Abstract
Bovine neosporosis, caused by Neospora caninum is a leading cause of abortion in cattle. We postulated that neosporosis could lead to fetal death and mummification. Fifteen mummified fetuses were tested by polymerase chain reaction (PCR) for the mutation in the bovine SLC35A3 gene that causes complex vertebral malformation (CVM) and the pNC-5 gene which identifies N. caninum infection. DNA was extracted from the mummified fetuses and the sex of the mummies was determined by PCR. The CVM mutation was not detected in the mummified fetuses, but 4 fetuses were positive for N. caninum infection. The ages of the mummies with N. caninum infection were 100, 113, 123, and 131 days. Twelve of the 15 mummified fetuses were male. To our knowledge, this is the first detection of N. caninum as a possible cause of bovine fetal mummification.
Résumé
Neospora caninum et la malformation vertébrale complexe comme causes possibles de la momification fœtale bovine. La néosporose bovine, causée par Neospora caninum, est l’une des causes principales d’avortement chez le bétail. Nous avons postulé que la néosporose pourrait provoquer la mort du fœtus et la momification. Quinze fœtus momifiés ont été testés par l’amplification en chaîne par la polymérase (ACP) pour la mutation du gène bovin SLC35A3 qui cause une malformation vertébrale complexe (MVC) et le gène pNC-5 qui identifie l’infection par N. caninum. De l’ADN a été prélevé des fœtus momifiés et le sexe des carcasses a été déterminé par ACP. La mutation MVC n’a pas été détectée chez les fœtus momifiés, mais 4 fœtus ont obtenu des résultats positifs pour une infection par N. caninum. L’âge des carcasses momifiées infectées par N. caninum était de 100, 113, 123 et 131 jours. Douze des 15 fœtus momifiés étaient de sexe mâle. À notre connaissance, il s’agit de la première détection de N. caninum comme cause possible de momification fœtale bovine.
(Traduit par Isabelle Vallières)
Introduction
Bovine fetal mummification may occur from the 3rd to the 8th month of gestation, and usually is accompanied by slight to severe interplacental hemorrhage, causing a separation of the maternal and fetal placentas. The longer the condition exists, the drier, firmer, and more leather-like the tissues of the fetus become. Although abortions may take place, the condition usually is not suspected until parturition fails to occur (1). The causes of fetal mummification in cattle are often difficult to identify; however, some genetic factors due to autosomal recessive genes have been reported to be involved in bovine fetal mummification. Complex vertebral malformation (CVM) syndrome is a hereditary lethal disorder, determined by a recessive gene (2). It was discovered in the Danish population of Holstein cattle in 1999 and confirmed in several countries. The Danish Institute of Agricultural Sciences has determined that the mode of inheritance of CVM is autosomal recessive and that CVM is caused by a point mutation from G to T at nucleotide position 559 of the bovine solute carrier family 35 member 3 (SLC35A3) gene (Ministeriet for Fodervarer, Landburg og Fiskeri Danmarks Jordburgsforskining, international patent WO 02/40709 A2, 2002). Complex vertebral malformation causes death of the embryo, leading to frequent abortion or stillbirth (2,3).
Neospora caninum is a protozoan parasite of the family Sarcocystidae in the phylum Apicomplexa (4) and bears a great similarity to Toxoplasma gondii. The parasite was first detected in 1984 in dogs with lameness (5) and was for the first few years only connected with disease in dogs. Around 1990 its association with bovine abortion was unraveled (6–8). Neospora caninum has a worldwide distribution and is one of the most common causes of abortion in both dairy and beef cattle. Nonpregnant adult cattle that are infected with N. caninum do not show any signs of disease. Abortions may occur irrespective of whether the infection in the cow is recent, chronic, or congenital (9–11). Transplacental transmission of N. caninum to the offspring has been documented to occur during consecutive pregnancies in the same cow. In cattle, N. caninum is efficient in being transmitted vertically, even for several generations (12,13).
Several methods have been reported for the diagnosis of N. caninum (14–17). However, there are usually very few N. caninum organisms present even in the central nervous system (CNS) of infected animals, making it difficult to detect the parasites (18,19). The presence of N. caninum antibodies in body fluids or serum from a fetus or pre-colostral calf indicates infection. However, the absence of antibodies does not rule out neosporosis. There was no literature on the identification of N. caninum infection in bovine mummified fetuses. This study was undertaken to analysebovine mummies for CVM and to clarify the role of N. caninum infection in bovine fetal mummification.
Materials and methods
Mummified fetuses
Fifteen samples of bovine mummified fetuses of various ages collected from several areas in Japan were used in this study. The ages of the fetuses were estimated by measuring the crown-rump length (20). The dams of fetuses numbers 5, 7, 10, 11, 14, and injection 48–72 h before fetal 15 were given prostaglandin F2α expulsion. After expulsion, the fetuses were washed with phosphate buffered saline and the crown-rump length was measured then kept at −20°C until sampling. The breeds of the mummified fetuses were obtained from the farm’s records. However, for a number of mummified fetuses (n = 7) the farm had no breeding records. The remaining mummified fetuses were Holsteins (n = 6), Japanese Black (JB) (n = 1), and F1 crossbreed (n = 1) that resulted from inseminating a Holstein cow with semen from a Japanese Black.
Sexing of mummified fetuses using AMX/Y primers
The DNA of the mummified fetuses was extracted as reported previously (21,22), using phenol choloform followed by 2-propanol precipitation. For sexing of the mummified fetuses, genomic DNA was amplified with the DNA primers AMXY-F (CAGCCAAACCTCCCTCTGC) and AMXY-R (CCCGCTTGGTCTTGTCTGTTGC). These primers amplify a 280 bp fragment in females and fragments of 280 bp and 217 bp in males (21). The polymerase chain reactions (PCR) were performed in a total volume of 20 μL containing 13.1 μL of distilled water, 2 μL of 10 × ImmoBuffer, 2 μL of 2 mM of each dNTP, 1 μL of 50 mM MgCl2, 0.4 μL of forward and reverse primers (20 μM), 1.0 μL of genomic DNA of the mummies and 0.1 μL of Immolase DNA polymerase (5 U/μL). Samples were preheated for 7 min at 95°C followed by PCR amplification at the following temperatures; denaturation at 95°C for 1 min, annealing at 57°C for 30 s, and extension at 72°C for 1 min. The PCR products were analyzed by gel electrophoresis on 2% (w/v) TBE agarose gel, stained with 0.5 μL/mL ethidium bromide, and visualized under ultraviolet light.
Testing of mummified fetuses for CVM
Primers designed to produce a 114 bp PCR product of the bovine SLC35A3 gene (GenBank accession number, AY 160683) were F (CCCTCAGATTCTCAAGAGCTTA) and R (AAAGTAAA CCCAGCAAAGC). The PCR was performed in a total volume of 20 μL containing 13.9 μL of distilled water, 2 μL of 10 × PCR buffer, 2 μL of 2 mM of each dNTP, 0.5 μL of each primer (20 μM), 1.0 μL of genomic DNA, and 0.1 μL of AmpliTaq Gold DNA polymerase (5 U/μL). Samples were amplified for 35 cycles at the following temperatures: denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min. Polymerase chain reaction products were analyzed on 2% agarose gel with ethidium bromide in TBE buffer for 30 min at 100 volt. The PCR products were sequenced using the BigDye terminator cycle sequence procedure on an ABI PRISM 3100 DNA sequencer. The DNA sequences were analyzed using Sequencing Analysis Software Version 3.3.
PCR for detection of N. caninum in mummified fetuses
Polymerase chain reaction for detection of N. caninum was conducted with primer pairs Np4 (CCTCCCAATGCGAACGAAA) and Np7 (GGGTGAACCGAGGGAGTTG) (GenBank accession number, X84238) that target the pNC-5 gene of N. caninum. The Np4–Np7 primer pair is one of several pairs previously shown to be specific for N. caninum when tested against Toxoplasma, Sarcocystis, and Hammondia spp (23). The Np4–Np7 primer pair amplifies a DNA fragment of 275 bp. The PCR reactions were performed in a total volume of 20 μL containing 13.1 μL of distilled water, 2 μL of 10 × ImmoBuffer, 2 μL of 2 mM each dNTP, 1 μL of 50 mM MgCl2, 0.4 μL of forward and reverse primers (20 μM), 1.0 μL of genomic DNA of the mummies and 0.1 μL of Immolase DNA polymerase (5 U/μL). Samples were preheated for 7 min at 95°C followed by PCR amplification at the following temperatures; denaturation at 95°C for 30 s, annealing at 57°C for 30 s and extension at 72°C for 1 min. The PCR products were analyzed by gel electrophoresis on 2% (w/v) TBE agarose gel, stained with 0.5 μL/mL ethidium bromide and visualized under ultraviolet light.
Results
Sex of mummified fetuses
Out of 15 mummified fetuses, 12 were male and 3 were female as indicated by PCR analysis of the X and Y chromosomes of the fetuses (Table 1). This result might suggest a role of sex-linked genes in bovine fetal mummification.
Table 1.
Results of tests for age, sex, and genes for the CVM mutation and N. caninum infection
| Number | Breed | CRL* (mm) | Age (days) | Sex | CVM | N. caninum |
|---|---|---|---|---|---|---|
| 1 | Unknown | 100 | 69 | Male | Neg | Neg |
| 2 | Unknown | 120 | 76 | Male | Neg | Neg |
| 3 | Unknown | 150 | 87 | Male | Neg | Neg |
| 4 | Unknown | 170 | 100 | Male | Neg | Neg |
| 5 | F1† | 190 | 105 | Female | Neg | Neg |
| 6 | Unknown | 200 | 106 | Male | Neg | Neg |
| 7 | JB | 220 | 110 | Male | Neg | Positive |
| 8 | Holstein | 230 | 113 | Male | Neg | Positive |
| 9 | Holstein | 280 | 123 | Male | Neg | Positive |
| 10 | Holstein | 300 | 127 | Male | Neg | Neg |
| 11 | Holstein | 320 | 131 | Female | Neg | Positive |
| 12 | Unknown | 370 | 142 | Male | Neg | Neg |
| 13 | Unknown | 440 | 157 | Male | Neg | Neg |
| 14 | Holstein | 670 | 206 | Female | Neg | Neg |
| 15 | Holstein | 720 | 216 | Male | Neg | Neg |
CRL = crown-rump length; Neg = negative.
F1 (Japanese Black semen × Holstein dam); JB = Japanese Black.
Detection of the CVM mutation in the fetuses
Primers successfully amplified short PCR products (114 bp) for sequencing. All the mummies were free of the mutation causing CVM. The site at which the mutation was predicted to occur is indicted by arrows (Figure 1).
Figure 1.
Nucleotide sequences of PCR product of the SLC35A3 gene. The mutation across G → T (arrows) that characterizes the CVM mutation was absent in all mummified fetuses.
Presence of N. caninum in the mummified fetuses
Four of the 15 mummified fetuses were positive for the pNC-5 gene that characterizes N. caninum infection. Three fetuses were Holstein and 1 was Japanese Black. The ages of N. caninum-positive fetuses when death had occurred were 100, 113, 123, and 131 days (Table 1). These results indicated that N. caninum could infect both Holstein and Japanese Black cattle. The fetuses that were positive for N. caninum infection yielded a PCR product of 275 bp. Polymerase chain reaction products were sequenced and identified as being part of the pNC-5 gene (Figure 2).
Figure 2.
PCR-based identification of the pNC-5 gene which identifies N. caninum. Mummified fetuses (P) and control sample (C) positive for N. caninum infection showed a DNA band of 275 bp. Mummified fetuses (N) negative for N. caninum showed no DNA band. A ladder marker (L) of 100 bp was used. The PCR product which was sequenced for the pNC-5 gene of N. caninum is shown.
Discussion
Autosomal recessive genes have previously been associated with bovine fetal mummification (21,22); however, the recessive genes were present in the heterozygous state, suggesting that they were not the direct cause of the fetal death or mummification. In this study, 15 mummified fetuses were tested for the CVM mutation which induces fetal death when present in the homozygous recessive form. Deaton (24) cited a number of reports that stated a role for autosomal recessive lethal genes in bovine mummification. They postulated that the lethal gene might be sex-linked, since the abnormality was observed in some cow families for several generations and most of the mummified fetuses were males. However, in a study of 32 mummified fetuses (25), it was concluded that the condition is not due to a single recessive lethal gene and that environmental influences very likely are involved. In the present study, 75% of the mummified fetuses were males, which emphasizes the possibility of some sex-linked genes being involved in fetal mummification; however, additional studies are required to elucidate the role of sex-linked genes in bovine fetal mummification.
In Japan, dogs, which are definitive and intermediate hosts for N. caninum, are usually kept on dairy farms. The ages of mummified fetuses which tested positive for N. caninum indicated that death of the fetuses occured at 4–5 mo of gestation. These results are consistent with another report (26) which stated that cows may abort from 3 mo gestation to term. Most neosporosis-induced abortions occur at 5–6 mo of gestation (7,11,27). Fetuses may die in utero, be resorbed, mummified, autolyzed or delivered as a stillbirth. In another study, N. caninum antibody titers rose by 1.5–2.5 dilution steps to reach a plateau 4–5 mo before parturition, indicating a reactivation of the parasite rather than a re-infection at mid-gestation (28). The rate of abortion after N. caninum infection was 18% during the first 60 days of an outbreak and mummified fetuses were discovered on day 44 after the onset of the outbreak (29).
A DNA-based method seemed to be the most suitable technique for diagnosing neosporosis in mummified fetuses. Neospora caninum has been detected by PCR in formalin-fixed paraffin-embedded bovine aborted brain tissue (26). The detection of pathognomic lesions of N. caninum in mummified fetuses by immunohistochemistry, histopathology and serology is difficult due to severe tissue changes. Moreover, immunohistochemical demonstration of N. caninum in lesions is evidence for etiology of the abortion but the method is very insensitive. A PCR-based assay to identify N. caninum infection in mummies was a good tool for diagnosis of the cause of fetal death. In addition, the ability to amplify parasite-specific DNA in mummified tissues provides a new method to obtain N. caninum genetic material for analysis of strain genotype or variations in specific parasite genes. The pNC-5 gene was chosen as the target for this study for several reasons: this sequence has apparently not been found in other taxa; it is a repetitive sequence (23) and, finally, it has shown excellent sensitivity when used in the diagnosis of N. caninum in bovine aborted fetuses (18).
There are no solid data on the economic losses due to neosporosis for the cattle industry worldwide, but losses are estimated to be in the millions of dollars. As many as 42% of cows may abort due to neosporosis; the economic impact will depend on the direct cost and value of calves that are lost. Indirect costs include professional help and costs associated with establishing diagnosis, rebreeding, possible loss of milk yield, and replacement costs if aborted cows are culled (30–32). It has been suggested that N. caninum is likely to be a cause of early fetal death but there has previously been no data to support this (33); such an outcome may increase the economic loss in dairy farms. In the present study N. caninum infected both Holstein and Japanese Black breeds, which increases the potential economic impact of neosporosis in both dairy and beef herds. In Japan, most of the cows with a history of fetal mummification are culled as farmers detest keeping these cows in the farms.
The data presented in this study indicate that fetal mummification was not caused by the complex vertebral malformation mutation. However, N. caninum infection was detected in only 25% of the bovine mummified fetuses.
Acknowledgments
This study was supported by JSPS (No. 18.06222). The authors are thankful to Prof. Toshihiko Nakao (Yamaguchi Univiversity) and Theriogenology Department, Rakuno Gakuen University for providing mummies samples. Thanks due to NOSAI Higashi-Hiroshima staffs for their cooperation. CVJ
References
- 1.Roberts SJ. General observation of abortion. In: Roberts SJ, editor. Veterinary Obestetric and Genital Diseases. Woodstock: published by the author; 1971. pp. 170–173. [Google Scholar]
- 2.Agerholm JS, Bendixen C, Andersen O, Arnbjerg J. Complex vertebral malformations in Holstein calves. J Vet Diagn Invest. 2001;13:283–289. doi: 10.1177/104063870101300401. [DOI] [PubMed] [Google Scholar]
- 3.Nielsen US, Aamand GP, Andersen O, Bendixen C, Nielsen VH, Agerholm JS. Effects of complex vertebral malformation on fertility traits in Holstein cattle. Livest Prod Sci. 2003;79:233–238. [Google Scholar]
- 4.Dubey JP, Carpenter JL, Speer CA, Topper MJ, Uggla A. Newly recognized fatal protozoan disease of dogs. J Am Vet Med Assoc. 1988;192:1269–1285. [PubMed] [Google Scholar]
- 5.Bjerkhs I, Mohn SF, Presthus J. Unidentified cyst-forming sporo-zoon causing encephalomyelitis and myositis in dogs. Zeitschrift fur Parasitenkunde. 1984;70:271–274. doi: 10.1007/BF00942230. [DOI] [PubMed] [Google Scholar]
- 6.Thilsted JP, Dubey JP. Neosporosis-like abortions in a herd of dairy cattle. J Vet Diagn Invest. 1989;1:205–209. doi: 10.1177/104063878900100301. [DOI] [PubMed] [Google Scholar]
- 7.Anderson ML, Blanchard PC, Barr BC, Dubey JP, Hoffman RL, Conrad PA. Neospora-like protozoan infection as a major cause of abortion in California dairy cattle. J Am Vet Med Assoc. 1991;198:241–244. [PubMed] [Google Scholar]
- 8.Barr BC, Anderson ML, Dubey JP, Conrad PA. Neospora-like pro-tozoal infections associated with bovine abortions. Vet Path. 1991;28:110–116. doi: 10.1177/030098589102800202. [DOI] [PubMed] [Google Scholar]
- 9.Thurmond MC, Hietala SK. Effect of congenitally acquired Neospora caninum infection on risk of abortion and subsequent abortions in dairy cattle. Am J Vet Res. 1997;58:1381–1385. [PubMed] [Google Scholar]
- 10.Moen AR, Wouda W, Mul MF, Graat EA, van Werven T. Increased risk of abortion following Neospora caninum abortion outbreaks: A retrospective and prospective cohort study in four dairy herds. Theriogenology. 1998;49:1301–1309. doi: 10.1016/S0093-691X(98)00077-6. [DOI] [PubMed] [Google Scholar]
- 11.Wouda W, Moen AR, Schukken YH. Abortion risk in progeny of cows after a Neospora caninum epidemic. Theriogenology. 1998;49:1311–1316. doi: 10.1016/S0093-691X(98)00078-8. [DOI] [PubMed] [Google Scholar]
- 12.Anderson ML, Reynolds JP, Rowe JD, et al. Evidence of vertical transmission of Neospora sp. infection in dairy cattle. J Am Vet Med Assoc. 1997;210:1169–1172. [PubMed] [Google Scholar]
- 13.Schares G, Peters M, Wurm R, Barwald A, Conraths FJ. The efficiency of vertical transmission of Neospora caninum in dairy cattle analysed by serological techniques. Vet Parasitol. 1998;80:87–98. doi: 10.1016/s0304-4017(98)00195-2. [DOI] [PubMed] [Google Scholar]
- 14.Holmdahl OJM, Mattsson JG. Rapid and sensitive identification of Neospora caninum by in vitro amplification of the internal transcribed spacer 1. Parasitol. 1996;112:177–182. doi: 10.1017/s0031182000084742. [DOI] [PubMed] [Google Scholar]
- 15.Gottstein B, Hentrich B, Wyss R, et al. Molecular and immunodiagnostic investigations of bovine neosporosis in Switzerland. Int J Parasitol. 1998;28:679–691. doi: 10.1016/S0020-7519(98)00006-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ellis JT. Polymerase chain reaction approaches for the detection of Neospora caninum and Toxoplasma gondii. Int J Parasitol. 1998;28:1053–1060. doi: 10.1016/s0020-7519(98)00096-4. [DOI] [PubMed] [Google Scholar]
- 17.Baszler TV, Long MT, McElwain TF, Mathison BA. Interferon-gamma and interleukin-12 mediate protection to acute Neospora caninum infection in BALB/c mice. Int J Parasitol. 1999;29:1635–1646. doi: 10.1016/s0020-7519(99)00141-1. [DOI] [PubMed] [Google Scholar]
- 18.Dubey JP. Recent advances in Neospora and neosporosis. Vet Parasitol. 1999;84:349–367. doi: 10.1016/s0304-4017(99)00044-8. [DOI] [PubMed] [Google Scholar]
- 19.Thurmond MC, Hietala SK, Blanchard PC. Predictive values of fetal histopathology and immunoperoxidase staining in diagnosing bovine abortion caused by Neospora caninum in a dairy herd. J Vet Diagn Invest. 1999;11:90–94. doi: 10.1177/104063879901100115. [DOI] [PubMed] [Google Scholar]
- 20.Evans HE, Sack WO. Prenatal development of domestic and laboratory mammals: Growth curves, external features and selected references. Anatomy Histology Embryology. 1973;2:11–45. doi: 10.1111/j.1439-0264.1973.tb00253.x. [DOI] [PubMed] [Google Scholar]
- 21.Ghanem M, Nakao T, Nishibori M. Deficiency of Uridine Monophosphate Synthase (DUMPS) and X-chromosome deletion in fetal mummification in cattle. Anim Reprod Sci. 2006;91:45–54. doi: 10.1016/j.anireprosci.2005.03.008. [DOI] [PubMed] [Google Scholar]
- 22.Ghanem M, Nishibori M, Nakao T, Moriyoshi M. DNA extraction from bovine mummified fetuses and detection of Factor XI gene deficiency in the mummies. J Reprod Dev. 2005;51:347–352. doi: 10.1262/jrd.16080. [DOI] [PubMed] [Google Scholar]
- 23.Yamage M, Flechtner O, Gottstein B. Neospora caninum: Specific oligonucleotide primers for the detection of brain “cyst” DNA of experimentally infected nude mice by the polymerase chain reaction (PCR) J Parasitol. 1996;82:272–279. [PubMed] [Google Scholar]
- 24.Deaton OW, Durward Olds, Seath DM. A Study of some possible genetic causes of mummified fetuses in dairy cattle. J Dairy Sci. 1959;42:312–314. [Google Scholar]
- 25.Erb RE, Morrison RA. Effect of mummified fetuses on the prolificacy of Holsteins. J Dairy Sci. 1957;40:1030–1035. [Google Scholar]
- 26.Dubey JP. Review of Neospora caninum and neosporosis in animals. The Korean J Parasitol. 2003;41:1–16. doi: 10.3347/kjp.2003.41.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Stenlund S. Swedish University of Agricultural Sciences Uppsala; 2000. Neospora caninum in cattle in Sweden Isolation of the parasite and studies of its transmission. Doctoral thesis. [Google Scholar]
- 28.Anderson ML, Palmer CW, Thurmond MC, et al. Evaluation of abortions in cattle attributable to neosporosis in selected dairy herds in California. J Am Vet Med Assoc. 1995;207:1206–1210. [PubMed] [Google Scholar]
- 29.McAllister MM, Huffman EM, Hietala SK, Conrad PA, Anderson ML, Salman MD. Evidence suggesting a point source exposure in an outbreak of bovine abortion due to neosporosis. J Vet Diagn Invest. 1996;8:355–357. doi: 10.1177/104063879600800313. [DOI] [PubMed] [Google Scholar]
- 30.Thurmond MC, Hietala SK. Culling associated with Neospora caninum infection in dairy cows. Am J Vet Res. 1996;57:1559–1562. [PubMed] [Google Scholar]
- 31.Thurmond MC, Hietala SK. Effect of Neospora caninum infection on milk production in first-lactation dairy cows. J Am Vet Med Assoc. 1997b;210:672–674. [PubMed] [Google Scholar]
- 32.Hernandez J, Risco C, Donovan A. Association between exposure to Neospora caninum and milk production in dairy cows. J Am Vet Med Assoc. 2001;219:632–635. doi: 10.2460/javma.2001.219.632. [DOI] [PubMed] [Google Scholar]
- 33.Trees AJ, Davison HC, Innes EA, Wastling JM. Towards evaluating the economic impact of bovine neosporosis. Int J Parasitol. 1999;29:1195–1200. doi: 10.1016/s0020-7519(99)00093-4. [DOI] [PubMed] [Google Scholar]


