | − |
| 01-2696 | 2001 | 1 | 227 | Blood | − | − | − | − |
| INV104B (none) | NA | 1 | 227 | Blood | − | − | − | − |
| S1_2 | NA | 1 | 227 | Blood | − | − | − | − |
| 05-2381 | 2005 | 1 | 227 | Blood | − | − | − | − |
| 06-1805 | 2006 | 1 | 227 | Blood | − | − | − | − |
| 00-1956 | 2000 | 1 | 306 | NA | + | + | − | − |
| S1-03 | NA | 1 | 306 | Blood | + | − | − | + |
| 05-1519 | 2005 | 1 | 306 | Blood | − | − | − | − |
| 05-2745 | 2005 | 1 | 306 | Blood | − | − | − | − |
| 96-5878 | 1996 | 2 | 74 | Blood | − | − | − | − |
| D39 (none) | 1916 | 2 | 128 | NA | − | − | − | − |
| 01-1315 | 2001 | 3 | 124 | Blood | + | − | − | + |
| 01-1512 | 2001 | 3 | 180 | Ear | − | − | − | − |
| 00-1847 | 2000 | 3 | 180 | Blood | + | − | − | + |
| 01-2111 | 2001 | 3 | 180 | Ear | + | − | − | + |
| 02-1198 | 2002 | 3 | 180 | Blood | + | + | − | + |
| OXC141 (phiSpn_OXC/phiSpn_3) | 2003 | 3 | 180 | Nasopharynx | + | − | − | + |
| 02-3941 | 2002 | 3 | 180 | Eye | + | − | − | − |
| 00-4824 | 2000 | 3 | 180 | Eye | + | − | − | − |
| 00-3946 | 2000 | 3 | 180 | CSF | + | − | − | + |
| CGSSp3BS71 (phiSpn_OXC/phiSpn_3) | 2003 | 3 | 180 | Nasopharynx | + | − | − | + |
| 02-3099 | 2002 | 3 | 458 | CSF | − | − | + | − |
| 03-1980 | 2003 | 3 | 861 | CSF | + | − | − | + |
| 05-1209 | 2005 | 3 | 1220 | Blood | − | − | − | − |
| 05-2158 | 2005 | 3 | 1253 | Blood | + | − | − | + |
| 3/43 | NA | 3 | 2021 | NA | − | − | − | − |
| TIGR4 (none) | 1987 | 4 | 205 | Blood | − | − | − | − |
| 01-5114 | 2001 | 4 | 246 | Blood | + | − | − | + |
| 05-1109 | 2005 | 4 | 246 | Blood | − | − | + | + |
| 04-1342 | 2004 | 4 | 246 | Blood | − | − | − | − |
| 03-5539 | 2003 | 4 | 246 | Blood | − | − | − | − |
| 04-2239 | 2004 | 4 | 246 | Blood | − | − | + | − |
| 06-1898 | 2006 | 4 | 246 | Blood | − | − | + | − |
| 06-1803 | 2006 | 4 | 246 | Blood | − | − | + | − |
| 97-1156 | 1997 | 5 | 569 | NA | − | − | − | − |
| 01-1546 | 2001 | 6 | 65 | Blood | − | + | − | + |
| 00-3521 | 2000 | 6 | 65 | CSF | − | + | − | + |
| 01-5034 | 2001 | 6 | 96 | Nose | − | − | − | − |
| CGSSp6BS73 (phiSpn_6) | 2003 | 6A | 460 | Nasopharynx | − | + | − | + |
| CGSSp18BS74 (phiSpn_18) | 2000 | 6B | Ne | Nasopharynx | − | − | + | + |
| 00-5183 | 2000 | 6A | 581 | Blood | − | + | − | + |
| 01-3862 | 2001 | 7F | 191 | Blood | − | − | − | − |
| 01-1199 | 2001 | 8 | 577 | Blood | + | − | − | + |
| 00-1139 | 2000 | 9 | 156 | Eye | − | + | − | − |
| 00-1153 | 2000 | 9 | 156 | Tissue | − | + | − | − |
| CGSSp9BS68 (phiSpn_9) | 2003 | 9V | 1269 | Nasopharynx | − | + | − | − |
| 01-2882 | 2001 | 10 | 1112 | Blood | − | − | − | − |
| CGSSp11BS70 (phiSpn_11) | 2003 | 11 | 62 | Nasopharynx | + | − | − | + |
| 00-1452 | 2000 | 11 | 62 | Blood | − | − | − | − |
| 03-1032 | 2003 | 11 | 62 | Blood | − | − | − | − |
| 01-2812 | 2001 | 11 | 408 | Blood | + | − | − | − |
| 00-1124 | 2000 | 12 | 218 | Blood | − | − | − | − |
| 00-1151 | 2000 | 12 | 218 | Blood | − | − | − | − |
| 01-3039 | 2001 | 12 | 218 | Blood | − | − | − | − |
| 01-4176 | 2001 | 13 | 70 | Blood | + | − | − | + |
| 96-3672 | 1996 | 13 | 574 | Blood | + | + | − | + |
| 06-1138 | 2006 | 14 | 9 | Blood | − | + | − | + |
| P33 | 2001 | 14 | 9 | Eye | − | + | − | + |
| 00-4850 | 2000 | 14 | 9 | Blood | − | − | − | − |
| 02-1309 | 2002 | 14 | 9 | Blood | − | − | − | − |
| INV200 | NA | 14 | 9 | Blood | − | − | − | − |
| CGSSp14BS69 (phiSpn_14) | 2003 | 14 | 124 | Nasopharynx | + | − | − | + |
| 03-1025 | 2003 | 14 | 124 | Blood | + | − | − | + |
| 01-2329 | 2001 | 14 | 124 | Blood | + | − | − | + |
| 00-4181 | 2000 | 14 | 124 | Blood | + | − | − | + |
| 01-1752 | 2001 | 14 | 156 | Blood | − | − | − | − |
| 00-4477 | 2000 | 14 | 156 | Ear | − | + | − | − |
| 00-2859 | 2000 | 14 | NA | Blood | + | + | − | + |
| 1427 | NA | 15B/C | 199 | NA | − | − | − | − |
| 2028 | NA | 15B/C | 199 | NA | − | − | − | − |
| 00-5123 | 2000 | 17 | 392 | Blood | − | − | − | − |
| 00-3881 | 2000 | 18 | 113 | Blood | − | + | − | − |
| 02-3345 | 2002 | 18 | 113 | Blood | − | + | − | + |
| 00-2529 | 2000 | 19 | 96 | Blood | − | − | − | − |
| 00-2569 | 2000 | 19 | 199 | NA | + | − | − | + |
| 01-4303 | 2001 | 19 | 285 | Ear | − | − | − | − |
| CGSSp19BS75 (phiSpn_19) | 2003 | 19F | 485 | Nasopharynx | − | + | − | − |
| 01-1203 | 2001 | 19 | 586 | Blood | − | − | − | − |
| 01-1875 | 2001 | 19 | 587 | Blood | − | + | − | + |
| H040400333 | 2005 | 19A | 199 | Blood | + | − | − | + |
| H052300328 | 2005 | 19A | 199 | Blood | − | − | − | − |
| H060160064 | 2005 | 19A | 199 | Blood | − | − | − | − |
| 05-2084 | 2005 | 19A | 199 | Nasopharynx | − | − | − | − |
| H051740086 | 2005 | 19A | 199 | Blood | − | − | − | + |
| 05-1308 | 2005 | 19A | 199 | Pneumonia | − | − | − | − |
| G54 (none) | NA | 19F | 63 | Sputum | − | − | − | − |
| 01-1277 | 2007 | 20 | 235 | Blood | + | − | − | + |
| 01-1240 | 2001 | 22 | 433 | Blood | − | − | − | − |
| 00-2987 | 2000 | 22 | 566 | CSF | + | − | − | + |
| CGSSp23BS72 (phiSpn_23) | 2003 | 23F | 37 | Nasopharynx | − | + | − | − |
| 03-2042 | 2003 | 23 | 311 | Blood | + | − | − | + |
| 01-3045 | 2001 | 23 | 311 | Ear | + | − | − | + |
| 01-5015 | 2001 | 23 | 573 | Ear | + | − | − | + |
| 96-3310 | 1996 | 24 | 72 | CSF | + | − | − | + |
| 01-5218 | 2001 | 29 | 558 | Trachea | − | − | − | − |
| 01-2255 | 2001 | 29 | 575 | Blood | − | − | − | − |
| 01-4658 | 2001 | 31 | 444 | Blood | + | − | − | + |
| 00-5238 | 2000 | 31 | 567 | Blood | − | − | − | − |
| 01-2291 | 2001 | 31 | 696 | Blood | − | − | − | − |
| 00-2011 | 2000 | 33 | 60 | Blood | − | − | − | − |
| 01-3427 | 2001 | 33 | 100 | Blood | + | − | − | + |
| 01-3135 | 2001 | 35 | 572 | Hip | + | − | − | + |
| 00-1635 | 2000 | 35 | 582 | Eye | − | − | − | − |
| 01-3102 | 2001 | 35 | 593 | Sputum | − | − | − | − |
| 00-5108 | 2000 | 41 | 589 | Blood | − | − | − | − |
| 00-4921 | 2000 | NT | NA | Sputum | + | − | − | + |
| 00-4296 | 2000 | NT | NA | Sputum | − | − | − | − |
Isolates are ordered by increasing number of serogroup/type. Within each serotype, strains are ordered by increasing number of ST. NA, data not available or not known. +, positive; −, negative.
Data of prophage are included in the accompanying paper (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication).
NT, nontypeable.
CSF, cerebrospinal fluid.
N, new allelic profile (7, 6, 1, 2, 6, 15, 0). A number (0) for the ddl allele of this strain is not assigned yet at the MLST database.
Bacteria were grown on blood agar base number 2 (Oxoid Ltd., Basingstoke, United Kingdom) with 5% (vol/vol) defibrinated horse blood (E & O Laboratories, Bonnybridge, United Kingdom) or in brain heart infusion broth (Oxoid Ltd.). All incubations were static at 37°C. Clinical isolates were serotyped and analyzed by MLST (10) at the SMPRL. Optochin susceptibility and bile solubility tests were also carried out (17).
DNA purification and PCR amplification.
DNA was obtained from each isolate in our collection by using the DNeasy blood and tissue kit (Qiagen), following the instructions of the manufacturer. Minor modifications were included in the protocol to increase the final yield, as follows. A total of 1.5 ml of an overnight culture was used to provide cell pellets; cells were lysed using a lysis buffer containing 20 mM Tris-HCl (pH 8), 2 mM EDTA, 20 mg/ml lysozyme, and 1.2% Triton X-100; and DNA was eluted in a final volume of 150 μl. The concentration and purity of the DNA were measured using the NanoDrop spectrophotometer ND-1000. As a reference gene and to check the purity of the DNA, a 347-bp fragment of the pneumococcal pneumolysin gene (ply) was amplified using the primers ply-F (5′-GAATTCCCTGTCTTTTCAAAGTC-3′) and ply-R (5′-ATTTCTGTAACAGCTACCAACGA-3′). Three pairs of primers and one PCR amplification program were used to detect and identify prophage in S. pneumoniae isolates (Table 2). All the reactions were performed in a Techne thermocycler (Techne, Duxford, Cambridge, United Kingdom) under the following conditions: 2 min at 94°C, 30 cycles of 30 s at 94°C, 30 s at 52°C, and 1 min at 72°C and a final step of 10 min at 72°C. The PCR products were separated on 1% agarose gels in TAE buffer (40 mM Tris-acetate buffer, 1 mM EDTA), stained with SYBR safe (Invitrogen), and visualized under UV radiation (29).
TABLE 2.
Primers used in this study
| PCR | Gene amplified | Size of fragment amplified (bp) | Primer | Sequence (5′ to 3′) | Phage group(s) |
|---|---|---|---|---|---|
| 1 | Integrase 1 gene | 215 | OXC141-5 | CAGATAGGTCAGAGCGTAGAATTG | 1 |
| P5-R | GATACACTGTTCAAACCCTCAATTC | ||||
| 2 | hol1 | 191 | P9 | GATTTTGTGACAGGGACGATTG | 1, 2, 3 |
| P9-R | GCGATGTACCCGAGATAGATTG | ||||
| 3 | Integrase 2 gene | 599 | PR5 phi23 | GCTAAAAACGAAATATGAGAATGCC | 2 |
| PR2 phi23 | GTACGGCATAGGCTCAGAGG | ||||
| 4 | TMP genea | 944 | PR6 phi23 | GGAAGGAGGAAGTAAATGGCAAC | 2 |
| PR7 phi23 | CCAACTGCTCCACCAACACC | ||||
| 5 | orf2 | 879 | MM1-P6 | CCTCACACTCTCCTTGGCC | 3 |
| MM1-P7 | CCTTTTACATCCCAGCCCTC | ||||
| 6 | Major tail protein gene | 455 | MM1-P3 | GCTCAGTTGATTGTCCATTTGC | 3 |
TMP, tape measure protein.
Induction of lysogenic bacteriophage by mitomycin C, phage preparation, and electron microscopy.
S. pneumoniae isolates were grown at 37°C until the culture reached an optical density at 600 nm (OD600) of 0.1 to 0.25. Mitomycin C was then added to a final concentration of 100 ng/ml to induce the release of temperate bacteriophage. Two hundred microliters of each culture with or without mitomycin C was added to the wells of a 96-well plate in triplicate. Incubation was continued, and growth was monitored by the OD600 in a plate reader (Fluostar Optima; BMG Labtech, Germany).
Preparation of phage particles and examination with the electron microscope were performed as described elsewhere (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication).
RESULTS
PCR detection of temperate bacteriophage in Streptococcus pneumoniae.
The genetic analysis of 11 temperate pneumophage has allowed us to design specific primers to detect and identify the presence of phage in S. pneumoniae. Sequence comparisons classified temperate pneumophage into three main groups (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). Different regions of the sequenced prophage were compared to look for conserved sequences in the pneumococcal groups previously identified. For pneumococcal phage belonging to group 1, the sequences of the genes encoding integrase were used as a template. For the phage clustered in group 2, the sequences of the integrase gene and the tape measure protein gene were employed, whereas, for those pneumococcal phage belonging to group 3, the sequences of the gene orf2 located immediately upstream of the integrase and the major tail protein gene were used. Based on these regions, pairs of primers for each phage group were designed (Table 2). The holin (hol1) gene was also used to design primers capable of amplifying a phage belonging to any of the three groups. As positive controls, we used DNA prepared from the following lysogenic pneumococcal strains: (i) OXC141, CGSSp3BS71, CGSSp11BS70, and CGSSp14BS69 (harboring group 1 prophage); (ii) CGSSp6BS73, CGSSp9BS68, CGSSp19BS75, and CGSSp23BS72 (harboring group 2 prophage); and (iii) CGSSp18BS74 that contains a type 3 prophage (phiSpn_18) (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). We also used the nonlysogenic strains G54 (9), TIGR4 (32), and D39 (14) as negative controls (Table 1).
The presence of bands in PCR 1 indicates the presence of a group 1 prophage; bands in PCRs 3 and 4 correspond to a group 2 prophage; and finally, bands in PCRs 5 and 6 match with the existence of a group 3 prophage (Fig. 1). PCR amplifications showed that 53% of the strains studied (57 of 108) contained at least one prophage (Table 1). The most common prophage corresponded to group 1 (56% of PCR-positive strains [32 of 57 lysogenic strains]), whereas group 2 and group 3 prophages represented 26% (15 of 57 strains) and <11% (6 of 57 strains), respectively (Table 1). Interestingly, polylysogenic strains have been identified in our collection, as the presence of two prophage, belonging to group 1 and 2, was identified in four isolates, which represents 7% of the lysogenic strains studied. Although no detectable PCR-amplified products could be recovered from strain H051740086, the finding that this strain lysed upon the addition of mitomycin C (Table 1) suggested the presence of a novel prophage not belonging to any of the three groups previously described.
FIG. 1.
PCR amplification performed to identify phage groups determined by genome comparison. PCRs 1 to 6 correspond, respectively, to amplification of parts of genes encoding integrase 1, holin 2, integrase 2, tape measure protein, MM1-like ORF2, and the major tail protein. The presence of a band 1 indicates the presence of group 1 prophage, bands 3 and 4 the existence of group 2 phage, and bands 5 and 6 the presence of group 3 prophage. A PCR 2 product is obtained if a phage of any group is present. The amplification of the pneumolysin gene (ply) was used as a positive control of amplification (lane 7). A 1-kb Plus marker (Invitrogen) was run at the flanks of each gel.
Mitomycin C induction of temperate bacteriophage harbored by S. pneumoniae and electron microscopy of phage particles.
All the isolates included in our collection of strains were tested for lysis after the addition of mitomycin C. Forty percent of the strains studied (43 of 108 isolates) showed a significant reduction (of >50%) in OD600 values after the addition of mitomycin C, indicating the liberation of a bacteriophage (Table 1). Not all of the strains that harbor a temperate bacteriophage according to PCR results lysed after the addition of mitomycin C. A total of 15 strains (26% of the lysogenic strains) did not lyse after the addition of mitomycin C, although the presence of prophage in their genomes was detected by PCR. The prophage that did not induce the lytic cycle corresponded to three group 1 phage, seven group 2 phage, four group 3 phage, and the two prophage residing in the polylysogenic strain 00-1956 (Table 1).
A group of 13 lysogenic strains belonging to 10 different serotypes was grown to the early exponential phase, and phage replication was induced using mitomycin C. High-speed pellets prepared from lysates obtained from the pneumococcal strains CGSSp3BS71, CGSSp6BS73, CGSSp9BS68, CGSSp11BS70, CGSSp14BS69, CGSSp18BS74, CGSSp19BS75, CGSSp23BS72, OXC141, 00-3946, 03-1980, 05-1109, and 06-1138 were resuspended and observed with the electron microscope after negative staining. Siphoviridae-like particles as well as tail or head components were identified (Fig. 2). Only heads could be observed in lysates of strain CGSSp9BS68, whereas no phage-like particles could be observed in CGSSp23BS72 (data not shown). The sizes of the heads observed were approximately 50 nm by 50 nm, while the length of the tails varied between 150 and 200 nm, depending on the phage. Phage particles with different morphologies were identified in lysates prepared from strain 00-3946 (Fig. 2A to C), although the possibility that they correspond to abnormally assembled particles of a single phage cannot be completely ruled out.
FIG. 2.
Electron micrographs of phage particles observed in mitomycin C-induced lysates of clinical pneumococcal isolates. (A to C) Strain 00-3946. (D) Strain 03-1980. (E) Strain 05-1105. (F) Strain 06-1138. (G) Strain OXC141. Scale bars represent 50 nm.
Prophage distribution in S. pneumoniae isolates.
The 108 isolates contained in our collection were of many different serogroups/serotypes (plus two nontypeable isolates) and showed at least 56 different STs (Table 1). Moreover, our collection of strains contained isolates generally considered to be of “invasive serotypes” (1, 4, or 14) as well as those of serotypes showing carriage prevalence (3, 6, 19, or 23) (5). Pneumococcal strains of serogroups/serotypes more “prone to carriage” appear to harbor prophage very frequently; thus, 12 out of 15 serotype 3, five out of six serogroup 6, and all four serogroup 23 pneumococcal strains were lysogenic (Table 1). In contrast, only 5 of the 13 serogroup 19 isolates studied here appear to carry any temperate prophage. Besides, lysogeny was also frequent among S. pneumoniae isolates belonging to “invasive serotypes” 4 and 14; i.e., five out of eight serotype 4 strains and 8 out of 12 serotype 14 isolates harbor prophage. However, serotype 1 isolates only seldom bear temperate phage (2 out of 10 isolates) (Table 1). The invasive potential of some serotypes, however, is a matter of much debate, and it has been recently concluded that the amount and type of pneumococcal capsule affect bacterial virulence in humans in combination with other properties that may differ among different clonal lineages or even within single clones (12).
We also studied whether there is any statistically significant difference between the origin of the isolates and the presence of prophages. Most strains (60%) were obtained from blood, whereas only 10% were isolated from nasopharyngeal swabs. Samples from other origins were much less frequent in our collection (Table 3). Pearson's chi-square test was used to calculate the probability that the distribution of lysogenic strains in blood isolates was consistent with the null hypothesis that temperate phage was independently distributed among strains of any origin. As a P value of <0.05 was obtained, it could be concluded that lysogeny was more frequent among pneumococci isolated from blood than among those from other origins. It should be noted, however, that all the strains isolated from cerebral spinal fluid (six isolates) were lysogenic, although their ST and year of isolation did not indicate any clear relationship among them. In view of the clinical relevance of pneumococcal meningitis (4), our observation appears to be interesting enough to deserve further investigations involving a higher number of strains.
TABLE 3.
Pneumococcal lysogens and origins of isolationa
| Origin | No. of isolates (%)b | No. of isolates harboring phage:
|
Total no. of lysogens (%)c | |||
|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 1 and 2 | |||
| Blood | 65 (60.2) | 16 | 6 | 4 | 3 | 29 (46.8) |
| Nasopharynx | 11 (10.2) | 4 | 4 | 1 | 0 | 9 (81.8) |
| CSF | 6 (5.5) | 4 | 1 | 1 | 0 | 6 (100) |
| Ear | 6 (5.5) | 3 | 1 | 0 | 0 | 4 (66.7) |
| Eye | 5 (4.6) | 2 | 2 | 0 | 0 | 4 (80) |
| Sputum | 4 (3.7) | 1 | 0 | 0 | 0 | 1 (25) |
| Other | 11 (10.2) | 2 | 1 | 0 | 1 | 4 (36.4) |
S. pneumoniae isolates were considered lysogens when PCR amplification of phage genes was observed (see Table 1). CSF, cerebral spinal fluid.
Calculated considering the total number of isolates studied here (n = 108) to be 100%.
Calculated considering the total number of isolates of the same origin to be 100%.
To determine whether there is any correlation between lysogeny and genotype of the isolates, we used the MLST data. The relatedness between each ST was shown as a dendrogram (1). Figure 3 illustrates that temperate phage appears to be randomly distributed among S. pneumoniae clones. Although a sufficient number of isolates of the same ST was tested only in a few occasions, some conclusions can be drawn. (i) The acquisition of temperate phage by serotype 1 pneumococci appears to be a “recent” (in evolutionary terms) event because only half of the isolates of ST306 (but none of the six isolates of ST227) harbor a prophage. (ii) A similar interpretation can be applied to ST199 isolates because only three (out of seven) serogroup 19 isolates (Netherlands15B-37-19A) and none of those belonging to the original Netherlands15B-37 clone carried any prophage. (iii) The serogroup 23 isolates used here belong to three different (but related) STs, and all of them are lysogenized. (iv) The pneumococci belonging to the clone Netherlands14-35 (ST124) are lysogenic, whereas temperate phage was detected only in some of the members of the England14-9 clone (ST9). (v) At least 8 out of the 43 internationally distributed, relevant clones (http://www.sph.emory.edu/PMEN/index.html) harbor prophage. The exceptions (our collection includes only 12 global clones) were members of the clones Denmark12F-24 (ST218) (three isolates), Sweden15A-25-19F (ST63) (one isolate), Sweden4-38 (represented by the TIGR4 strain; ST205), and Netherlands7F-39 (ST191) (one isolate) (Fig. 3).
FIG. 3.
Dendrogram created from the MLST data showing prophage carriage and genetic relatedness of the pneumococcal clinical isolates studied here. The dendrogram was constructed by the unweighted-pair group cluster method using arithmetic averages from the matrix of allelic mismatches between the STs. For clones in which lysogeny was not observed in all members, the corresponding horizontal line has been broken.
DISCUSSION
Prophage carriage in S. pneumoniae has been studied in different ways. Early studies carried out by Bernheimer showed that 7 out of the 12 strains freshly isolated from patients lysed with mitomycin C, although only 4 were able to produce plaques (3). In a subsequent report, 42% of the 139 strains studied were lysogenic (2). A more recent survey on prophage carriage was performed based on hybridization of pneumococcal DNA with the lytA gene encoding the major S. pneumoniae autolysin, an N-acetylmuramoyl-l-alanine amidase (24). A collection of 791 strains was studied, showing that 76% of the clinical isolates tested carry multiple copies of lytA homologues, including the lytA-hybridizing band. The authors suggested that the lytA-hybridizing DNA fragments, in addition to the host lytA gene, represent the gene encoding the prophage endolysin (24). The method used by Bernheimer may underestimate the presence of temperate bacteriophage, due to incompatibilities between the phage and the indicator strain. On the other hand, the hybridization approach may overestimate the rate of prophage carriage in S. pneumoniae, since it might detect not only complete bacteriophage genomes but also prophage-related fragments. Actually, a phage remnant containing a lytA-like gene that provides the insertion site for the temperate phage HB-746 had been found in a serotype 8 S. pneumoniae strain (26). In any case, it should be pointed out that all of the 17 temperate S. pneumoniae bacteriophage reported to date harbor an endolysin-encoding gene highly similar (>80% identical nucleotides) to the host lytA (19, 22, 27; P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication), a finding that has been recently extended to two Streptococcus mitis prophage (28) but not to others (15, 30).
In this study, we have used two different (but complementary) methods to detect prophage carriage in clinical isolates of S. pneumoniae—a PCR-based assay and a mitomycin C induction assay. The PCR assay detects the presence of pneumococcal phage genes and identifies the group to which the phage belongs. This is the first PCR-based system for the detection of pneumococcal phage, and our results have shown that half of the strains studied contained a prophage. This method cannot, however, ascertain whether the phage is viable and/or able to integrate into other strains. The PCR primers were designed to amplify gene fragments located far apart in the prophage, making likely the presence of a whole prophage, not a mere phage remnant. The mitomycin C assay, however, revealed that only 40% of the strains contained an inducible prophage under the conditions used here. Despite the response to mitomycin C, our experiments indicate that more than half of the population of S. pneumoniae clinical isolates studied in our collection contained a putatively complete prophage.
Phage belonging to group 1 is the most abundant in our collection of isolates, being present in pneumococci of 18 different STs, whereas group 2 phage was detected in clinical isolates of 10 different STs. Only a small number of our strains belonging to three different STs harbor a group 3 bacteriophage (6 of 57 strains). Group 3 bacteriophage was originally identified in strains of serotype 6, 19A, 23F, or 24 (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). In our strain collection, group 3 phage has been identified in strains of serogroup/serotype 3, 4, or 6. MM1, a well-characterized pneumococcal temperate bacteriophage (11, 19-21), and its relatives MM1-1998 (16) and MM1-2008 (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication) belong to group 3. PCR experiments revealed that at least four isolates were polylysogenic. Strains with serotypes 1 (ST306), 3 (ST180), 13 (ST574), and 14 (strain 00-2859; ST not known) harbored simultaneously a group 1 bacteriophage and a group 2 bacteriophage (Table 1). The presence of two prophage (each inserted into a different attachment site) in the genome of two different S. pneumoniae strains has been reported only in the accompanying paper (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). Nevertheless, the possible existence of pneumococcal mosaic prophages containing chimeric genes capable of hybridizing with oligonucleotide primers specific for type 1 and 2 integrase genes cannot be completely ruled out. Besides, although the comparison of the genomes of 11 bacteriophage has allowed the design of the primers used to identify and classify prophage, the presence of different phage particles in strain 00-3946 (Fig. 2), as well as the induction of premature lysis in strain H051740086 without any phage-specific PCR amplification (Table 1), suggests the existence, in S. pneumoniae, of additional prophage families that remain to be studied.
Genetic differences due to variations in prophage content have been identified in strains showing the same serotype and the same ST (Fig. 3). Although isolates of the same ST are assumed to be clonal and to have descended from a recent common ancestor, it is well known that strains of the same ST can synthesize different capsular polysaccharides as a consequence of large recombinational replacements at the capsular biosynthetic locus (8). Recently, comparative genome hybridization microarray analysis has revealed that strains showing the same serotype and ST contained several regions of diversity that may be responsible for the differences observed in animal models of infection (31). Interestingly, two out of four ST306 isolates (clone Sweden1-28) were lysogenic, while the six ST227 isolates of the same serotype appear to lack any phage (Table 1). Moreover, in addition to the Sweden1-28 clone, a recent report (25) has revealed that the clones that were most frequently found in 682 invasive samples from adult patients between years 1997 and 2004 in a Spanish hospital were Spain9V-3, and Netherlands3-31. Interestingly, the vast majority of the members of these clones that we have studied here are lysogenic.
Prophage may contribute to the diversification of the bacterial genome architecture. In many cases, they actually represent a large fraction of the strain-specific DNA sequences. In addition, they can serve as anchoring points for genome inversions (6). Many of the genes identified in the genome of pneumococcal temperate bacteriophage have been annotated as encoding hypothetical proteins with little or no functional data (P. Romero, N. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. García, and T. J. Mitchell, submitted for publication). Furthermore, most of the annotated genes lack functional confirmation. However, our results fully confirm the high frequency of prophage carriage in most clinical pneumococcal isolates. It has been reported that adherence to inert surfaces and specifically to pharyngeal cells is associated with the MM1-1998 pneumococcal prophage, which may confer an advantage in colonization of the human nasopharynx (16). Adherence enhancement would contribute to the fitness of those strains and possibly to their persistence and spread. Nevertheless, further studies using a significant number of isolates belonging to the most relevant pneumococcal clones are needed to ascertain the possible role of lysogeny on the virulence and/or fitness of S. pneumoniae.
Acknowledgments
We are grateful to P. García and A. Mitchell for helpful comments and the critical reading of the manuscript. We also thank M. Mullin and L. Tetley for skillful assistance at the electron microscopy facilities of the University of Glasgow. We thank the Scottish Meningococcus and Pneumococcus Reference Laboratory for providing us with some of the strains for this study.
P.R. is the recipient of a postdoctoral fellowship from the Spanish Ministerio de Educacion y Ciencia (EX-2006-0759). This work was supported by a grant from the Dirección General de Investigación Científica y Técnica (SAF2006-00390). CIBER de Enfermedades Respiratorias (CIBERES) is an initiative of ISCIII.
Footnotes
Published ahead of print on 23 January 2009.
REFERENCES
- 1.Aanensen, D. M., and B. G. Spratt. 2005. The multilocus sequence typing network: mlst.net. Nucleic Acids Res. 33:W728-W733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bernheimer, H. P. 1979. Lysogenic pneumococci and their bacteriophages. J. Bacteriol. 138:618-624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bernheimer, H. P. 1977. Lysogeny in pneumococci freshly isolated from man. Science 195:66-68. [DOI] [PubMed] [Google Scholar]
- 4.Brouwer, M. C., J. de Gans, S. G. B. Heckenberg, A. H. Zwinderman, T. van der Poll, and D. van de Beek. Host genetic susceptibility to pneumococcal and meningococcal disease: a systematic review and meta-analysis. Lancet Infect. Dis. doi: 10.1016/S1473-3099(08)70261-5. [DOI] [PubMed]
- 5.Brueggemann, A. B., D. T. Griffiths, E. Meats, T. Peto, D. W. Crook, and B. G. Spratt. 2003. Clonal relationships between invasive and carriage Streptococcus pneumoniae and serotype- and clone-specific differences in invasive disease potential. J. Infect. Dis. 187:1424-1432. [DOI] [PubMed] [Google Scholar]
- 6.Brüssow, H., C. Canchaya, and W.-D. Hardt. 2004. Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev. 68:560-602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Brüssow, H., and F. Desiere. 2001. Comparative phage genomics and the evolution of Siphoviridae: insights from dairy phages. Mol. Microbiol. 39:213-222. [DOI] [PubMed] [Google Scholar]
- 8.Coffey, T. J., M. C. Enright, M. Daniels, J. K. Morona, R. Morona, W. Hryniewicz, J. C. Paton, and B. G. Spratt. 1998. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol. Microbiol. 27:73-83. [DOI] [PubMed] [Google Scholar]
- 9.Dopazo, J., A. Mendoza, J. Herrero, F. Caldara, Y. Humbert, L. Friedli, M. Guerrier, E. Grand-Schenk, C. Gandin, M. de Francesco, A. Polissi, G. Buell, G. Feger, E. García, M. Peitsch, and J. F. García-Bustos. 2001. Annotated draft genomic sequence from a Streptococcus pneumoniae type 19F clinical isolate. Microb. Drug Resist. 7:99-125. [DOI] [PubMed] [Google Scholar]
- 10.Enright, M. C., and B. G. Spratt. 1999. Multilocus sequence typing. Trends Microbiol. 7:482-487. [DOI] [PubMed] [Google Scholar]
- 11.Gindreau, E., R. López, and P. García. 2000. MM1, a temperate bacteriophage of the 23F Spanish/USA multiresistant epidemic clone of Streptococcus pneumoniae: structural analysis of the site-specific integration system. J. Virol. 74:7803-7813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Henriques-Normark, B., C. Blomberg, J. Dagerhamn, P. Bättig, and S. Normark. 2008. The rise and fall of bacterial clones: Streptococcus pneumoniae. Nat. Rev. Microbiol. 6:827-837. [DOI] [PubMed] [Google Scholar]
- 13.Hiller, N. L., B. Janto, J. S. Hogg, R. Boissy, S. Yu, E. Powell, R. Keefe, N. E. Ehrlich, K. Shen, J. Hayes, K. Barbadora, W. Klimke, D. Dernovoy, T. Tatusova, J. Parkhill, S. D. Bentley, J. C. Post, G. D. Ehrlich, and F. Z. Hu. 2007. Comparative genomic analyses of seventeen Streptococcus pneumoniae strains: insights into the pneumococcal supragenome. J. Bacteriol. 189:8186-8195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lanie, J. A., W.-L. Ng, K. M. Kazmierczak, T. M. Andrzejewski, T. M. Davidsen, K. J. Wayne, H. Tettelin, J. I. Glass, and M. E. Winkler. 2007. Genome sequence of Avery's virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J. Bacteriol. 189:38-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Llull, D., R. López, and E. García. 2006. Skl, a novel choline-binding N-acetylmuramoyl-l-alanine amidase of Streptococcus mitis SK137 containing a CHAP domain. FEBS Lett. 580:1959-1964. [DOI] [PubMed] [Google Scholar]
- 16.Loeffler, J. M., and V. A. Fischetti. 2006. Lysogeny of Streptococcus pneumoniae with MM1 phage: improved adherence and other phenotypic changes. Infect. Immun. 74:4486-4495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lund, E., and J. Henrichsen. 1978. Laboratory diagnosis, serology and epidemiology of Streptococcus pneumoniae. Methods Microbiol. 12:241-262. [Google Scholar]
- 18.Martín, A. C., R. López, and P. García. 1996. Analysis of the complete nucleotide sequence and functional organization of the genome of Streptococcus pneumoniae bacteriophage Cp-1. J. Virol. 70:3678-3687. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Obregón, V., J. L. García, E. García, R. López, and P. García. 2003. Genome organization and molecular analysis of the temperate bacteriophage MM1 of Streptococcus pneumoniae. J. Bacteriol. 185:2362-2368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Obregón, V., J. L. García, E. García, R. López, and P. García. 2004. Peculiarities of the DNA of MM1, a temperate phage of Streptococcus pneumoniae. Int. Microbiol. 7:133-137. [PubMed] [Google Scholar]
- 21.Obregón, V., P. García, R. López, and J. L. García. 2003. Molecular and biochemical analysis of the system regulating the lytic/lysogenic cycle in the pneumococcal temperate phage MM1. FEMS Microbiol. Lett. 222:193-197. [DOI] [PubMed] [Google Scholar]
- 22.Obregón, V., P. García, R. López, and J. L. García. 2003. VO1, a temperate bacteriophage of the type 19A multiresistant epidemic 8249 strain of Streptococcus pneumoniae: analysis of variability of lytic and putative C5 methyltransferase genes. Microb. Drug Resist. 9:7-15. [DOI] [PubMed] [Google Scholar]
- 23.Pelletier, J., P. Gros, and M. DuBow. June 2000. Development of novel anti-microbial agents based on bacteriophage genomics. U.S. patent WO0032825A2.
- 24.Ramirez, M., E. Severina, and A. Tomasz. 1999. A high incidence of prophage carriage among natural isolates of Streptococcus pneumoniae. J. Bacteriol. 181:3618-3625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ribes, S., F. Taberner, C. Cabellos, F. Tubau, C. Ardanuy, J. Gerber, J. Liñares, R. Nau, and F. Gudiol. 2008. Contribution of capsular and clonal types and β-lactam resistance to the severity of experimental pneumococcal meningitis. Microb. Infect. 10:129-134. [DOI] [PubMed] [Google Scholar]
- 26.Romero, A., R. López, and P. García. 1992. The insertion site of the temperate phage HB-746 is located near the phage remnant in the pneumococcal host chromosome. J. Virol. 66:2860-2864. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Romero, A., R. López, and P. García. 1990. Sequence of the Streptococcus pneumoniae bacteriophage HB-3 amidase reveals high homology with the major host autolysin. J. Bacteriol. 172:5064-5070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Romero, P., R. López, and E. García. 2004. Characterization of LytA-like N-acetylmuramoyl-l-alanine amidases from two new Streptococcus mitis bacteriophages provides insights into the properties of the major pneumococcal autolysin. J. Bacteriol. 186:8229-8239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 30.Siboo, I. R., B. A. Bensing, and P. M. Sullam. 2003. Genomic organization and molecular characterization of SM1, a temperate bacteriophage of Streptococcus mitis. J. Bacteriol. 185:6968-6975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Silva, N. A., J. McCluskey, J. M. C. Jefferies, J. Hinds, A. Smith, S. C. Clarke, T. J. Mitchell, and G. K. Paterson. 2006. Genomic diversity between strains of the same serotype and multilocus sequence type among pneumococcal clinical isolates. Infect. Immun. 74:3513-3518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelber, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. [DOI] [PubMed] [Google Scholar]