Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2009 Mar 20;284(12):7903–7913. doi: 10.1074/jbc.M806920200

Involvement of MicroRNAs in Hydrogen Peroxide-mediated Gene Regulation and Cellular Injury Response in Vascular Smooth Muscle Cells*

Ying Lin ‡,1, Xiaojun Liu ‡,1, Yunhui Cheng ‡,1, Jian Yang ‡, Yuqing Huo §, Chunxiang Zhang ‡,2
PMCID: PMC2658083  PMID: 19158092

Abstract

MicroRNAs (miRNAs) comprise a novel class of endogenous, small, noncoding RNAs that negatively regulate ∼30% of genes in a cell via degradation or translational inhibition of their target mRNAs. However, the effects of reactive oxygen species (ROS) on miRNA expression and the roles of miRNAs in ROS-mediated gene regulation and biological functions of vascular cells are unclear. Using microarray analysis, we demonstrated that miRNAs are aberrantly expressed in vascular smooth muscle cells (VSMCs) after treatment with hydrogen peroxide (H2O2). H2O2-mediated up-regulation of microRNA-21 (miR-21) was further confirmed by quantitative real-time PCR. To determine the potential roles of miRNAs in H2O2-mediated gene regulation and cellular effects, miR-21 expression was down-regulated by miR-21 inhibitor and up-regulated by pre-miR-21. H2O2-induced VSMC apoptosis and death were increased by miR-21 inhibitor and decreased by pre-miR-21. Programmed cell death 4(PDCD4) was a direct target of miR-21 that was involved in miR-21-mediated effects on VSMCs. Pre-miR-21-mediated protective effect on VSMC apoptosis and death was blocked via adenovirus-mediated overexpression of PDCD4 without the miR-21 binding site. Moreover, activator protein 1 was a downstream signaling molecule of PDCD4 in miR-21-modulated VSMCs. The results suggest that miRNAs in VSMCs are sensitive to H2O2 stimulation. miRN-21 participates in H2O2-mediated gene regulation and cellular injury response through PDCD4 and the activator protein 1 pathway. miRNAs might play a role in vascular diseases related to ROS.


The current literature indicates an increasing body of evidence demonstrating that reactive oxygen species (ROS)3 such as superoxide and hydrogen peroxide (H2O2) are involved in the pathogenesis of many vascular diseases by modulating expression of a large number of genes related to vascular cell differentiation, proliferation, migration, and apoptosis (1–5). In this respect, increased ROS are associated with a variety of vascular disorders such as atherosclerosis, hypertension, restenosis after angioplasty or bypass, diabetic vascular complications, transplantation arteriopathy, and vascular aneurysm (5–12). ROS-mediated gene expression regulation has recently been extensively studied at epigenetic and transcriptional levels (3–5, 13, 14). It is clear that exposure of vascular cells to ROS modulates oxidation-sensitive signaling pathways and transcription factors that could be an important mechanism responsible for ROS-mediated expression changes of multiple genes.

Recent studies reveal that post-transcriptional controls of gene expression such as translational regulation are as important as epigenetic and transcriptional controls (15, 16). However, the effects of ROS on gene expression regulation at the translational level are currently unclear.

MicroRNAs (miRNAs) comprise a novel class of endogenous, small, noncoding RNAs that negatively regulate gene expression via degradation or translational inhibition of their target mRNAs (17–20). Functionally, an individual miRNA is as important as a transcription factor, because it is able to regulate the expression of its multiple target genes. Analogous to the first RNA revolution in the 1980s when Cech (21) discovered the enzymatic activity of RNA, this recent discovery of miRNA and RNA interference may represent the second RNA revolution (22). Currently, ∼700 miRNAs have been identified and sequenced in humans (23, 24), and the estimated number of miRNA genes is as high as 1000 in the human genome (23–25). As a group, miRNAs may directly regulate at least 30% of the genes in a cell (25, 26). It is not surprising that miRNAs are involved in the regulation of almost all major cellular functions, such as cell differentiation, proliferation/growth, mobility, and apoptosis. Therefore, miRNAs could be the pivotal regulators in normal development and physiology, as well as disease states, including vascular disease (24).

Although miRNAs represent a new layer of gene expression regulators at the translational level, the effects of ROS on miRNA expression and the potential roles of miRNAs in ROS-mediated gene regulation and biological functions of vascular cells are unclear. The objective of the current study is to determine the effect of an ROS, H2O2, on miRNA expression in cultured vascular smooth muscle cells (VSMCs) and to determine whether miRNAs play a role in H2O2-mediated effects on gene expression and cellular function.

EXPERIMENTAL PROCEDURES

Cell Culture—VSMCs were obtained from the aortic media of male Sprague-Dawley rats (5 weeks old) using an enzymatic dissociation method as described (27). VSMCs were cultured with Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. Cells between passage 3 and 6 were applied for the experiments.

Microarray Analysis of miRNA Expression—Cultured rat VSMCs were treated with either vehicle or H2O2 (200 μm) for 6 h. miRNAs were then isolated from the cultured cells using the mirVana miRNA isolation kit (Ambion, Inc.). miRNA expression was determined by miRNA microarray analysis as described (28, 29). The assay started with a 4- to 8-μg total RNA sample, which was size-fractionated using a YM-100 microcon centrifugal filter, and the small RNAs (<300 nucleotides) isolated were 3′-extended with a poly(A) tail using poly(A) polymerase. An oligonucleotide tag was then ligated to the poly(A) tail for later fluorescent dye staining; two different tags were used for the two RNA samples in dual-sample experiments. Hybridization was performed overnight on a microfluidic chip using a micro-circulation pump (Atactic Technologies). On the microfluidic chip, each detection probe consisted of a chemically modified nucleotide coding segment complementary to 238 mature miRNAs (Chip ID miRRat, 9.2 version, LC Sciences) and a spacer segment of polyethylene glycol to extend the coding segment away from the substrate. The detection probes were made by in situ synthesis using photogenerated reagent chemistry. The hybridization melting temperatures were balanced by chemical modifications of the detection probes. Hybridization used 100 μl of 6× saline-sodium phosphate-EDTA buffer (0.90 m NaCl, 60 mm Na2HPO4, 6 mm EDTA, pH 6.8) containing 25% formamide at 34 °C. After RNA hybridization, tag-conjugating Cy3 and Cy5 dyes were circulated through the microfluidic chip for dye staining. Fluorescence images were collected using a laser scanner (GenePix 4000B, Molecular Device) and digitized using Array-Pro image analysis software (Media Cybernetics). Data were analyzed by subtracting the background and then normalizing the signals using a LOWESS filter (locally weighted regression). For two-color experiments, the ratio of the two sets of detected signals (log2-transformed, balanced), and p values of the t test were calculated; differentially detected signals were those with p values < 0.05. Proprietary “spike-in” controls were used at each step of the process (30, 31).

Measurements of VSMC Apoptosis and Cell Death Induced by H2O2—Briefly, VSMCs cultured in 0.1% fetal bovine serum were treated with either vehicle or H2O2 (10–200 μm, Sigma) for 24 h. Afterward, cell death and cell apoptosis were measured by trypan exclusion and terminal deoxynucleotide transferase dUTP nick end labeling (TUNEL) staining as described previously (29, 32). For the trypan exclusion, the cells were harvested and stained with 0.25% trypan blue for 2 min, and live cells were counted using a hemocytometer (32). Then the total cells were counted, and the percentage of dead cells (% cell death) was calculated. For TUNEL analysis, VSMCs cultured on coverslips in 24-well plates were fixed in 4% paraformaldehyde. TUNEL staining was done using the in situ cell death detection kit (Roche Applied Science) according to the manufacturer's protocol. The number of TUNEL-positive cells was counted under a fluorescence microscope. A VSMC apoptosis index was calculated using the following formula: (number of TUNEL-positive cells/total cells) × 100.

Oligonucleotide Transfection, miR-21 Knockdown, miR-21 Overexpression, and Programmed Cell Death 4 (PDCD4) Gene Up-regulation in Cultured VSMCs—Oligonucleotide transfection was performed according to an established protocol (28, 29). Briefly, cells were transfected using a transfection reagent (Qiagen) 24 h after seeding into the well. Transfection complexes were prepared according to the manufacturer's instructions. For the miR-21 knockdown, the miR-21 inhibitor (LNA-anti-miR-21) was added to the culture media at final oligonucleotide concentration of 30 nm. The locked nucleic acid (LNA)-anti-miR molecules were synthesized as unconjugated and fully phosphorothioated mixed LNA/DNA oligonucleotides with a 6-carboxyfluorescein (FAM) moiety at the 5′ end. The following sequences were synthesized by Exiqon: LNA-anti-miR-21, 5′-FAM-tcagtctgataagcta-3′, and its control oligonucleotide, LNA-control, 5′-FAM-cgtcagtatgcgaatc-3′. For the miR-21 up-regulation, pre-miR-21 (Ambion, Inc.) was added directly to the complexes at final oligonucleotide concentration of 30 nm. PDCD4 gene up-regulation was performed by adenovirus expressing PDCD4 without miR-21 binding site at 3′-UTR (Ad-PDCD4) (30 m.o.i.) or with miR-21 binding site at 3′-UTR (Ad-PDCD4) (30 m.o.i.). The transfection medium was replaced 4 h post-transfection by the regular culture medium. Vehicle control, oligonucleotide control (Ambion, Inc.) and adenoviruses control (Ad-GFP) were applied.

RNA Levels Were Determined by qRT-PCR—Briefly, RNAs from VSMCs were isolated with an RNA isolation kit (Ambion, Inc.). qRT-PCR for miR-21 was performed on cDNA generated from 50 ng of total RNA using the protocol of the mirVana qRT-PCR miRNA detection kit (Ambion, Inc). qRT-PCR for PDCD4 was performed on cDNA generated from 200 ng of total RNA using the protocol of a qRT-PCR mRNA detection kit (Roche Applied Science). Amplification and detection of specific products were performed with a LightCycler 480 detection system (Roche Applied Science). As an internal control, U6 was used for miR-21 template normalization and glyceraldehyde-3-phosphate dehydrogenase was used for PDCD4 template normalization. Fluorescent signals were normalized to an internal reference, and the threshold cycle (Ct) was set within the exponential phase of the PCR. The relative gene expression was calculated by comparing cycle times for each target PCR. The target PCR Ct values were normalized by subtracting the U6 or glyceraldehyde-3-phosphate dehydrogenase Ct value, which provided the ΔCt value. The relative expression level between treatments was then calculated using the following equation: relative gene expression = 2-(ΔCtsample-ΔCtcontrol) (28, 29).

Western Blot Analysis—Proteins isolated from cultured VSMCs were determined by Western blot analysis. Equal amounts of protein were subjected to SDS-PAGE. A standard Western blot analysis was conducted using PDCD4 antibody (Santa Cruz Biotechnology). Glyceraldehyde-3-phosphate dehydrogenase antibody (1:5000 dilution, Cell Signaling) was used as a loading control.

Construction of the Adenovirus Expressing PDCD4 and Control Virus Expressing GFP—The adenovirus expressing PDCD4 and control virus expressing GFP (Ad-GFP) were generated using the adeno-X™ expression systems 2 kit (Clontech) according to the manufacturer's protocols. Briefly, a 1410-bp fragment of the full-length coding sequence was amplified with primers tgaattcatggatgtagaaaacgagcagata and taagcttcagtagctctcaggtttaagacga by using RT-PCR and was inserted into pDNR-CMV donor vector (Clontech) at EcoRI and HindIII sites. This vector was named pDNR-CMC-PDCD4. The construct was sequenced to confirm the DNA sequence. The PDCD4 fragment was then excised from the pDNR-CMC-PDCD4 and was inserted into the pLP-Adeno-X-CMV vector using cre recombinase, which was then termed pLP-Adeno-X-CMV-PDCD4. The pLP-Adeno-X-CMV-PDCD4 plasmid digested by PacI was used to transfect low passage HEK 293 cells to produce recombinant adenovirus with Lipofectamine 2000 according to the manufacturer's protocols (Invitrogen). Adenovirus-expressing GFP was generated as described before (33). The GFP DNA fragment was excised from pGFP-N3 (Clontech) by digestion of the plasmid with SalI and NotI and subcloned into an entry vector, pENTR3C (Invitrogen), producing pENTR3C-GFP. pENTR3C-GFP was transformed into Escherichia coli DH5α, and the plasmids were amplified. These plasmids were recombined with pAd/CMV/V5-DEST as described by the manufacturer (Invitrogen), producing pAd-GFP plasmids, which were verified by DNA sequencing. The pAd-EGFP with PacI was transfected into HEK293A cells. The resulting adenoviruses (Ad-PDCD4, Ad-PDCD4-Lack, and Ad-GFP) were further amplified by infection of HEK293A cells and purified by cesium chloride gradient ultracentrifugation. Ad-PDCD4, Ad-PDCD4-Lack, and Ad-GFP were titrated using a standard plaque assay.

Luciferase Assay—A construct in which a fragment of the 3′-UTR of PDCD4 mRNA containing the putative miR-21 binding sequence was cloned into a firefly luciferase reporter construct and transfected into HEK 293 cells with either vehicle (vehicle control), an empty plasmid (pDNR-CMV, 0.2 μg/ml), a plasmid expressing miR-21 (pmiR-21, 0.2 μg/ml), or a control plasmid expressing an unrelated miRNA, miR-145 (pmiR-145), following the transfection procedures provided by Invitrogen. The construct with mutated targeting fragment (AUAAGCUA) at the 3′-UTR of PDCD4 without the putative miR-21 binding sequence was used as a mutated control.

Activator protein 1 (AP-1) activity was measured using luciferase assay as described (34). Briefly, adenoviral vector (Ad-AP1-Luc) containing Photinus pyralis (firefly) gene that is controlled by a synthetic promoter with direct repeats of the transcription recognition sequences for the AP-1 was purchased from Vector Biolabs. Cultured VSMCs pretreated with vehicle, control oligonucleotides (oligonucleotide control), LNA-anti-miR-21 (30 nm), pre-miR-21 (30 nm), Ad-GFP (30 m.o.i.), Ad-PDCD4 (30 m.o.i.), Ad-PDCD4-Lack (30 m.o.i.), or pre-miR-21 plus Ad-PDCD4-Lack for 4 h were transfected with Ad-AP1-Luc for 5 h with 10 pfu/cell. Luciferase activity was measured after 24 h. The luciferase expression was measured on a scintillation counter by using a dual luciferase reporter system.

Statistics—All data are presented as means ± S.E. For relative gene expression, the mean value of the vehicle control group is defined as 100% or 1. Two-tailed unpaired Student's t tests and analysis of variance were used for statistical evaluation of the data. The SigmaStat statistical analysis program was used for data analysis. A p value < 0.05 was considered significant.

RESULTS

The Effect of H2O2 on miRNA Expression in Cultured VSMCs— Overall, 143 miRNAs out of the 238 arrayed were found in VSMCs. After treatment with H2O2 (200 μm) for 6 h, microarray analysis demonstrated that 72 of the 143 miRNAs were differentially expressed with p value <0.05; 38 miRNAs were up-regulated, and 34 miRNAs were down-regulated. Fifty-seven miRNAs that are highly expressed and dysregulated in H2O2-treated VSMCs are listed in Table 1. Remarkably, miR-21, an miRNA that we found has an anti-apoptotic effect on VSMCs induced by serum deprivation (29), was increased compared with the vehicle-treated control. The effect of H2O2 on miR-21 expression was further confirmed by qRT-PCR. As shown in Fig. 1, H2O2 (10–200 μm) increased expression of miR-21 in a dose-dependent manner.

TABLE 1.

Aberrant expression of miRNAs in VSMCs treated with H2O2

Down-regulated miRNAs Up-regulated miRNAs
miR-290 miR-107 rno-miR-351 rno-miR-20a
miR-193 miR-103 rno-miR-30d rno-let-7e
miR-181c miR-328 rno-let-7b rno-miR-26b
miR-29b miR-34a rno-miR-30b rno-miR-10b
miR-30e miR-181b rno-let-7f rno-miR-15b
miR-145 miR-19b rno-miR-18 rno-miR-92
miR-181a miR-324-5p rno-let-7i rno-miR-352
miR-199a miR-101b rno-miR-342 rno-miR-21
miR-22 miR-214 rno-let-7d rno-miR-20b
miR-130a miR-23b rno-miR-361 rno-miR-10a
miR-30a-5p miR-23a rno-miR-424 rno-miR-98
miR-99b miR-143 rno-miR-132 rno-miR-7
miR-101a miR-151 rno-miR-30c rno-miR-195
miR-301 miR-31 rno-miR-25 rno-miR-365
miR-99a

FIGURE 1.

FIGURE 1.

The effect of H2O2 on miR-21 expression in cultured rat VSMCs. Cultured rat VSMCs were treated with vehicle or H2O2 (10–200 μm) for 6 h. miR-21 levels were determined by qRT-PCR. Note: n = 6; *, p < 0.05 compared with vehicle control (0 μm).

The Effects of H2O2 on VSMC Apoptosis and Death—Although low concentrations of H2O2 had no effect on apoptosis and death, high concentrations (10–200 μm) increased VSMC cell death in a dose-dependent manner after 24-h treatment under our experimental condition (Fig. 2). Using the combination of trypan exclusion and TUNEL staining, we have confirmed that most of cell death in H2O2-treated VSMCs at 50 μm for 24 h was induced by apoptosis.

FIGURE 2.

FIGURE 2.

Death of rat VSMCs induced by H2O2. Cultured rat VSMCs were treated with vehicle or H2O2 (10–200 μm) for 24 h. Cell was measured by trypan exclusion. Note: n = 6; *, p < 0.05 compared with vehicle control (0 μm).

Modulating miR-21 Expression in Cultured VSMCs—To modulate miR-21 expression in cultured VSMCs, both gain-of-function and loss-of-function approaches were applied. As shown in Fig. 3, LNA-anti-miR-21 deceased, but pre-miR-21 increased miR-21 expression in VSMCs. The effects of both LNA-anti-miR-21 and pre-miR-21 on miR-21 expression were miR-21-specific, because no effects were found on other miRNAs such as miR-24 and miR-146 (data not shown).

FIGURE 3.

FIGURE 3.

Modulating miR-21 expression in cultured VSMCs. Cultured VSMCs were treated with vehicle, miR-21 inhibitor (LNA-anti-miR-21, 30 nm) or pre-miR-21 (30 nm) for 4 h. miR-21 levels were determined 24 h later by qRT-PCR. Note: n = 6; *, p < 0.05 compared with vehicle control.

The Effect of miR-21 on H2O2-induced VSMC Death and Apoptosis—Pre-miR-21 decreased H2O2-induced VSMC death as determined by trypan exclusion (Fig. 4A) and apoptosis as determined by terminal TUNEL staining (Fig. 4B). In contrast, VSMC apoptosis and death were increased after treatment with LNA-anti-miR-21 (Fig. 4, A and B). Representative TUNEL-stained photomicrographs from VSMCs treated with vehicle, control oligonucleotide, Pre-miR-21, and LNA-anti-miR-21 are shown in Fig. 4 (C–F). The results indicate that miR-21 has a protective effect on H2O2-induced VSMC injury responses (apoptosis and death).

FIGURE 4.

FIGURE 4.

The effect of miR-21 on H2O2-induced VSMC apoptosis and death. Cultured rat VSMCs pre-treated with vehicle, miR-21 inhibitor (LNA-anti-miR-21, 30 nm) or pre-miR-21 (30 nm) were treated with H2O2 (50 μm) for 24 h. Then, cell death was determined by trypan exclusion (A) and cell apoptosis was determined by TUNEL staining (B). Representative TUNEL-stained photomicrographs from VSMCs treated with vehicle (C), control oligonucleotide (D), Pre-miR-21 (E), and LNA-anti-miR-21 (F). Note: n = 6; *, p < 0.05 compared with vehicle control treated with H2O2 (50 μm).

PDCD4 Is a miR-21 Target Gene in VSMCs—Computational analysis indicates that PDCD4 is a potential target gene of miR-21 (Fig. 5A). If it is a miR-21 target, H2O2 should decrease its expression in VSMCs, because miR-21 expression was up-regulated after H2O2 stimulation (Fig. 1). To confirm this, we incubated VSMCs with either vehicle or H2O2 (50 μm) for 24 h, and protein level of PDCD4 was determined by Western blot. As shown in Fig. 5B, H2O2 decreased PDCD4 expression in a dose-dependent manner. The results suggest that PDCD4 is a potential miR-21 target gene in VSMCs stimulated with H2O2.

FIGURE 5.

FIGURE 5.

PDCD4 is a target gene of mi-21. A, computational analysis indicates that PDCD4 has a miR-21 binding site at nucleotides 228–249 of the PDCD4-3′-UTR, and is highly conserved in six species. B, H2O2 decreased PDCD4 expression in a dose-dependent manner. Rat VSMCs were treated with 0 μm, 10 μm, 50 μm, or 100 μm of H2O2 for 24 h, and the cell proteins were isolated for Western blot analysis of PDCD4. The left panel is the representative Western blot from five experiments, and the right panel is the quantification of PDCD4 protein. Note: n = 5; *, p < 0.05 compared with 0 μm control. C, miR-21 inhibitor. LNA-anti-miR-21 increased, whereas pre-miR-21 decreased, PDCD4 expression in cultured VSMCs. Rat VSMCs were treated with vehicle (Vehicle Control), control oligonucleotide (Oligo Control, 30 nm), miR-21 inhibitor (LNA-anti-miR-21, 30 nm), or pre-miR-21 (30 nm) for 4 h. 48 h later, proteins were isolated for Western blot analysis of PDCD4. The left panel is the representative Western blot from five experiments, and the right panel is the quantification of PDCD4 protein. Note: n = 5; *, p < 0.05 compared with vehicle control. D, in addition to the treatments in C, all the cells were treated with H2O2 (50 μm) for 24 h. 48 h after H2O2 treatment, proteins were isolated for Western blot analysis of PDCD4. The left panel is the representative Western blot from five experiments, and the right panel is the quantification of PDCD4 protein. Note: n = 5; *, p < 0.05 compared with vehicle control.

To verify that PDCD4 is a gene target of miR-21, both gain-of-function and loss-of-function approaches were applied. As shown in Fig. 5C, LNA-anti-miR-21 increased, whereas pre-miR-21 decreased PDCD4 expression in cultured VSMCs. The similar regulatory effect of miR-21 modulation on PDCD4 expression was also found in H2O2-stimulated VSMCs (Fig. 5D). The results suggest that PDCD4 is a target gene of miR-21. To further confirm that miR-21 is able to directly bind to PDCD4 and inhibit PDCD4 expression, a construct in which a fragment of the 3′-UTR of PDCD4 mRNA with the putative miR-21 binding sequence was cloned into a firefly luciferase reporter construct and transfected into HEK 293 cells with either vehicle (vehicle control), an empty plasmid (pDNR-CMV), a plasmid expressing miR-21 (pmiR-21), or a control plasmid expressing an unrelated miRNA, miR-145 (pmiR-145), following the transfection procedure provided by Invitrogen. As expected, we found that pmiR-21, but not pmiR-145 and pDNR-CMV, increased miR-21 expression in HEK 293 cells (Fig. 6A). Accordingly, pmiR-21, but not pDNR-CMV or pmiR-145, inhibited luciferase activity (Fig. 6B). In the mutated control group, the inhibitory effect of pmiR-21 and pmiR-222 disappeared (Fig. 6B). The dose-dependent effect of pmiR-21 on luciferase activity is shown in Fig. 6C. The maximal inhibitory effect was ∼50% inhibition that occurred between 30 and 60 nm pmiR-21. The results imply that miR-21 can bind to PDCD4 directly and inhibit its expression.

FIGURE 6.

FIGURE 6.

miR-21 is able to bind to PDCD4 and inhibit PDCD4 expression in HEK 293 cells. A construct (1 μg/well) in which a fragment of the 3′-UTR of PDCD4 mRNA with the putative miR-221 and miR-222 binding sequence was cloned into a firefly luciferase reporter construct and transfected into HEK 293 cells with either vehicle (Vehicle), an empty plasmid (pDNR-CMV, 30 nm), a plasmid expressing miR-21 (pmiR-21, 30 nm), or a control plasmid expressing an unrelated miRNA, miR-145 (pmiR-145, 30 nm). The construct (1 μg/well) with mutated fragment of the 3′-UTR of PDCD4 mRNA without the putative miR-21 binding sequence was used as the mutated control. A, pmiR-21, but not pmiR-145 or pDNR-CMV, increased miR-21 expression in HEK 293 cells. B, pmiR-21, but not pDNR-CMV or pmiR-145 inhibited luciferase activity. In the mutated control group, the inhibitory effect of pmiR-21 and pmiR-222 disappeared. C, dose-dependent effect of pmiR-21 on luciferase activity. The cells were treated with 0, 10, 30, 60, or 100 nm of pmiR-21. Note: n = 5; *, p < 0.05 compared with vehicle control.

PDCD4 Is a Functional Target Gene That Is Involved in miR-21-mediated Protective Effect on H2O2-induced VSMC Apoptosis and Death—The role of PDCD4 in H2O2-induced VSMC apoptosis and death is currently unknown. To determine the functional involvement of PDCD4 in miR-21-mediated cellular effect, we first determined the role of PDCD4 in H2O2-induced VSMC apoptosis and death. As shown in Fig. 7, overexpression of PDCD4 via ad-PDCD4 increased H2O2-induced VSMC apoptosis and death as determined by trypan exclusion (Fig. 7A) and terminal TUNEL staining (Fig. 7B). The relative expression of PDCD4 in these different treatment groups is shown in Fig. 7C. Representative TUNEL-stained photomicrographs from VSMCs treated with vehicle, Ad-GFP, and Ad-PDCD4 are shown in Fig. 7 (D–F). Interestingly, pre-miR-21-mediated protective effect on VSMC apoptosis and death was totally inhibited in H2O2-treated cells via adenovirus-mediated overexpression of PDCD4 without miR-21 binding site (Ad-PDCD4-Lack) (Fig. 7G). In contrast, pre-miR-21 still had a protective effect on H2O2-induced VSMC apoptosis in Ad-PDCD4-treated cells, although the protective effect was lower than that in VSMCs without Ad-PDCD4 (Fig. 7G).

FIGURE 7.

FIGURE 7.

PDCD4 is a functional target gene that is involved in miR-21-mediated protective effect on H2O2-induced VSMC apoptosis and death. Rat VSMCs were treated with vehicle, control adenovirus, Ad-GFP (30 m.o.i.) or adenovirus expressing PDCD4 without miR-21 binding site (Ad-PDCD4-Lack, 30 m.o.i.) for 4 h. Cell death, cell apoptosis, and PDCD4 protein levels were determined 24 h after treatment with 50 μm of H2O2. A, overexpression of PDCD4 via Ad-PDCD4-Lack increased H2O2-induced VSMC death as determined by trypan exclusion. Note: n = 6; *, p < 0.05 compared with vehicle control. B, overexpression of PDCD4 via Ad-PDCD4-Lack increased H2O2-induced VSMC apoptosis as determined by TUNEL staining. Note; n = 6; *, p < 0.05 compared with vehicle control. C, Ad-PDCD4-Lack increased PDCD4 expression in VSMCs as determined by Western blot analysis. Note: n = 5; *, p < 0.05 compared with vehicle control. Representative TUNEL-stained photomicrographs from VSMCs treated with vehicle (D), Ad-GFP (E), and Ad-PDCD4 (F). G, cultured rat VSMCs pre-treated with vehicle (Vehicle Control), control oligonucleotide (Oligo Control, 30 nm), or pre-miR-21 (30 nm) for 4 h were treated with Ad-GFP (30 m.o.i.), Ad-PDCD4-Lack (30 m.o.i.), or adenovirus expressing PDCD4 with miR-21 binding site (Ad-PDCD4, 30 m.o.i.). Then, the cells were treated with 50 μm of H2O2 for 24 h and cell apoptosis was determined. Pre-miR-21 had a protective effect on H2O2-induced VSMC apoptosis. However, the Pre-miR-21-mediated protective effect on VSMC apoptosis was totally inhibited in H2O2-treated cells via Ad-PDCD4-Lack. In contrast, pre-miR-21 still had a protective effect on H2O2-induced VSMC apoptosis in Ad-PDCD4-treated cells, although the protective effect was lower than that in VSMCs without Ad-PDCD4. Note: n = 8; *, p < 0.05 compared with vehicle control; #, p < 0.05 compared with Ad-PDCD4.

AP-1 Is a Downstream Signaling Molecule of PDCD4 That Might Be Involved in miR-21-mediated Protective Effect on VSMCs—As shown in Fig. 8A, overexpression of PDCD4 by Ad-PDCD4 or Ad-PDCD4-Lack inhibited AP-1 activity. In addition, increasing of PDCD4 expression via LNA-anti-miR-21 (Fig. 5C) resulted in decrease in AP-1 activity (Fig. 8B). In contrast, decreasing of PDCD4 expression via pre-miR-21 (Fig. 5C) resulted in increase in AP-1 activity (Fig. 8C). Moreover, the pre-miR-21-induced increase in luciferase activity was totally blocked after transfection of adenovirus expression PDCD4 without miR-21 binding site (Ad-PDCD4-Lack) (Fig. 8C). In H2O2-stimulated VSMCs, AP-1 activity was increased (Fig. 8D). The regulatory effect of miR-21 on AP-1 activity was also verified in H2O2-stimulated VSMCs as demonstrated in Fig. 8D. The results suggest that AP-1 is a downstream signaling molecule of PDCD4 that might be involved in miR-21-mediated protective effect on VSMCs.

FIGURE 8.

FIGURE 8.

miR-21 regulates AP-1 activity via its target gene PDCD4. AP-1 was measured using luciferase assay. VSMCs pretreated with vehicle, control oligonucleotides (Oligo Control), LNA-anti-miR-21 (30 nm), pre-miR-21 (30 nm), ad-GFP (30 m.o.i.), Ad-PDCD4 (30 m.o.i.), Ad-PDCD4-Lack (30 m.o.i.), or pre-miR-21 plus Ad-PDCD4-Lack for 4 h were transfected with Ad-AP1-Luc for 5 h with 10 pfu/cell. Luciferase activity was measured after 24 h. A, luciferase activity was decreased by overexpression of PDCD4 via either Ad-PDCD4 or AD-PDCD4-Lack. B, luciferase activity was decreased by LNA-anti-miR-21. C, luciferase activity was increased by pre-miR-21 (30 nm); however, the pre-miR-21-induced increase in luciferase activity was totally blocked after transfection of adenovirus expression PDCD4 without miR-21 binding site (Ad-PDCD4-Lack). Note: n = 5; *, p < 0.05 compared with vehicle control. #, p < 0.05 compared with pre-miR-21 group. D, the cell groups and treatments were the same as in A–C except for the additional treatment with H2O2 (50 μm) or vehicle for 24 h before the luciferase activity was measured. Note: n = 5; *, p < 0.05 compared with vehicle control treated with H2O2. #, p < 0.05 compared with pre-miR-21 group.

DISCUSSION

It is well established that ROS such as H2O2 play important roles in controlling cellular functions such as cell differentiation, proliferation, migration, apoptosis, and death (3). These cell functional controls are achieved via ROS-mediated gene expression regulation (3–5). For example, microarray analysis reveals that a large number of genes are regulated in cells treated with H2O2, and these regulated genes are responsible for H2O2-mediated cellular effects (4, 5).

Several investigators have studied the molecular mechanisms of ROS-mediated gene regulation. It is found that epigenetic regulation at the DNA level and transcription factors at the transcriptional level are two important mechanisms involved in H2O2-mediated expression changes of multiple genes (3–5, 13, 14). However, the role of post-transcriptional regulation in H2O2-mediated gene regulation is still unclear. Recently, there has been an important breakthrough in gene regulation in which miRNAs have been identified in mammalian cells (17–20). The new layer of gene expression regulators is found to regulate at least 30% of genes in a cell at the translational level. However, the role of miRNAs in H2O2-mediated gene regulation and its functional effects on the VSMCs are currently unidentified.

In the current study, we identified that miRNA expression is very sensitive to H2O2 stimulation. Six hours after treatment with H2O2, multiple miRNAs are either down- or up-regulated. The multiple aberrantly expressed miRNAs match the complex process of gene regulation via ROS such as H2O2, in which multiple genes have been dysregulated (3–5). The result of the current study indicates that miRNAs may participate in H2O2-mediated modulation of gene expression.

To test the potential roles of miRNAs in H2O2-mediated cellular effects, we selected an up-regulated miRNA, miR-21. We found H2O2 (10–100 μm) increased miR-21 expression in a dose-dependent manner. Interestingly, up-regulation of miR-21 expression inhibited H2O2-mediated VSMC apoptosis and death. In contrast, H2O2-mediated VSMC apoptosis and death were exacerbated after down-regulation of miR-21 expression. The results suggest that miR-21 had an anti-apoptotic effect in H2O2-mediated VSMC apoptosis and death. It should be noted that the effects of miR-21 modulations on VSMC apoptosis and death are modest in magnitude. We think that, although miR-21 is a novel regulator for apoptosis and death in H2O2-stimulated VSMCs, it is only one of multiple regulators for these cellular events.

miRNAs modulate their biological functions via their multiple target gene mRNAs. Although their potential gene targets can be predicted by computational analysis, these targets must be experimentally verified in experimental cells as the miRNA targets and functions are cell-specific (35). In the current study, computational analysis suggests that PDCD4 is a miR-21 target. Moreover, PDCD4 regulation by miR-21 has been recently reported in cancer cells (36–38).

To test whether PDCD4 is an miR-21 target gene in VSMCs, we have first confirmed that H2O2 decreased PDCD4 expression in a dose-dependent manner. It is established that PDCD4 is a pro-apoptotic protein. The negative relationship between H2O2 and PDCD4 in H2O2-treated VSMCs indicates that the decreased expression of PDCD4 via H2O2 may be a defensive response of the VSMCs. In addition, PDCD4 expression in VSMCs was able to be regulated by miR-21 in both H2O2-stimulated and unstimulated cells as determined by both gain-of-function and loss-of-function approaches. However, the effects of miR-21 modulations on PDCD4 expression are modest in magnitude. In particular, even when we used miR-21 at a higher level than that in H2O2-stimulated cells, the magnitude of PDCD4 modulation was still smaller than that in H2O2-stimulated cells. We think that the modest effects on PDCD4 expression in VSMCs might be explained by the following two reasons: First, the modest effect on its multiple target gene expression in vitro is a characteristic of an individual miRNA in cardiovascular cells, based on our recent studies on miR-21, miR-145, miR-221, and miR-222. The observation has also been confirmed by a recent miRNA study using the proteomic approach. These investigators have found that a single miRNA can repress the production of hundreds of its target proteins but that this repression is typically relatively mild (39). Another potential reason is that PDCD4 expression in H2O2-stimulated cells is not only controlled by miR-21 but other unidentified regulators might also be involved.

We have confirmed that miR-21 is able to bind to PDCD4 and regulate its expression directly using a construct in which a fragment of the 3′-UTR of PDCD4 mRNA has the putative miR-21 binding sequence. Furthermore, we have found that the miR-21 overexpression-mediated protective effect on VSMC apoptosis and death is blocked after overexpression of PDCD4 without miR-21 binding sites. The results indicate that PDCD4 is a functional target gene of miR-21, which is involved in the miR-21-mediated protective effect on VSMC injury elicited by H2O2.

It is well established that AP-1 is a key signaling molecule that determines life or death cell fates in response to extracellular stimuli, including ROS, although its final outcome on cell apoptosis is cell-specific (40, 41). Several recent studies suggest that AP-1 is a downstream signaling molecule of PDCD4 in other types of cells (42, 43). We thus hypothesize that AP-1 might be a downstream signaling molecule of PDCD4 that is involved in miR-21-mediated effects on VSMCs. The hypothesis is supported by the following findings in both H2O2-stimulated and unstimulated VSMCs. First, we found that increasing PDCD4 by Ad-PDCD4 or Ad-PDCD4-Lack inhibits AP-1 activity. Second, miR-21 inhibitor increases PDCD4 expression and results in a decrease in AP-1 activity. In contrast, pre-miR-21 decreases PDCD4 expression and results in an increase in AP-1 activity. Third, a pre-miR-21-mediated increase in AP-1 activity is able to be blocked by adenovirus-expressing PDCD4 without miR-21 binding sites.

In the current study, we have found that there is significant necrosis involved in the H2O2 response, and miR-21 also has a protective effect on VSMC necrosis. However, the mechanisms responsible for it are unclear and need to be investigated in future study. Several recent reports have suggested that the phosphatase and tensin homolog is a target gene for miR-21. Phosphatase and tensin homolog is an important molecule for cell survival and might play a role in the miR-21-mediated protective effect on cell necrosis.

In summary, the current study reveals that the new layer of gene regulators, miRNAs, in VSMCs are sensitive to H2O2 stimulation. miR-21 participates in H2O2-mediated gene regulation and injury response via its target gene PDCD4 and AP-1 pathway. These novel findings may have extensive implications for the diagnosis and therapy of a variety of cardiovascular diseases related to ROS such as atherosclerosis, hypertension, restenosis after angioplasty or bypass, diabetic vascular complications, and transplantation arteriopathy.

Acknowledgments

We thank Dr. Sheldon Goldstein in our department for editing assistance.

*

This work was supported, in whole or in part, by National Institutes of Health Grant HL080133. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

3

The abbreviations used are: ROS, reactive oxygen species; miRNA, microRNA; VSMC, vascular smooth muscle cell; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling; PDCD4, programmed cell death 4; LNA, locked nucleic acid; FAM, 6-carboxyfluorescein; m.o.i., multiplicity of infection; UTR, untranslated region; Ad, adenovirus; GFP, green fluorescent protein; qRT, quantitative reverse transcription; CMV, cytomegalovirus; AP-1, Activator protein 1.

References

  • 1.Napoli, C., de Nigris, F., and Palinski, W. (2001) J. Cell. Biochem. 82 674-682 [DOI] [PubMed] [Google Scholar]
  • 2.Madamanchi, N. R., Vendrov, A., and Runge, M. S. (2005) Arterioscler. Thromb. Vasc. Biol. 25 29-38 [DOI] [PubMed] [Google Scholar]
  • 3.Irani, K. (2000) Circ. Res. 87 179-183 [DOI] [PubMed] [Google Scholar]
  • 4.Weigel, A. L., Handa, J. T., and Hjelmeland, L. M. (2002) Free Radic. Biol. Med. 33 1419-1432 [DOI] [PubMed] [Google Scholar]
  • 5.Vandenbroucke, K., Robbens, S., Vandepoele, K., Inzé, D., Van de Peer, Y., and Van Breusegem, F. (2008) Mol. Biol. Evol. 25 507-516 [DOI] [PubMed] [Google Scholar]
  • 6.Bonomini, F., Tengattini, S., Fabiano, A., Bianchi, R., and Rezzani, R. (2008) Histol. Histopathol. 23 381-390 [DOI] [PubMed] [Google Scholar]
  • 7.Delles, C., Miller, W. H., and Dominiczak, A. F. (2008) Antioxid. Redox Signal. 10 1061-1077 [DOI] [PubMed] [Google Scholar]
  • 8.Tardif, J. C., Grégoire, J., and L'Allier, P. L. (2002) Am. J. Cardiovasc. Drugs 2 323-334 [DOI] [PubMed] [Google Scholar]
  • 9.Movahed, A., Nair, K. G., Ashavaid, T. F., and Kumar, P. (1996) Can. J. Cardiol. 12 138-144 [PubMed] [Google Scholar]
  • 10.Son, S. M., Whalin, M. K., Harrison, D. G., Taylor, W. R., and Griendling, K. K. (2004) Curr. Diab. Rep. 4 247-252 [DOI] [PubMed] [Google Scholar]
  • 11.Shi, Y., Patel, S., Davenpeck, K. L., Niculescu, R., Rodriguez, E., Magno, M. G., Ormont, M. L., Mannion, J. D., and Zalewski, A. (2001) Circulation 103 2408-2413 [DOI] [PubMed] [Google Scholar]
  • 12.McCormick, M. L., Gavrila, D., and Weintraub, N. L. (2007) Arterioscler. Thromb. Vasc. Biol. 27 461-469 [DOI] [PubMed] [Google Scholar]
  • 13.Cerda, S., and Weitzman, S. A. (1997) Mutat. Res. 386 141-152 [DOI] [PubMed] [Google Scholar]
  • 14.Lyle, A. N., and Griendling, K. K. (2006) Physiol. (Bethesda) 21 269-280 [DOI] [PubMed] [Google Scholar]
  • 15.Halbeisen, R. E., Galgano, A., Scherrer, T., and Gerber, A. P. (2008) Cell. Mol. Life Sci. 65 798-813 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yoo, P. S., Mulkeen, A. L., and Cha, C. H. (2006) World J. Gastroenterol. 12 4937-4942 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ambros, V. (2003) Cell 113 673-676 [DOI] [PubMed] [Google Scholar]
  • 18.Farh, K. K., Grimson, A., Jan, C., Lewis, B. P., Johnston, W. K., Lim, L. P., Burge, C. B., and Bartel, D. P. (2005) Science 310 1817-1821 [DOI] [PubMed] [Google Scholar]
  • 19.Pasquinelli, A. E., Hunter, S., and Bracht, J. (2005) Curr. Opin. Genet. Dev. 15 200-205 [DOI] [PubMed] [Google Scholar]
  • 20.Bartel, D. P. (2004) Cell 116 281-297 [DOI] [PubMed] [Google Scholar]
  • 21.Zaug, A. J., and Cech, T. R. (1986) Science 231 470-475 [DOI] [PubMed] [Google Scholar]
  • 22.Kong, Y., and Han, J. H. (2005) Genomics Proteomics Bioinformatics 3 62-72 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bentwich, I., Avniel, A., Karov, Y., Aharonov, R., Gilad, S., Barad, O., Barzilai, A., Einat, P., Einav, U., Meiri, E., Sharon, E., Spector, Y., and Bentwich, Z. (2005) Nat. Genet. 37 766-770 [DOI] [PubMed] [Google Scholar]
  • 24.Zhang, C. (2008) Clin. Sci. (Lond.) 114 699-706 [DOI] [PubMed] [Google Scholar]
  • 25.Berezikov, E., Guryev, V., van de Belt, J., Wienholds, E., Plasterk, R. H., and Cuppen, E. (2005) Cell 120 21-24 [DOI] [PubMed] [Google Scholar]
  • 26.Lewis, B. P., Burge, C. B., and Bartel, D. P. (2005) Cell 120 15-20 [DOI] [PubMed] [Google Scholar]
  • 27.Zhang, C., Baker, D. L., Yasuda, S., Makarova, N., Balazs, L., Johnson, L. R., Marathe, G. K., McIntyre, T. M., Xu, Y., Prestwich, G. D., Byun, H. S., Bittman, R., and Tigyi, G. (2004) J. Exp. Med. 199 763-774 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cheng, Y., Ji, R., Yue, J., Yang, J., Liu, X., Chen, H., Dean, D. B., and Zhang, C. (2007) Am. J. Pathol. 170 1831-1840 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ji, R., Cheng, Y., Yue, J., Yang, J., Liu, X., Chen, H., Dean, D. B., and Zhang, C. (2007) Circ. Res. 100 1579-1588 [DOI] [PubMed] [Google Scholar]
  • 30.Bolstad, B. M., Irizarry, R. A., Astrand, M., and Speed, T. P. (2003) Bioinformatics (Oxf.) 19 185-193 [DOI] [PubMed] [Google Scholar]
  • 31.Gao, X., Gulari, E., and Zhou, X. (2004) Biopolymers 73 579-596 [DOI] [PubMed] [Google Scholar]
  • 32.Mangat, R., Singal, T., Dhalla, N. S., and Tappia, P. S. (2006) Am. J. Physiol. 291 H854-H860 [DOI] [PubMed] [Google Scholar]
  • 33.Liu, Z., Zhang, C., Dronadula, N., Li, Q., and Rao, G. N. (2005) J. Biol. Chem. 280 14700-14708 [DOI] [PubMed] [Google Scholar]
  • 34.Cho, M. A., Lee, M. K., Nam, K. H., Chung, W. Y., Park, C. S., Lee, J. H., Noh, T., Yang, W. I., Rhee, Y., Lim, S. K., Lee, H. C., and Lee, E. J. (2007) J. Endocrinol. 195 255-263 [DOI] [PubMed] [Google Scholar]
  • 35.Zhang, C. (2008) Physiol. Genomics 33 139-147 [DOI] [PubMed] [Google Scholar]
  • 36.Asangani, I. A., Rasheed, S. A., Nikolova, D. A., Leupold, J. H., Colburn, N. H., Post, S., and Allgayer, H. (2008) Oncogene. 27 2128-2136 [DOI] [PubMed] [Google Scholar]
  • 37.Frankel, L. B., Christoffersen, N. R., Jacobsen, A., Lindow, M., Krogh, A., and Lund, A. H. (2008) J. Biol. Chem. 283 1026-1033 [DOI] [PubMed] [Google Scholar]
  • 38.Lu, Z., Liu, M., Stribinskis, V., Klinge, C. M., Ramos, K. S., Colburn, N. H., and Li, Y. (2008) Oncogene 27 4373-4379 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Selbach, M., Schwanhäusser, B., Thierfelder, N., Fang, Z., Khanin, R., and Rajewsky, N. (2008) Nature 455 58-63 [DOI] [PubMed] [Google Scholar]
  • 40.Shaulian, E., and Karin, M. (2001) Oncogene. 20 2390-2400 [DOI] [PubMed] [Google Scholar]
  • 41.Karin, M., and Shaulian, E. (2001) IUBMB Life 52 17-24 [DOI] [PubMed] [Google Scholar]
  • 42.Hwang, S. K., Jin, H., Kwon, J. T., Chang, S. H., Kim, T. H., Cho, C. S., Lee, K. H., Young, M. R., Colburn, N. H., Beck, G. R., Jr., Yang, H. S, and Cho, M. H. (2007) Gene Ther. 14 1353-1361 [DOI] [PubMed] [Google Scholar]
  • 43.Yang, H. S., Knies, J. L., Stark, C., and Colburn, N. H. (2003) Oncogene 22 3712-3720 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES