Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jan 15.
Published in final edited form as: Toxicol Appl Pharmacol. 2008 Oct 8;234(2):166–178. doi: 10.1016/j.taap.2008.09.022

Hepatic Effects of a Methionine-Choline-Deficient Diet in Hepatocyte RXRα-null Mice

Maxwell Afari Gyamfi 1, Yuji Tanaka 1, Lin He 1, Curtis D Klaassen 1, Yu-Jui Yvonne Wan 1
PMCID: PMC2656443  NIHMSID: NIHMS92626  PMID: 18952117

Abstract

Retinoid X receptor-α (RXRα) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXRα deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXRα-null (H-RXRα-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid β-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXRα-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXRα-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXRα-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXRα-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXRα-null mice. In conclusion, these data suggest a critical role for RXRα in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

Keywords: Nuclear receptors, Retinoid X receptor-alpha, Non-alcoholic steatohepatitis, sterol regulatory element binding protein, fatty liver, methionine and choline deficient diet, hepatic transporters

Introduction

Non-alcoholic steatohepatitis (NASH) is a chronic liver disease that has histological features comparable to alcohol-induced steatohepatitis (Ludwig et al., 1980). Whereas the cellular and molecular mechanisms involved in the pathogenesis of NASH are not fully understood, the initial stage of the disease is characterized by fat accumulation (steatosis), especially triglycerides, in hepatocytes. NASH is seen in patients with the metabolic syndrome, obesity, hyperlipidemia, and type 2 diabetes mellitus (Ludwig et al., 1980). Furthermore, steatosis is known to stimulate lipogenesis through decreased expression of the peroxisome proliferator-activated receptor α (PPARα), a nuclear receptor crucial for fatty acid oxidation (Wan et al., 1995). Compelling evidence suggests that impaired fatty acid oxidation is the cause of fatty acid accumulation and steatosis in liver (Fromenty and Pessayre, 1995; Bradbury, 2006).

Another major regulator of lipogenesis in the liver is the sterol regulatory element binding proteins (SREBPs), transcription factors known to have important roles in de novo fatty acid and triglyceride synthesis (Horton et al., 2002). The three SREBP isoforms, SREBP-1a, SREBP-1c, and SREBP-2, have overlapping functions, and activate the expression of more than 30 genes involved in lipogenesis (Horton et al., 2002). Insulin-induced increases in SREBP-1c mRNA lead to elevated fatty acid synthesis and fatty liver (Shimomura et al., 1999). It has been suggested that SREBP activity is a key factor involved in lipid accumulation in nonalcoholic fatty liver disease (NAFLD), and that activation of PPARα and AMP-activated protein kinase (AMPK), which can suppress SREBP activity, may serve as potential treatment option for NASH (Zhou et al., 2001; Ahmed and Byrne, 2007).

Whereas the etiology of NASH may be multifactorial and complex, emerging evidence indicates that nuclear receptors are important in the pathogenesis of NASH (Caldwell et al., 2001; Dai et al., 2003; Ip et al., 2004; George and Liddle, 2008). For instance, thiazolidinediones, the most promising drug family for treating NASH, activate the nuclear receptor PPARγ, leading to enhanced insulin sensitization in NASH patients and thereby decreasing steatohepatitis (Caldwell et al., 2001). Activation of PPARγ also has anti-inflammatory effects (Jiang et al., 1998). Furthermore, WY-14,643, a potent PPARα agonist, decreases hepatic triglyceride concentrations and diminishes hepatotoxicity in an animal model of NASH (Ip et al., 2004). Interestingly, PPAR isomers and other type II nuclear receptors require retinoid X receptor alpha (RXRα) as the obligate heterodimeric partner for transcription of their target genes (Ulven et al., 1998).

Retinoids have profound anti-inflammatory effects (Nozaki et al., 2006). The ability of retinoids to inhibit the production of cytokines is mediated by their nuclear receptors (Uchimura et al., 2001). In mouse models of noninsulin-dependent diabetes mellitus and obesity, the RXR agonists, LG100268 and LG100324, function as insulin sensitizers and decrease hyperglycaemia, hypertriglyceridaemia, and hyperinsulinaemia (Mukherjee et al., 1997; Liu et al., 2000). Chronic adminstration of LG100268 and LG100324 to rats reduced food intake and body weight gain (Liu et al., 2000). This suggests that retinoids and their receptors play a role in lipid homeostasis (Mukherjee et al., 1997; Liu et al., 2000; Thacher et al., 2000). In a recent report, we indicated that hepatocyte RXRα-null (H-RXRα-null) mice exhibited enhanced liver injury in association with both increased hepatic free fatty acids and production of pro-inflammatory cytokines (Gyamfi et al., 2008b). Furthermore, low serum retinol levels are associated with hepatocellular carcinoma in patients with chronic liver disease (Newsome et al., 2000). To date, there are no reports on the role of RXRα, the most abundant among the three RXR isoforms (α, β, γ) in liver, in the develpoment of NASH (Ulven et al., 1998). We hypothesize that a compromise in the retinoids/RXRα signaling pathway has a significant negative impact on the pathogenesis of NASH.

The MCD diet is a standard nutritional rodent model for NASH that produces key features of human NASH, including steatosis, hepatic inflammation, and fibrosis (Weltman et al., 1996; Ip et al., 2004). Elevated levels of alkaline phosphatase (ALP), a biochemical marker for cholestasis, are seen in subjects with NASH (Sorrentino et al., 2005). In rodent studies, reduced expression of canalicular transporters results in cholestasis (Trauner et al., 1999). Furthermore, changes in the expression and localization of hepatic transporters have been reported in patients with chronic cholestatic liver disease (Keitel et al., 2005). In addition, increased expression of proinflammatory cytokines implicated in NASH can alter the expression of hepatic transporters leading to a cholestatic phenotype (Geier et al., 2003). We previously reported that the MCD diet can induce cholestasis; however, limited data exist on the influence of the MCD diet on xenobiotic transporters (Lickteig et al., 2007; Gyamfi et al., 2008a).

In this study we used a MCD diet to treat WT and H-RXRα-null mice to investigate the role of hepatocyte RXRα in the pathogenesis of NAFLD. The results of this study indicate increased susceptibility of the H-RXRα-null mice to steatohepatitis induced by the MCD diet. Our findings show that impaired fatty acid oxidation and inflammatory factors, rather than factors involved in oxidative stress, play significant roles in the pathogenesis of NASH in H-RXRα-null mice. Furthermore, down-regulation of hepatic Oatp1a1 and Oatp1b2 as well as up-regulation of basolateral efflux transporter Mrp4 may be critical pathologic features of the MCD diet ingestion in addition to steatosis and fibrosis.

Materials and Methods

Animals

Mice carrying the RXRα mutation in hepatocytes have been described previously (Wan et al., 2000). Age-matched WT (of mixed genetic background of C57/Bl/6, 129/SvEvTac, and DBA-2) and H-RXRα-null mice (10-12 weeks old) were used in all the experiments (Wan et al., 2000; Wan et al., 2003). The mice were housed in steel microisolator cages at 22°C with a 12- h/12-h, light/dark cycle. Due to the tendency of animals to reduce their solid food intake during administration of a MCD diet, mice were given a liquid diet. After 2 days of feeding mice a control liquid diet, mice were randomized into two dietary groups (n = 8), and fed either a methionine-choline sufficient (control) or a MCD diet for 14 days. The diets were purchased from DYETS Inc. (Bethlehem, PA). The MCD diet was similar to the control diet except for complete removal of methionine and choline. For the control diet, methionine was provided at 1.18 g/L and choline at 0.66 g/L. Protein was 18.9% calories, fat was16.5% of calories, and 64.5% of calories were from carbohydrate.

Mice were given free access to feed. During the experimental period, individual body weights were recorded at the start and once a week thereafter. All procedures were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals and were approved by the Kansas University Medical Center Institutional Animal Care and Use Committee. After 2 weeks of feeding, blood samples were obtained and centrifuged at 3000 rpm for 15 min to collect serum. Livers were rapidly excised, weighed and a portion snap-frozen in liquid nitrogen and maintained at -80°C, and later used for RNA extraction, lipid peroxidation (LPO) assay, or lipid extraction. The rest of the fresh liver tissue was immediately homogenized for isolation of microsomes and cytosol. A portion of each liver was fixed in 10% formalin for hematoxylin and eosin (H & E) staining.

Serum alanine aminotransferase (ALT), ALP, cholesterol, triglyceride, and bile acid levels

Serum was stored at -20°C and used to assay ALT and ALP activities, as well as cholesterol, triglyceride, and bile acid concentrations. Serum ALT was determined using Liquid ALT Reagent kit (Pointe Scientific Inc., Brussels, Belgium). Serum ALP activity was determined using ALP (Liquid) Reagent Set (Pointe Scientific Inc., Canton, MI). Serum cholesterol and triglyceride levels were determined by cholesterol E-test and triglyceride E-test kits (Wako Pure Chemical Industries, Richmond, VA), respectively. Serum bile acid concentrations were determined using a commercially available kit (Colorimetric Total Bile Acids Assay Kit; Bioquant, San Diego, CA).

H & E Staining of Liver Sections and morphology analysis

Following fixation of the livers with 10% formalin/phosphate-buffered saline, livers were sectioned and stained with H & E for histological examination. Slides were viewed blindly and scored for steatosis, inflammation, necrosis, and fibrosis using our previously described criteria (Dai et al., 2003). The liver pathology was scored as follows: steatosis (the percentage of liver cells containing fat), <25% = 1+, <50% = 2+, <75% = 3+, >75% = 4+; inflammation, necrosis, and fibrosis, 1 focus =1+, 2 or more foci = 2+.

Hepatic triglyceride, nonesterified fatty acid (NEFA), and thiobarbituric acid-reactants (TBARS) levels

Total liver lipids were extracted from 100 mg of liver homogenate using methanol and chloroform as previously described (Folch et al., 1957; Zhou et al., 2006). Hepatic triglyceride was quantified using a Triglyceride test kit (Wako pure Chemical Industries, Richmond, VA). Hepatic NEFA levels were determined using the NEFA C test kit (Wako Pure Chemical Industries, Richmond, VA). For determination of lipid peroxides, 50 mg of liver was homogenized in 1.15% KCl. TBARS were measured in 200 μl liver homogenate as described previously (Gyamfi and Wan, 2006).

Hepatic Cyp2e1 activity

Microsomal fractions were separated from fresh liver tissue as described previously (Gyamfi et al., 2006). Cyp2e1 activity in liver microsomes was estimated colorimetrically by measuring the hydroxylation of p-nitrophenol to 4-nitrocathecol (Reinke and Moyer, 1985).

Western blot analysis

Cytosolic and microsomal fractions were extracted as described previously (Gyamfi et al., 2006). Liver homogenate (50 μg/lane), microsomes (30 μg/lane) and cytosol (30 μg/lane) were separated by 10 or 15% SDS-PAGE gels, electroblotted onto polyvinylidene difluoride (PVDF) membranes and immunoblotted with anti-acyl-Coenzyme A oxidase 1 (ACOX1)(ABGENT, San Diego, CA), anti-interleukin-1β (IL-1β)(Chemicon International, Temecula, CA, USA) or anti-Cyp4a14 and anti-liver fatty acid binding protein (L-FABP)(Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibody. Blots were then incubated with the appropriate peroxidase-conjugated anti-rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted in Tris-buffered saline with 0.1% Tween 20 (TBST) plus 1% non-fat dry milk for 1 h at room temperature. Following probing, blots were stripped and reprobed with anti-β-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or anti-gapdh (Abcam Inc., Cambridge, MA, USA) antibody. Proteins were viewed using enhanced chemiluminescence. Protein concentrations were determined by the Bradford method (Bradford, 1976).

Quantification of mRNA levels using real-time polymerase chain reaction (PCR) and branched DNA signal amplification (bDNA) assay

Total RNA was isolated from frozen liver tissues using the TRIzol reagent according to the manufacturer’s protocol (Invitrogen, Carlsbard, CA). RNA concentration and quality were determined spectrophotometrically at 260 nm and the A260/A280 ratio, respectively. Real-time PCR was used to quantify the mRNA level of macrophage inflammatory protein-2 (MIP-2), IL-1β, tumor necrosis factor α (TNFα), α-smooth muscle actin (α-SMA), L-FABP, carnitine palmitoyltransferase 1 (CPT-1), ACOX1, sterol regulatory element-binding protein (SREBP)-1c, SREBP-2, PPARα, HMG-CoA reductase, acetyl CoA carboxylase-1a (ACC-1a), fatty acid synthase (FAS), fatty acid translocase (FAT/CD36), Cyp4a14, Cyp7a1, Cyp8b1, β-actin, and Gapdh as described previously (Gyamfi et al., 2008b). Primers and probes (Table 1) were designed using Primer Express 2.0 (Applied Biosystems, Foster City, CA). The amplification reactions were carried out in an ABI Prism 7900 sequence detection system (Applied Biosystems, Foster City, CA) as described previously (Gyamfi et al., 2008b). The mRNA of hepatic transporters was quantified using the bDNA assay (QuantiGene, High Volume bDNA Signal Amplification Kit; Panomics, Fremont, CA) with modifications (Hartley and Klaassen, 2000). Specific transporter probe sets were designed as previously described: Mrp2, 3, and 4 (Maher et al., 2005); Ntcp, Bsep, Mdr2, and Mdr1b (Maher et al., 2006); and organic anion transporting polypeptide (Oatp) 1a1, 1a4, 1b2 (Cheng et al., 2005). All reagents for analysis (i.e., lysis buffer, amplifier/label probe buffer, and substrate solution) were supplied by the manufacturer (QuantiGene, High Volume bDNA Signal Amplification Kit; Panomics, Fremont, CA). Total RNA (1 μg/μl; 10 μl/well) was added to each well of a 96-well plate containing capture hybridization buffer and 50 μl of each diluted probe set. Total RNA was allowed to hybridize to each probe set overnight at 53°C. Subsequent hybridization steps were carried out per the manufacturer’s protocol and luminescence was quantified with a Quantiplex 320 bDNA Luminometer interfaced with Quantiplex Data Management Software Version 5.02 for analysis of luminescence from 96-well plates. The luminescence for each well was reported as relative light units (RLU) per 10 μg total RNA.

Table 1.

Sequences of primers and probes used for real-time quantitative PCR.

Name Sequence Accession #
MIP-2 Sense GAACATCCAGAGCTTGAGTGTGA NM 009140
Antisense CCCTTGAGAGTGGCTATGACTTC
Probe AGGACCCCACTGCGCCCAGA
TNF-1α Sense ACAAGGCTGCCCCGACTAC NM013693
Antisense TTTCTCCTGGTATGAGATAGCAAATC
Probe TGCTCCTCACCCACACCGTCAGC
α-SMA Sense CCTGACGGGCAGGTGATC NM 007392
Antisense ATGAAAGATGGCTGGAAGAGAGTCT
Probe CGAACGCTTCCGCTGCCCA
CD36 Sense TCCAGCCAATGCCTTTGC NM007643
Antisense TGGAGATTACTTTTTCAGTGCAGA A
Probe TCACCCCTCCAGAATCCAGACAACCA
FAS Sense CCCGGAGTCGCTTGAGTATATT NM007988
Antisense GGACCGAGTAATGCCATTCAG
Probe AGCCCATGGCACGGGCACC
L-FABP Sense TGCATGAAGGGAAGAAAATCAAA NM017399
Antisense CCCCCAGGGTGAACTCATT
Probe TCACCATCACCTATGGACCCAAAGTGG
ACC1 Sense ATGTCCGCACTGACTGTAACCA NM133360
Antisense TGCTCCGCACAGATTCTTCA
Probe TCCTCAACTTTGTGCCCACGGTCA
β-Actin Sense CTTCTTTGCAGCTCCTTCGTTG NM 007393
Antisense CGACCAGCGCAGCGATATC
Probe CCACACCCGCCACCAGTTCGCC
GAPDH Sense TGTGTCCGTCGTGGATCTGA NM 001001303
Antisense CCTGCTTCACCACCTTCTTGA
Probe CCGCCTGGAGAAACCTGCCA
IL-1β Sense AAGATGAAGGGCTGCTTCCA NM008361
Antisense GTGCTGCTGCGAGATTTGAA
Probe CCTTTGACCTGGGCTGTCCTGATGA
CD36 Sense TCCAGCCAATGCCTTTGC NM007643
Antisense TGGAGATTACTTTTTCAGTGCAGA A
Probe TCACCCCTCCAGAATCCAGACAACCA
CPT-1 Sense CGATCATCATGACTATGCGCTACT NM013495
Antisense GCCGTGCTCTGCAAACATC
Probe CTGAAGGTGCTGCTCTCCTACCATTCA
SREBP-1c Sense CATGCCATGGGCAAGTACAC NM011480
Antisense TGTTGCCATGGAGATAGCATCT
Probe AACCTGGCACTAAGTGCCCTCAACCTG
SREBP-2 Sense ATGATCACCCCGACGTTCAG NM 033218
Antisense GCTGCGTTCTGGTATATCAAAGG
Probe CGCTCCGCAGACGAGGATCATCC
PPARα Sense GATTCAGAAGAAGAACCGGAACA NM011144
Antisense TGCTTTTTCAGATCTTGGCATTC
Probe TCTGTCGGGATGTCACACAATGCAATTC
HMGCoA-Reductase Sense GGCAGTCAGTGGGAACTATTGC NM008255
Antisense CAGTCTTTCCTCGTCCTTCGA
Probe CCGACAAGAAGCCTGCTGCCATAAAC
Cyp7a1 Sense CCATGATGCAAAACCTCCAAT NM007824
Antisense TGACCCAGACAGCGCTCTTT
Probe TGTCATGAGACCTCCGGGCCTTCC
Cyp8b1 Sense GCCCTTACTCCAAATCCTACCA NM010012
Antisense TCGCACACATGGCTCGAT
Probe TCAGACTCCAGGGATGTTGCTCAATGG
ACOX1 Sense TTTGTTGTCCCTATCCGTGAGA NM 015729
Antisense GCCGATATCCCCAACAGTGA
Probe TGGGACCCACAAGCCTCTGCCA
Cyp4a14 Sense CAAGACCCTCCAGCATTTCC NM 007822
Antisense GGTGTTGGCAAGGCATTCC
Probe TCACCCGCTCTTTACCTTCCTG
Open in a new tab

Statistical Analysis

Data are presented as means ± S.E.M (n = 4-8) and analyzed using SigmaStat 3.5 software (Systat Software, Inc. Chicago, IL). Effect of genotype, MCD diet, and their interaction were analyzed using a two-way analysis of variance (ANOVA), with Bonferroni post-hoc tests. A P value of < 0.05 was considered statistically significant.

Results

Effect of the MCD diet and RXRα deficiency on body weight, liver weight serum and hepatic lipid levels, lipid peroxide levels, Cyp2e1 activity, steatosis, and inflammation

The MCD diet decreased the body weight in both the WT and H-RXRα-null mice (Table 2). However, the decrease in body weight was greater in H-RXRα-null mice than in WT mice (Table 2). The MCD diet also decreased liver weight in both genotypes of mice, however, a statistically significant difference was found only in H-RXRα-null mice (Table 2). When liver weight was expressed as percent of body weight, no significant change was found in both genotypes of mice fed the MCD diet (Table 2). The genotype influenced the serum cholesterol and triglycerides levels which were higher in H-RXRα-null mice than in WT mice (Table 2). The MCD diet decreased serum cholesterol and triglyceride levels in both genotypes of mice (Table 2). Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on serum cholesterol and triglyceride levels. Hepatic triglyceride levels were increased by the MCD diet in both WT and in H-RXRα-null mice (Table 2). The basal hepatic NEFA levels between WT and H-RXRα-null mice were not different (Table 2). Furthermore, the MCD diet did not increase NEFA levels in WT mice, but it did in livers of the H-RXRα-null mice (Table 2). WT mice fed the MCD diet had increased hepatic LPO as quantified by the TBARS assay (Table 2). The H-RXRα-null mice not only had constitutively lower TBARS, the MCD diet did not increase TBARS in their livers (Table 2). Cyp2e1 is involved in LPO, and its levels are increased in a rat dietary model of steatohepatitis (Weltman et al., 1996). Consistent with an increase in LPO in the MCD-fed WT mice, Cyp2e1 enzyme activity was increased (Table 2). This increase in Cyp2e1 activity was not observed in H-RXRα-null mice fed the MCD diet (Table 2). The increase in TBARS levels and Cyp2e1 activity by the MCD diet in WT mice was higher than that in H-RXRα-null mice (Table 2). To determine lipid accumulation in liver, H & E staining was conducted. Liver sections indicated that lipid droplets were rare in livers of mice fed the control diet. Irrespective of the genotype, lipid droplets were common in both WT and H-RXRα-null mice fed the MCD diet (Fig. 1). The histological score indicated the presence of steatosis in both genotypes of mice fed the MCD diet (Table 2 and Fig. 1). While a mild inflammation was observed by histology score in only H-RXRα-null mice (Table 2), however, necrosis and fibrosis were absent in both genotypes of mice (data not shown).

Table 2.

Effect of methionine and choline deficient diet (MCD) diet on body weight, liver weight, biochemical parameters, and liver pathology.

Wild type RXRα KO
Parameter Control MCD Control MCD
Body weight (g) 34.6 ± 1.0 27.8 ± 1.4# 32.5 ± 0.9 24.2 ± 0.9#, †
Absolute liver weight (g) 1.20 ± 0.0 0.91 ± 0.1 1.23 ± 0.0 0.92 ± 0.0#
Liver/body weight (%) 3.5 ± 0.2 3.3 ± 0.2 3.8 ± 0.1 3.8 ± 0.2
Serum cholesterol (mg/dl) 125 ± 17.9 55 ± 4.1# 203 ± 10.1* 87 ± 7.5#, †
Serum triglycerides (mg/dl) 110 ± 10.7 55 ± 5.7# 379 ± 28.5* 91.9 ± 10.7#, †
Hepatic triglyceride (mg/g liver) 6.9 ± 0.5 9.4 ± 0.7# 7.72 ± 0.51 10.0 ± 0.2#
Hepatic NEFA (μmol/mg protein) 0.63 ± 0.06 0.58 ± 0.08 0.61 ± 0.04 0.76 ± 0.02#
TBARS levels (nmol/mg) 4.3 ± 0.1 6.3 ± 0.4# 3.3 ± 0.1* 3.7 ± 0.3†
Cyp2e1 activity (nmol/mg) 17.8 ± 2.3 25.5 ± 1.7# 14.3 ± 1.3 18.9 ± 1.7†
Steatosis score 0.0 ± 0.0 1.6 ± 0.3# 0.0 ± 0.0 2.3 ± 0.7#
Inflammation 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.3 ± 0.2
Open in a new tab

Data are mean ± SEM for 4-8 mice per group.

*

P < 0.05, statistically significant difference between WT and H-RXRα-null mice.

#

P < 0.05 statistically significant difference between mice fed a control and a MCD diet.

†

P < 0.05 statistically significant difference between WT mice and H-RXRα-null mice fed a MCD diet.Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on serum cholesterol and triglyceride levels.

Fig.1.

Fig.1

Open in a new tab

Representative photomicrographs of hematoxylin and eosin (H & E) staining of liver sections in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD (Inline graphic) diets for 2 weeks. H & E staining (original magnification ×400) from different treatment groups was performed as described in Materials and Methods. In the livers of mice fed the MCD diet, H & E staining revealed steatosis in both WT and H-RXRα-null mice fed a MCD diet.

Effect of the MCD diet and RXRα deficiency on mRNA levels of lipogenic genes

The basal mRNA level of SREBP-1c was not different between WT and H-RXRα-null mice (Fig. 2). Furthermore, the MCD diet did not significantly alter SREBP-1c gene expression in either WT or H-RXRα-null mice (Fig. 2). The MCD diet did not increase mRNA levels of FAS and ACC-1a, target genes for SREBP-1c in WT mice, whereas they were increased 4.8- and 2.0-fold, respectively, in H-RXRα-null mice administered the MCD diet (Fig. 2). Furthermore, the increase in mRNA levels of FAS and ACC-1a by the MCD diet in H-RXRα-null mice was higher than in WT mice fed the MCD diet (Fig. 2). Two-way ANOVA indicated that the increase in FAS and ACC-1a mRNA levels in the H-RXRα-null mice was influenced by the interaction of the genotype and the MCD diet. The mRNA levels of SREBP-2 were not different between the WT and H-RXRα-null mice fed the control diet (Fig. 2). Whereas the MCD diet did not alter SREBP-2 mRNA levels in the WT mice, it increased SREBP-2 mRNA levels 2.2-fold in H-RXRα-null mice (Fig. 2). The SREBP-2-target gene HMG CoA reductase was not significantly increased in the WT mice by the MCD diet. However, HMG CoA reductase mRNA levels were increased 5.4- fold in the H-RXRα-null mice fed the MCD diet (Fig. 2). Two-way ANOVA indicated that the increase in SREBP-2, but not HMG CoA mRNA levels in the H-RXRα-null mice was influenced by the combined effect of the genotype and the MCD diet. The MCD diet increased the free fatty acid uptake transporter CD36 3.7-fold in WT mice but not in H-RXRα-null mice (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

mRNA expression of hepatic transcription factors and lipid synthesizing genes in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) fed a control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed a control (■) or a MCD (Inline graphic) diets for 2 weeks. Total hepatic RNA was isolated and mRNA levels were determined by real-time PCR as described in Materials and Methods. Data represent mean ± SEM (n = 4-5). Pound (#) represent statistically significant difference (P < 0.05) between mice fed control and MCD diet. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on expression of FAS, ACC-1a, SREBP-2, and CD-36.

Effect of the MCD diet and RXRα deficiency on mRNA levels of fatty acid oxidation genes

Hepatocyte RXRα deficiency did not change basal PPARα mRNA levels (Fig. 3). Furthermore, the MCD diet did not alter PPARα mRNA levels in WT mice, but the MCD diet decreased PPARα mRNA levels in H-RXRα-null mice (Fig. 3). The level of CPT-1 mRNA was similar between WT and H-RXRα-null mice (Fig. 3). The MCD diet did not change the CPT-1 gene expression in WT mice, however, the MCD diet markedly decreased CPT-1 gene expression in the H-RXRα-null mice (Fig. 3). Furthermore, both the constitutive ACOX1 mRNA and protein levels were lower in the H-RXRα-null mice than in WT mice (Fig. 3). The MCD diet did not affect either the ACOX1 mRNA or protein levels in WT mice, whereas both were decreased in the H-RXRα-null mice (Fig. 3). The basal expression of L-FABP mRNA and protein were lower in H-RXRα-null mice than in WT mice (Fig. 3). Furthermore, the MCD diet did not alter the L-FABP mRNA or protein levels in WT mice (Fig. 3). The H-RXRα-null mice had about 50% less L-FABP mRNA and protein than WT mice, and the MCD diet decreased it further in the H-RXRα-null mice (Fig. 3). Cyp4a14 mRNA and protein levels were much lower in H-RXRα-null mice than in WT mice (Fig. 3). The Cyp4a14 mRNA was increased 1.8-fold, but not the protein in WT mice fed the MCD diet. The MCD diet did not increase either Cyp4a14 mRNA or protein levels in the H-RXRα-null mice (Fig. 3) and the levels were lower compared to WT mice fed the MCD diet (Fig.3).

Fig. 3.

Fig. 3

Open in a new tab

Hepatic transcription factor, fatty acid oxidation genes mRNA and protein expression in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed a control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed a control (■) or a MCD (Inline graphic) diets for 2 weeks. Total hepatic RNA was isolated and mRNA levels were determined by real-time PCR as described in Materials and Methods. Liver homogenate (50 μg/lane), cytosol (30 μg/lane) or microsomes (30 μg/lane) from control or a MCD-fed mice was electrophoresed on 10 or 15% SDS-polyacrylamide gels, transferred to polyvinylidene difluoride (PVDF) membranes, and incubated with anti-ACOX1, L-FABP or Cyp4a14 antibody. Following probing, blots were stripped and reprobed with anti- β-actin or Gapdh antibody. Data represent mean ± SEM (n = 3-5). Asterisks (*) represent statistically significant difference (P < 0.05) between WT and H-RXRα-null mice. Pound (#) represent statistically significant difference (P < 0.05) between mice fed a control and a MCD diet. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on expression of CPT-1 and Cyp4a14.

Effect of the MCD diet and RXRα deficiency on mRNA and protein levels of pro-inflammatory genes

The MCD diet did not induce the levels of MIP-2, TNFα, IL-1β, and α-SMA mRNA in the WT mice (Fig. 4). However, the MCD diet increased MIP-2, TNFα, IL-1β, and α-SMA mRNA by 2.5-, 1.7-, 2.0-, and 1.7-fold, respectively, in H-RXRα-null mice (Fig. 4). The increase in MIP-2 and IL-1β mRNA levels by the MCD diet in H-RXRα-null mice was higher than in WT mice fed the MCD diet (Fig. 4). Hepatocyte RXRα deficiency did not change basal IL-1β mRNA levels but increased IL-1β protein in H-RXRα-null mice (Fig. 4). The MCD diet did not increase IL-1β protein levels in WT mice (Fig. 4). However, the MCD diet increased IL-1β protein levels in H-RXRα-null mice (Fig. 4), and this increase was higher than in WT mice (Fig. 4). Two-way ANOVA revealed that the increase in MIP-2, IL-1β, and α-SMA mRNA levels in H-RXRα-null mice was influenced by the interaction of genotype and the MCD diet (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

MIP-2, TNFα, IL-1β, α-SMA mRNA and IL-1β protein levels in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed a control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD diets (Inline graphic) for 2 weeks. MIP-2 (a), TNFα (b), IL-1β (c), and α-SMA (d) normalized to Gapdh or β-actin mRNA levels were determined by real-time PCR. Liver homogenate (50 μg/lane) from control or a MCD-fed mice was electrophoresed on 15% SDS-polyacrylamide gel, transferred to polyvinylidene difluoride (PVDF) membranes, and incubated with anti-IL-1β antibody. Following probing, blots were stripped and reprobed with anti-gapdh antibody. Data represent mean ± SEM (n = 4). Asterisks (*) represent statistically significant difference (P < 0.05) between WT and H-RXRα-null mice. Pound (#) represent statistically significant difference (P < 0.05) between mice fed a control and a MCD diet. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on gene expression of MIP-2, α-SMA, and IL-1β.

Effect of the MCD diet and RXRα deficiency on mRNA levels of hepatic bile acid synthesis genes

Bile acids are the end products of hepatic cholesterol metabolism, and also act as signaling molecules (Chiang, 1998). Interestingly, changes in bile acid synthesizing genes have not been examined after feeding a MCD diet. We therefore examined whether feeding the MCD diet was associated with changes in Cyp7a1 gene expression, which catalyzes the rate-limiting step in bile acid formation from cholesterol and sterol 12α-hydroxylase (Cyp8b1), required for the synthesis of cholic acid (Chiang, 1998). The MCD diet did not statistically decrease Cyp7a1 gene expression in WT mice, but decreased Cyp7a1 mRNA levels 50% in the H-RXRα-null mice (Fig. 5). The basal Cyp8b1 mRNA level was similar in the H-RXRα-null mice compared to WT mice (Fig. 5). The MCD diet decreased the mRNA levels of Cyp8b1 50 and 70% in WT and H-RXRα-null mice, respectively (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Hepatic Cyp7a1 and Cyp8b1 mRNA levels in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed a control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD (Inline graphic) diets for 2 weeks. Cyp7a1 and Cyp8b1 mRNA levels were determined by real-time PCR. Data represent mean ± SEM (n = 4-5). Asterisks (*) represent statistically significant difference (P < 0.05) between WT and H-RXRα-null mice. Pound (#) represent statistically significant difference (P < 0.05) between mice fed a control and a MCD diet. Two-way ANOVA revealed no significant effects of genotype and the MCD diet on gene expression of Cyp7a1 and Cyp8b1.

Effect of the MCD diet and RXRα deficiency on mRNA levels of hepatic uptake and efflux transporter genes

Ntcp is responsible for the uptake of bile acids from portal blood into hepatocytes. The MCD diet did not affect the expression of Ntcp in either genotype (Fig. 6). However, the MCD diet decreased the mRNA of the hepatic uptake transporter Oatp1a1 90 and 60% in WT and H-RXRα-null mice, respectively (Fig. 6). While the MCD diet did not affect the Oatp1a4 mRNA levels in WT mice, the MCD diet interacted with the genotype to induce the Oatp1a4 gene 4-fold in the H-RXRα-null mice (Fig. 6). The increase in Oatp1a4 mRNA levels by the MCD diet was higher in the H-RXRα-null mice than in WT mice (Fig. 6). The MCD diet inhibited Oatp1b2 gene expression 60% in WT mice, but not significantly in H-RXRα-null mice (Fig. 6). Feeding the MCD diet did not change the expression of the canalicular efflux transporters Bsep, Mrp2, Mdr2, and Mdr1b in either genotype of mice (Fig. 7). However, the basal mRNA level of Mdr2, which transports phospholipids into bile, was less in the H-RXRα-null mice than in the WT mice (Fig. 7). The expression of basolateral efflux transporters was also quantified (Figure 8). The basal Mrp3 expression was much lower in the H-RXRα-null mice than in the WT mice, suggesting that RXRα regulates constitutive expression of Mrp3 as previously reported (Cherrington et al., 2003). The MCD diet did not have a significant effect on Mrp3 expression in either genotype of mice (Fig. 8). However, Mrp4 expression was increased by the MCD diet in both WT (3.7-fold) and H-RXRα-null mice (2.5-fold) (Fig. 8).

Fig. 6.

Fig. 6

Open in a new tab

Hepatic uptake transporters Ntcp, Oatp1a1, Oatp1a4, and Oatp1b2 mRNA levels in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed a control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD (Inline graphic) diets for 2 weeks. Ntcp, Oatp1a1, Oatp1a4, and Oatp1b2 mRNA levels were analyzed by branched DNA (bDNA) signal amplification assay as described in Materials and Methods. Data represent mean ± SEM (n = 4-5). Pound (#) represent statistically significant difference (P < 0.05) between mice fed a control and a MCD diet. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet only on gene expression of Oatp1a4.

Fig. 7.

Fig. 7

Open in a new tab

Hepatic canalicular efflux transporters Bsep, Mrp2, Mdr2, and Mdr1b mRNA levels in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed control or methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD (Inline graphic) diets for 2 weeks. Bsep, Mrp2, Mdr2, and Mdr1b mRNA levels were analyzed by branched DNA (bDNA) signal amplification assay as described in Materials and Methods. Data represent mean ± SEM (n = 4-5). Asterisks (*) represent statistically significant difference (P < 0.05) between WT and H-RXRα-null mice. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed no significant effects of genotype and the MCD diet on hepatic canalicular efflux transporter gene expression.

Fig. 8.

Fig. 8

Open in a new tab

Hepatic basolateral efflux transporters Mrp3 and Mrp4 mRNA levels in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed a control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD (Inline graphic) diets for 2 weeks. Mrp3 and Mrp4 mRNA levels were analyzed by branched DNA (bDNA) signal amplification assay as described in Materials and Methods. Data represent mean ± SEM (n = 4-5). Asterisks (*) represent statistically significant difference (P < 0.05) between WT and H-RXRα-null mice. Pound (#) represent statistically significant difference (P < 0.05) between mice fed a control and a MCD diet. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed no significant effects of genotype and the MCD diet on Mrp3 and Mrp4 gene expression.

Effect of the MCD diet on serum ALT, ALP, and bile acids

After two weeks on the MCD diet, serum ALT activity was measured as an index of hepatocyte injury. The MCD diet did not increase ALT levels in WT mice. However, the MCD diet increased ALT levels in H-RXRα-null mice (Fig. 9). Serum ALP levels were lower in the H-RXRα-null mice compared to WT mice (Fig. 9). The MCD diet increased serum ALP 70 and 100% in H-RXRα-null and WT mice, respectively (Fig. 9). Serum bile acids were increased 70% in both WT and H-RXRα-null mice fed the MCD diet (Fig. 9). Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on ALT and ALP levels but not on serum bile acid levels (Fig. 9).

Fig.9.

Fig.9

Open in a new tab

Serum alanine aminotransferase (ALT), alkaline phosphatase (ALP), and bile acid levels in wild type (WT) and hepatocyte RXRα-null (H-RXRα-null) mice fed control or a methionine and choline deficient (MCD) diet.

Male WT or H-RXRα-null mice were fed control (■) or MCD (Inline graphic) diets for 2 weeks. Serum ALT, ALP, and bile acids were determined as described in Materials and Methods. Data represent mean ± SEM (n = 5-8). Asterisks (*) represent statistically significant difference (P < 0.05) between WT and H-RXRα-null mice. Pound (#) represent statistically significant difference (P < 0.05) between mice fed control and MCD diet. Daggers (†) represent statistically significant difference (P < 0.05) between WT mice and H-RXRα-null mice fed the MCD diet. Two-way ANOVA revealed significant effects (P < 0.05) of genotype and the MCD diet on ALT and ALP levels but not serum bile acid levels.

Discussion

The purpose of the current study was to examine the role of hepatocyte RXRα in the pathogenesis of NAFLD/NASH and how changes in expression of xenobiotic transporters contribute to pathogenesis of NASH. To examine these, WT and H-RXRα-null mice were fed a liquid MCD diet for 2 weeks.

The mechanisms of progression of a simple fatty liver to a fatty liver with liver injury or inflammation (NASH) remain unclear. However, a two-hit progression has been suggested (Day and James, 1998). Accumulation of fat in hepatocytes has been described as the “first hit” that serves as a potent stimulus for the “second hit”, including S-adenosylmethionine depletion, lipid toxicity, mitochondrial dysfunction, oxidative stress, apoptosis, and inflammation, culminating in liver injury (Day and James, 1998; Wortham et al., 2008). The mechanisms of steatosis development in the MCD model involve limiting the availability of methionine and choline which are important precursors for phosphatidylcholine synthesis (Vance and Vance, 1985). This in turn inhibits very low density lipoprotein (VLDL) assembly and blocks triglycerides and free fatty acids secretion from hepatocytes (Vance and Vance, 1985). Whether the MCD diet can also induce lipogenic genes has not been fully explored. Subsequent experiments therefore characterized lipid accumulation and expression of lipogenic genes.

Feeding the MCD diet increased steatosis in both WT and H-RXRα-null mice indicating that steatosis was promoted by methionine and choline deficiency. Contrary to expectation, lipid accumulation and hepatic triglyceride levels were similar after the MCD diet between WT mice and H-RXRα-null mice (Fig. 1 and Table 2), suggesting that absence of RXRα in hepatocytes did not affect lipid accumulation in this model. We next sought to explore how the MCD diet ingestion and RXRα deficiency affected expression of genes involved in lipid synthesis.

The ingestion of the MCD diet was associated with increased expression of several hepatic lipogenic genes known to be controlled by SREBP-1c and SREBP-2 (Horton et al., 2002) (Fig. 2). The SREBP-regulated battery of genes, including ACC-1a, FAS, and HMGCoA reductase was increased by the MCD diet in H-RXRα-null mice, but not in WT mice. In contrast, the effect of MCD diet on triglyceride accumulation in the WT mice appears to involve CD36, rather than SREBP-1- and SREBP-2-regulated genes, because CD36 mRNA levels were increased only in the WT mice (Fig 2). To date, this is the first report to demonstrate induction of SREBP-target genes while consuming a MCD diet. Interestingly, the induction of the SREBP-regulated genes was observed after a combination of MCD and high fat diet were fed to rats (Ota et al., 2007). Furthermore, SREBP-1c is activated by insulin and glucose leading to elevated mRNA levels of its target genes (Shimomura et al., 1999). It is possible that ingestion of the MCD diet by the H-RXRα-null mice could lead to hyperinsulinemia and induction of the SREBP-target genes. As human NASH typically occurs in obesity and insulin resistance, the transcriptional regulation of the SREBPs by the MCD diet in H-RXRα-null mice is important and remains to be investigated (Ludwig et al., 1980; Ahmed and Byrne, 2007).

Another mechanism by which the MCD diet stimulates steatosis is inhibition of fatty acid oxidation (Koteish and Diehl, 2001). Furthermore, it has been demonstrated that activation of genes involved in fatty acid oxidation by the PPARα agonist WY-14,643 ameliorated MCD-induced steatohepatitis (Ip et al., 2003). CPT-1 mRNA levels as well as ACOX1 and L-FABP mRNA and protein levels were reduced in the MCD-fed H-RXRα-null mice, and such reductions were not found in the WT mice (Fig. 3). CPT-1 controls the rate of mitochondrial β-oxidation and regulates the deposition or oxidation of fatty acids in the liver (Zammit, 1999). However, ACOX1 is the first and rate-limiting enzyme in peroxisomal β-oxidation encoding the enzymes responsible for the transfer of shortened fatty acids from peroxisomes to mitochondria (George and Liddle, 2008). L-FABP enhances hepatic uptake of fatty acids, exposing them to the fatty acid oxidation machinery (Desvergne et al., 1998). Furthermore, fatty acids are also oxidized through the microsomal ω-oxidation system by Cyp4a enzymes (Reddy and Hashimoto, 2001). The basal Cyp4a14 mRNA and protein levels were significantly reduced and were not induced after ingestion of the MCD diet in the H-RXRα-null mice (Fig. 3). Based on the decrease in mRNAs critical for free fatty acid metabolism in the livers of the H-RXRα-null mice, fatty acid accumulation was predicted. Indeed, free fatty acid levels were increased in the MCD-fed H-RXRα-null, but not in WT mice (Table 2). Intracellular accumulation of free fatty acids may damage cell membranes and possibly contribute to hepatocyte injury. Supportive of our findings, decreased expression of genes encoding enzymes for peroxisomal and mitochondrial β-oxidation were also observed in mice made vitamin A deficient by feeding pregnant female mice from day 10 of gestation and their pups vitamin A deficient diets for 9 weeks (Kang et al., 2007). Overall, our data indicate that both vitamin A and its receptor RXRα are important for proper fatty acid homeostasis in the liver.

The present data also indicated that RXRα deficiency did not further enhance lipid accumulation in this experimental NASH model. Many factors involved in lipid homeostasis were altered during the MCD diet treatment because of RXRα deficiency. For example, PPARα-mediated fatty acid oxidation is compromised in hepatocyte RXRα deficient mice; the expression of CD36 is up-regulated in MCD-treated WT mice, but not in MCD-treated H-RXRα-null mice; and SREBP-mediated genes are up-regulated in MCD-treated H-RXRα-null mice, but not in MCD-treated WT mice. These variables might eventually counter balance each other and result in no difference in the degree of steatosis in MCD-treated WT and H-RXRα-null mice mice.

Products of oxidative stress including lipid peroxides and cytokines have been found in patients with NASH suggesting their involvement in the transition from steatosis to steatohepatitis (Crespo et al., 2001; Reid, 2001). The impaired fatty acid oxidation and the resultant increase in hepatic NEFA levels suggested that the MCD diet could induce LPO in the H-RXRα-null mice. Contrary to expectation, we observed increased LPO only in the WT mice but not in H-RXRα-null mice (Table 2). As expected, Cyp2e1 enzyme activity was induced in the MCD-fed WT mice (Table 2). Consistent with the lack of LPO, Cyp2e1 enzyme activity and Cyp4a14 gene and protein expression were not increased in the MCD-fed H-RXRα-null mice (Fig. 3). Previous reports have shown that the MCD diet or a high fat diet can cause liver injury without induction of LPO and Cyp2e1 indicating that the extent of LPO does not always predict degree of toxicity (Deng et al., 2005; Arsov et al., 2006). The MCD diet produces inflammation (Ip et al., 2003). In agreement with these observations, gene expression of pro-inflammatory cytokines and chemokines were activated in the MCD diet-fed H-RXRα-null mice, but not in WT mice (Figs. 4). Taken together, our observation that the H-RXRα-null mice developed liver injury without both increased LPO and induction of Cyp2e1, but rather with elevated levels of pro-inflammatory cytokines, chemokines with mild histologic inflammation, suggests that oxidative stress is not an early event in the progression of steatosis to steatohepatitis as seen by other investigators (Sahai et al., 2004; Sundaram et al., 2005). The current study was done using mice treated with the MCD diet for 2 weeks, which is relatively a short treatment. It is therefore possible to speculate that oxidative stress is delayed in H-RXRα-null mice fed the MCD diet.

Expression of bile acid synthesis and hepatic transporter genes was quantified in an attempt to reveal further changes induced by the MCD diet in the absence of RXRα in hepatocytes. Moreover, the farnesoid X receptor (FXR), a key regulator of bile acid, lipid, and glucose metabolism, heterodimerizes with RXRα (Blumberg and Evans, 1998; Fiorucci et al., 2007). In the current study, the MCD diet resulted in significant suppression of key bile acid synthesizing genes Cyp8b1 and Cyp7a1 mRNA levels (Fig. 5). Interestingly, both hepatic Cyp7a1 and Cyp8b1 mRNA levels were reduced in MCD-fed H-RXRα-null mice suggesting that the regulation of these genes is not impaired in the absence of RXRα. Previous reports indicate that repression of Oatp1a1 is completely lost in PXR- and CAR-null mice after bile-duct ligation (BDL) (Stedman et al., 2005). It was of interest to examine the effects of the MCD diet on hepatic uptake transporters.

The mRNA levels of both Oatp1a1 and Oatp1b2 were markedly decreased but Oatp1a4 was unaffected by the MCD diet in WT mice (Fig. 6). The MCD diet also decreased Oatp1a1 mRNA levels in the H-RXRα-null mice; however, the decrease was not as pronounced as that seen in the WT mice. Cytokines including TNFα, IL-6, and IL-1β have been implicated as important in down-regulation of hepatic transporters during cholestasis (Hartmann et al., 2002; Geier et al., 2003). The reduced MCD-induced suppression of Oatp1a1 expression in the H-RXRα-null mice suggests the co-dependence of PXR and CAR on RXRα in Oatp1a1 down-regulation. Contrary to expectation, the MCD diet markedly induced Oatp1a4 without any effect on Oatp1b2 in H-RXRα-null mice. This data is similar to a previous report in which the bile duct ligation (BDL) model was used to induce cholestasis resulting in Oatp1a4 gene induction with inhibition of Oatp1a1 and Oatp1b2 (Slitt et al., 2007). Furthermore, the hepatotoxicants, acetaminophen and carbon tetrachloride can increase Oatp1a4 mRNA levels (Aleksunes et al., 2005). A possible explanation is that, the Oatp1a4 induction seen in H-RXRα-null mice fed the MCD diet may increase bile acid transport into hepatocytes for bile acid hydroxylation and detoxification. In addition, Oatp1a4 can function bidirectionally (Li et al., 2000). Thus, induction of Oatp1a4 may assist in bile acid efflux similar to Mrp3 and Mrp4. However, liver injury was observed in H-RXRα-null mice fed the MCD diet, suggesting that Oatp1a4 induction was not sufficient to ameliorate MCD-induced hepatotoxicity.

Reports indicate that induction of Bsep, Ostβ, and Mrp-isoforms in cholestatic mice is an adaptive mechanism to enhance excretion of toxic bile acids and conjugates into bile and/or portal blood (Fiorucci et al., 2007). Mrp3 and Mrp4 can transport bile acids (Mennone et al., 2006; Fiorucci et al., 2007). The induction of Mrp3 and Mrp4 by the MCD diet has been reported in rats (Lickteig et al., 2007). In the present study, while basal Mrp3 mRNA expression was lower in H-RXRα-null mice, the Mrp3 expression in both genotypes of mice was not induced after feeding the MCD diet (Fig. 8). However, the MCD diet markedly induced Mrp4 mRNA expression in WT, but was only moderately increased in the H-RXRα-null mice. The induction of Mrp4 seen in this study is also similar to that seen in bile duct-ligated mice, and lack of Mrp4 induction in Mrp4-null mice led to impaired cytoprotection (Mennone et al., 2006). FXR, PXR, and CAR regulate Mrp4 gene expression (Fiorucci et al., 2007). Bile-duct obstruction in FXR-null mice causes a robust induction of Mrp4 in the basolateral membrane leading to less liver injury compared to WT mice (Stedman et al., 2006). Because Mrp4 mRNA induction by MCD was observed in both WT and H-RXRα-null mice, this finding indicates that MCD-induced Mrp4 expression may be mediated through an RXRα-independent mechanism. Indeed, in a recent report, the treatment of WT and nuclear factor E2-related factor-2 (Nrf2)-null mice with Nrf2-activating chemicals, oltipraz and butylated hydroxyanisole, demonstrated that the induction of Mrp4 is Nrf2-dependent (Maher et al., 2007). This suggests that Nrf2 may be responsible for Mrp4 induction in the H-RXRα-null mice fed the MCD diet. Taken together, compared to WT mice, these data indicate that hepatocyte RXRα deficiency does not lead to significant impairment in bile acid homeostasis during MCD diet administration.

The above changes observed after the MCD diet in oxidative stress and expression of genes involved in fatty acid oxidation, pro-inflammatory cytokines, bile acid synthesis, and hepatic transporters prompted us to examine markers for liver injury in WT and H-RXRα-null mice. While the MCD diet caused hepatocyte injury only in H-RXRα-null mice seen as elevated ALT levels, it significantly increased serum bile acid levels and ALP activity in both WT and H-RXRα-null mice (Fig. 9). Serum bile acids and ALP are markers of cholestasis. Our findings indicate that the MCD diet caused cholestasis in both genotypes of mice. It is possible that the cholestasis observed in mice fed the MCD diet in this study might be due to impaired ductular permeability and compression or obstruction of the bile ducts by the accumulated fat in hepatocytes.

Collectively, these data indicate that deficient expression of RXRα in hepatocytes induces a disturbed balance between fatty acid synthesis and oxidation when consuming a MCD diet, ultimately, favoring fatty acid accumulation, inflammation, and liver injury in H-RXRα-null mice, as shown in Figure 10. We also demonstrate that feeding a MCD diet disrupts the normal transport of bile acids and inhibits enzymes involved in bile acid synthesis, which induces cholestasis independent of RXRα. In conclusion, while hepatocyte RXRα deficiency provides resistance against oxidative stress, these data suggest a critical role for RXRα in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury. Studies on how H-RXRα-null mice adapt to complete biliary obstruction using BDL are important in order to define the role of RXRα in providing hepatobiliary protection in the presence of elevated bile acids.

Fig. 10.

Fig. 10

Open in a new tab

Hepatocyte RXRα-deficiency causes dysregulation of fatty acid synthesis and oxidation.

MCD diet ingestion activates the sterol regulatory element binding proteins (SREBP)-regulated genes (FAS, ACC-1a and HMG CoA reductase) which up-regulate fatty acids, hepatic lipids and bile acid synthesis. Inactivation of PPARα and PPARα-target genes including CPT-1, ACOX1, and L-FABP by MCD diet and a lack of Cyp4a14 gene induction in the H-RXRα-null mice produces impaired fatty acid β-oxidation and hepatic fatty acid overload. Free fatty acid accumulation may lead to proinflammatory cytokine gene activation and liver injury in H-RXRα-null mice.

Acknowledgments

We thank Ms. Barbara Brede for the critical reading of the manuscript. This work was supported by National Institutes of Health Grants AA14147, CA53596, AA12081, and P20RR021940.

Abbreviations

L-FABP

liver fatty acid binding protein

Cyp2e1

cytochrome P450 2e1

Cyp4a14

cytochrome P450 4a14

MCD

methionine and choline deficient

PPARα

peroxisome proliferator-activated receptor alpha

SREBP

sterol regulatory element binding protein

ASH

alcoholic steatohepatitis

NASH

non-alcoholic steatohepatitis

NAFLD

nonalcoholic fatty liver disease

RT-PCR

reverse transcription-polymerase chain reaction

ALT

alanine aminotransferase

ALP

alkaline phosphatase

LPO

lipid peroxidation

NEFA

nonesterified fatty acid

TBST

Tris-buffered saline with 0.1% Tween 20

ACOX1

acyl-CoA oxidase 1

CAR

constitutive androstane receptor

Oatp

organic anion-transporting polypeptides

Ntcp

sodium/taurocholate-cotransporting polypeptide

Mrp

multidrug resistance-associated protein

Mdr2

multidrug resistance protein 2

Bsep

bile salt export pump

FXR

farnesoid X receptor

MIP-2

macrophage inflammatory protein-2

IL-1β

interleukin-1β

TNFα

tumor necrosis factor α

α-SMA

α-smooth muscle actin

CPT-1

carnitine palmitoyltransferase 1

ACC-1a

acetyl CoA carboxylase-1a

FAS

fatty acid synthase

FAT/CD36

fatty acid translocase

BDL

bile-duct ligation

VLDL

very low density lipoprotein

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Ahmed MH, Byrne CD. Modulation of sterol regulatory element binding proteins (SREBPs) as potential treatments for non-alcoholic fatty liver disease (NAFLD) Drug discovery today. 2007;12:740–747. doi: 10.1016/j.drudis.2007.07.009. [DOI] [PubMed] [Google Scholar]
  2. Arsov T, Larter CZ, Nolan CJ, Petrovsky N, Goodnow CC, Teoh NC, Yeh MM, Farrell GC. Adaptive failure to high-fat diet characterizes steatohepatitis in Alms1 mutant mice. Biochem Biophys Res Commun. 2006;342:1152–1159. doi: 10.1016/j.bbrc.2006.02.032. [DOI] [PubMed] [Google Scholar]
  3. Blumberg B, Evans RM. Orphan nuclear receptors--new ligands and new possibilities. Genes Dev. 1998;12:3149–3155. doi: 10.1101/gad.12.20.3149. [DOI] [PubMed] [Google Scholar]
  4. Bradbury MW. Lipid metabolism and liver inflammation. I. Hepatic fatty acid uptake: possible role in steatosis. Am J Physiol Gastrointest Liver Physiol. 2006;290:G194–198. doi: 10.1152/ajpgi.00413.2005. [DOI] [PubMed] [Google Scholar]
  5. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  6. Caldwell SH, Hespenheide EE, Redick JA, Iezzoni JC, Battle EH, Sheppard BL. A pilot study of a thiazolidinedione, troglitazone, in nonalcoholic steatohepatitis. Am J Gastroenterol. 2001;96:519–525. doi: 10.1111/j.1572-0241.2001.03553.x. [DOI] [PubMed] [Google Scholar]
  7. Cheng X, Maher J, Chen C, Klaassen CD. Tissue distribution and ontogeny of mouse organic anion transporting polypeptides (Oatps) Drug Metab Dispos. 2005;33:1062–1073. doi: 10.1124/dmd.105.003640. [DOI] [PubMed] [Google Scholar]
  8. Cherrington NJ, Slitt AL, Maher JM, Zhang XX, Zhang J, Huang W, Wan YJ, Moore DD, Klaassen CD. Induction of multidrug resistance protein 3 (mrp3) in vivo is independent of constitutive androstane receptor. Drug Metab Dispos. 2003;31:1315–1319. doi: 10.1124/dmd.31.11.1315. [DOI] [PubMed] [Google Scholar]
  9. Chiang JY. Regulation of bile acid synthesis. Front Biosci. 1998;3:d176–193. doi: 10.2741/a273. [DOI] [PubMed] [Google Scholar]
  10. Crespo J, Cayon A, Fernandez-Gil P, Hernandez-Guerra M, Mayorga M, Dominguez-Diez A, Fernandez-Escalante JC, Pons-Romero F. Gene expression of tumor necrosis factor alpha and TNF-receptors, p55 and p75, in nonalcoholic steatohepatitis patients. Hepatology. 2001;34:1158–1163. doi: 10.1053/jhep.2001.29628. [DOI] [PubMed] [Google Scholar]
  11. Dai T, Wu Y, Leng AS, Ao Y, Robel RC, Lu SC, French SW, Wan YJ. RXRalpha-regulated liver SAMe and GSH levels influence susceptibility to alcohol-induced hepatotoxicity. Exp Mol Pathol. 2003;75:194–200. doi: 10.1016/s0014-4800(03)00091-1. [DOI] [PubMed] [Google Scholar]
  12. Day CP, James OF. Steatohepatitis: a tale of two “hits”? Gastroenterology. 1998;114:842–845. doi: 10.1016/s0016-5085(98)70599-2. [DOI] [PubMed] [Google Scholar]
  13. Deng QG, She H, Cheng JH, French SW, Koop DR, Xiong S, Tsukamoto H. Steatohepatitis induced by intragastric overfeeding in mice. Hepatology. 2005;42:905–914. doi: 10.1002/hep.20877. [DOI] [PubMed] [Google Scholar]
  14. Desvergne BA, IJpenberg A, Devchand PR, Wahli W. The peroxisome proliferator-activated receptors at the cross-road of diet and hormonal signalling. J Steroid Biochem Mol Biol. 1998;65:65–74. doi: 10.1016/s0960-0760(97)00182-9. [DOI] [PubMed] [Google Scholar]
  15. Fiorucci S, Rizzo G, Donini A, Distrutti E, Santucci L. Targeting farnesoid X receptor for liver and metabolic disorders. Trends Mol Med. 2007;13:298–309. doi: 10.1016/j.molmed.2007.06.001. [DOI] [PubMed] [Google Scholar]
  16. Fromenty B, Pessayre D. Inhibition of mitochondrial beta-oxidation as a mechanism of hepatotoxicity. Pharmacol Ther. 1995;67:101–154. doi: 10.1016/0163-7258(95)00012-6. [DOI] [PubMed] [Google Scholar]
  17. Geier A, Dietrich CG, Voigt S, Kim SK, Gerloff T, Kullak-Ublick GA, Lorenzen J, Matern S, Gartung C. Effects of proinflammatory cytokines on rat organic anion transporters during toxic liver injury and cholestasis. Hepatology. 2003;38:345–354. doi: 10.1053/jhep.2003.50317. [DOI] [PubMed] [Google Scholar]
  18. George J, Liddle C. Nonalcoholic Fatty liver disease: pathogenesis and potential for nuclear receptors as therapeutic targets. Mol Pharm. 2008;5:49–59. doi: 10.1021/mp700110z. [DOI] [PubMed] [Google Scholar]
  19. Gyamfi MA, Damjanov I, French S, Wan YJ. The pathogenesis of ethanol versus methionine and choline deficient diet-induced liver injury. Biochem Pharmacol. 2008a;75:981–995. doi: 10.1016/j.bcp.2007.09.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gyamfi MA, He L, French SW, Damjanov I, Wan YJ. Hepatocyte retinoid X receptor alpha-dependent regulation of lipid homeostasis and inflammatory cytokine expression contributes to alcohol-induced liver injury. J Pharmacol Exp Ther. 2008b;324:443–453. doi: 10.1124/jpet.107.132258. [DOI] [PubMed] [Google Scholar]
  21. Gyamfi MA, Kocsis MG, He L, Dai G, Mendy AJ, Wan YJ. The role of retinoid X receptor alpha in regulating alcohol metabolism. J Pharmacol Exp Ther. 2006;319:360–368. doi: 10.1124/jpet.106.108175. [DOI] [PubMed] [Google Scholar]
  22. Gyamfi MA, Wan YJ. The effect of ethanol, ethanol metabolizing enzyme inhibitors, and Vitamin E on regulating glutathione, glutathione S-transferase, and S-adenosylmethionine in mouse primary hepatocyte. Hepatol Res. 2006;35:53–61. doi: 10.1016/j.hepres.2006.02.003. [DOI] [PubMed] [Google Scholar]
  23. Hartley DP, Klaassen CD. Detection of chemical-induced differential expression of rat hepatic cytochrome P450 mRNA transcripts using branched DNA signal amplification technology. Drug Metab Dispos. 2000;28:608–616. [PubMed] [Google Scholar]
  24. Hartmann G, Cheung AK, Piquette-Miller M. Inflammatory cytokines, but not bile acids, regulate expression of murine hepatic anion transporters in endotoxemia. J Pharmacol Exp Ther. 2002;303:273–281. doi: 10.1124/jpet.102.039404. [DOI] [PubMed] [Google Scholar]
  25. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest. 2002;109:1125–1131. doi: 10.1172/JCI15593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Ip E, Farrell G, Hall P, Robertson G, Leclercq I. Administration of the potent PPARalpha agonist, Wy-14,643, reverses nutritional fibrosis and steatohepatitis in mice. Hepatology. 2004;39:1286–1296. doi: 10.1002/hep.20170. [DOI] [PubMed] [Google Scholar]
  27. Ip E, Farrell GC, Robertson G, Hall P, Kirsch R, Leclercq I. Central role of PPARalpha-dependent hepatic lipid turnover in dietary steatohepatitis in mice. Hepatology. 2003;38:123–132. doi: 10.1053/jhep.2003.50307. [DOI] [PubMed] [Google Scholar]
  28. Jiang C, Ting AT, Seed B. PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature. 1998;391:82–86. doi: 10.1038/34184. [DOI] [PubMed] [Google Scholar]
  29. Kang HW, Bhimidi GR, Odom DP, Brun PJ, Fernandez ML, McGrane MM. Altered lipid catabolism in the vitamin A deficient liver. Mol Cell Endocrinol. 2007;271:18–27. doi: 10.1016/j.mce.2007.03.002. [DOI] [PubMed] [Google Scholar]
  30. Keitel V, Burdelski M, Warskulat U, Kuhlkamp T, Keppler D, Haussinger D, Kubitz R. Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology. 2005;41:1160–1172. doi: 10.1002/hep.20682. [DOI] [PubMed] [Google Scholar]
  31. Koteish A, Diehl AM. Animal models of steatosis. Semin Liver Dis. 2001;21:89–104. doi: 10.1055/s-2001-12932. [DOI] [PubMed] [Google Scholar]
  32. Lickteig AJ, Fisher CD, Augustine LM, Aleksunes LM, Besselsen DG, Slitt AL, Manautou JE, Cherrington NJ. Efflux transporter expression and acetaminophen metabolite excretion are altered in rodent models of nonalcoholic fatty liver disease. Drug Metab Dispos. 2007;35:1970–1978. doi: 10.1124/dmd.107.015107. [DOI] [PubMed] [Google Scholar]
  33. Liu YL, Sennitt MV, Hislop DC, Crombie DL, Heyman RA, Cawthorne MA. Retinoid X receptor agonists have anti-obesity effects and improve insulin sensitivity in Zucker fa/fa rats. Int J Obes Relat Metab Disord. 2000;24:997–1004. doi: 10.1038/sj.ijo.0801351. [DOI] [PubMed] [Google Scholar]
  34. Ludwig J, Viggiano TR, McGill DB, Oh BJ. Nonalcoholic steatohepatitis: Mayo Clinic experiences with a hitherto unnamed disease. Mayo Clin Proc. 1980;55:434–438. [PubMed] [Google Scholar]
  35. Maher JM, Dieter MZ, Aleksunes LM, Slitt AL, Guo G, Tanaka Y, Scheffer GL, Chan JY, Manautou JE, Chen Y, Dalton TP, Yamamoto M, Klaassen CD. Oxidative and electrophilic stress induces multidrug resistance-associated protein transporters via the nuclear factor-E2-related factor-2 transcriptional pathway. Hepatology. 2007;46:1597–1610. doi: 10.1002/hep.21831. [DOI] [PubMed] [Google Scholar]
  36. Maher JM, Slitt AL, Callaghan TN, Cheng X, Cheung C, Gonzalez FJ, Klaassen CD. Alterations in transporter expression in liver, kidney, and duodenum after targeted disruption of the transcription factor HNF1alpha. Biochem Pharmacol. 2006;72:512–522. doi: 10.1016/j.bcp.2006.03.016. [DOI] [PubMed] [Google Scholar]
  37. Maher JM, Slitt AL, Cherrington NJ, Cheng X, Klaassen CD. Tissue distribution and hepatic and renal ontogeny of the multidrug resistance-associated protein (Mrp) family in mice. Drug Metab Dispos. 2005;33:947–955. doi: 10.1124/dmd.105.003780. [DOI] [PubMed] [Google Scholar]
  38. Mennone A, Soroka CJ, Cai SY, Harry K, Adachi M, Hagey L, Schuetz JD, Boyer JL. Mrp4-/- mice have an impaired cytoprotective response in obstructive cholestasis. Hepatology. 2006;43:1013–1021. doi: 10.1002/hep.21158. [DOI] [PubMed] [Google Scholar]
  39. Mukherjee R, Davies PJ, Crombie DL, Bischoff ED, Cesario RM, Jow L, Hamann LG, Boehm MF, Mondon CE, Nadzan AM, Paterniti JR, Jr, Heyman RA. Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature. 1997;386:407–410. doi: 10.1038/386407a0. [DOI] [PubMed] [Google Scholar]
  40. Newsome PN, Beldon I, Moussa Y, Delahooke TE, Poulopoulos G, Hayes PC, Plevris JN. Low serum retinol levels are associated with hepatocellular carcinoma in patients with chronic liver disease. Aliment Pharmacol Ther. 2000;14:1295–1301. doi: 10.1046/j.1365-2036.2000.00849.x. [DOI] [PubMed] [Google Scholar]
  41. Nozaki Y, Yamagata T, Sugiyama M, Ikoma S, Kinoshita K, Funauchi M. Anti-inflammatory effect of all-trans-retinoic acid in inflammatory arthritis. Clin Immunol. 2006;119:272–279. doi: 10.1016/j.clim.2005.11.012. [DOI] [PubMed] [Google Scholar]
  42. Ota T, Takamura T, Kurita S, Matsuzawa N, Kita Y, Uno M, Akahori H, Misu H, Sakurai M, Zen Y, Nakanuma Y, Kaneko S. Insulin resistance accelerates a dietary rat model of nonalcoholic steatohepatitis. Gastroenterology. 2007;132:282–293. doi: 10.1053/j.gastro.2006.10.014. [DOI] [PubMed] [Google Scholar]
  43. Reddy JK, Hashimoto T. Peroxisomal beta-oxidation and peroxisome proliferator-activated receptor alpha: an adaptive metabolic system. Annu Rev Nutr. 2001;21:193–230. doi: 10.1146/annurev.nutr.21.1.193. [DOI] [PubMed] [Google Scholar]
  44. Reid AE. Nonalcoholic steatohepatitis. Gastroenterology. 2001;121:710–723. doi: 10.1053/gast.2001.27126. [DOI] [PubMed] [Google Scholar]
  45. Reinke LA, Moyer MJ. p-Nitrophenol hydroxylation. A microsomal oxidation which is highly inducible by ethanol. Drug Metab Dispos. 1985;13:548–552. [PubMed] [Google Scholar]
  46. Sahai A, Malladi P, Melin-Aldana H, Green RM, Whitington PF. Upregulation of osteopontin expression is involved in the development of nonalcoholic steatohepatitis in a dietary murine model. Am J Physiol Gastrointest Liver Physiol. 2004;287:G264–273. doi: 10.1152/ajpgi.00002.2004. [DOI] [PubMed] [Google Scholar]
  47. Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown MS, Goldstein JL. Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci USA. 1999;96:13656–13661. doi: 10.1073/pnas.96.24.13656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Slitt AL, Allen K, Morrone J, Aleksunes LM, Chen C, Maher JM, Manautou JE, Cherrington NJ, Klaassen CD. Regulation of transporter expression in mouse liver, kidney, and intestine during extrahepatic cholestasis. Biochim Biophys Acta. 2007;1768:637–647. doi: 10.1016/j.bbamem.2006.10.008. [DOI] [PubMed] [Google Scholar]
  49. Sorrentino P, Tarantino G, Perrella A, Micheli P, Perrella O, Conca P. A clinical-morphological study on cholestatic presentation of nonalcoholic fatty liver disease. Dig Dis Sci. 2005;50:1130–1135. doi: 10.1007/s10620-005-2719-1. [DOI] [PubMed] [Google Scholar]
  50. Stedman C, Liddle C, Coulter S, Sonoda J, Alvarez JG, Evans RM, Downes M. Benefit of farnesoid X receptor inhibition in obstructive cholestasis. Proc Natl Acad Sci USA. 2006;103:11323–11328. doi: 10.1073/pnas.0604772103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Stedman CA, Liddle C, Coulter SA, Sonoda J, Alvarez JG, Moore DD, Evans RM, Downes M. Nuclear receptors constitutive androstane receptor and pregnane X receptor ameliorate cholestatic liver injury. Proc Natl Acad Sci USA. 2005;102:2063–2068. doi: 10.1073/pnas.0409794102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sundaram SS, Whitington PF, Green RM. Steatohepatitis develops rapidly in transgenic mice overexpressing Abcb11 and fed a methionine-choline-deficient diet. Am J Physiol Gastrointest Liver Physiol. 2005;288:G1321–1327. doi: 10.1152/ajpgi.00455.2004. [DOI] [PubMed] [Google Scholar]
  53. Thacher SM, Vasudevan J, Chandraratna RA. Therapeutic applications for ligands of retinoid receptors. Curr Pharm Des. 2000;6:25–58. doi: 10.2174/1381612003401415. [DOI] [PubMed] [Google Scholar]
  54. Trauner M, Meier PJ, Boyer JL. Molecular regulation of hepatocellular transport systems in cholestasis. J Hepatol. 1999;31:165–178. doi: 10.1016/s0168-8278(99)80179-2. [DOI] [PubMed] [Google Scholar]
  55. Uchimura K, Nakamuta M, Enjoji M, Irie T, Sugimoto R, Muta T, Iwamoto H, Nawata H. Activation of retinoic X receptor and peroxisome proliferator-activated receptor-gamma inhibits nitric oxide and tumor necrosis factor-alpha production in rat Kupffer cells. Hepatology. 2001;33:91–99. doi: 10.1053/jhep.2001.21145. [DOI] [PubMed] [Google Scholar]
  56. Ulven SM, Natarajan V, Holven KB, Lovdal T, Berg T, Blomhoff R. Expression of retinoic acid receptor and retinoid X receptor subtypes in rat liver cells: implications for retinoid signalling in parenchymal, endothelial, Kupffer and stellate cells. Eur J Cell Biol. 1998;77:111–116. doi: 10.1016/S0171-9335(98)80078-2. [DOI] [PubMed] [Google Scholar]
  57. Vance JE, Vance DE. The role of phosphatidylcholine biosynthesis in the secretion of lipoproteins from hepatocytes. Can J Biochem Cell Biol. 1985;63:870–881. doi: 10.1139/o85-108. [DOI] [PubMed] [Google Scholar]
  58. Wan YJ, An D, Cai Y, Repa JJ, Hung-Po Chen T, Flores M, Postic C, Magnuson MA, Chen J, Chien KR, French S, Mangelsdorf DJ, Sucov HM. Hepatocyte-specific mutation establishes retinoid X receptor alpha as a heterodimeric integrator of multiple physiological processes in the liver. Mol Cell Biol. 2000;20:4436–4444. doi: 10.1128/mcb.20.12.4436-4444.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wan YJ, Han G, Cai Y, Dai T, Konishi T, Leng AS. Hepatocyte retinoid X receptor-αlpha-deficient mice have reduced food intake, increased body weight, and improved glucose tolerance. Endocrinology. 2003;144:605–611. doi: 10.1210/en.2002-221003. [DOI] [PubMed] [Google Scholar]
  60. Wan YJ, Morimoto M, Thurman RG, Bojes HK, French SW. Expression of the peroxisome proliferator-activated receptor gene is decreased in experimental alcoholic liver disease. Life Sci. 1995;56:307–317. doi: 10.1016/0024-3205(94)00953-8. [DOI] [PubMed] [Google Scholar]
  61. Weltman MD, Farrell GC, Liddle C. Increased hepatocyte CYP2E1 expression in a rat nutritional model of hepatic steatosis with inflammation. Gastroenterology. 1996;111:1645–1653. doi: 10.1016/s0016-5085(96)70028-8. [DOI] [PubMed] [Google Scholar]
  62. Wortham M, He L, Gyamfi M, Copple BL, Wan YJ. The Transition from Fatty Liver to NASH Associates with SAMe Depletion in db/db Mice Fed a Methionine Choline-Deficient Diet. Dig Dis Sci. 2008 Feb 26; doi: 10.1007/s10620-007-0193-7. Epub ahead of print. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zammit VA. Carnitine acyltransferases: functional significance of subcellular distribution and membrane topology. Prog Lipid Res. 1999;38:199–224. doi: 10.1016/s0163-7827(99)00002-8. [DOI] [PubMed] [Google Scholar]
  64. Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ, Moller DE. Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest. 2001;108:1167–1174. doi: 10.1172/JCI13505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhou J, Zhai Y, Mu Y, Gong H, Uppal H, Toma D, Ren S, Evans RM, Xie W. A novel pregnane X receptor-mediated and sterol regulatory element-binding protein-independent lipogenic pathway. J Biol Chem. 2006;281:15013–15020. doi: 10.1074/jbc.M511116200. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES