Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2008 Nov 26;150(4):1597–1606. doi: 10.1210/en.2008-1079

Role of c-Myb during Prolactin-Induced Signal Transducer and Activator of Transcription 5a Signaling in Breast Cancer Cells

Feng Fang 1, Michael A Rycyzyn 1, Charles V Clevenger 1
PMCID: PMC2659289  PMID: 19036881

Abstract

Implicated in the pathogenesis of breast cancer, prolactin (PRL) mediates its function in part through the prolactin receptor (PRLr)-associated Janus kinase 2 (Jak2)/signal transducer and activator of transcription 5 (Stat5) signaling complex. To delineate the mechanisms of Stat5a regulation in breast cancer, transcription factor-transcription factor (TF-TF) array analysis was employed to identify associated transcriptional regulators. These analyses revealed a PRL-inducible association of Stat5a with the transcription factor and protooncogene c-Myb. Confirmatory co-immunoprecipitation studies using lysates from both T47D and MCF7 breast cancer cells revealed a PRL-inducible association between these transcription factors. Ectopic expression of c-Myb enhanced the PRL-induced expression from both composite and synthetic Stat5a-responsive luciferase reporters. Chromatin immunoprecipitation assays also revealed a PRL-inducible association between c-Myb and endogenous Stat5a-responsive CISH promoter, which was associated with an enhanced expression of CISH gene product at the RNA and protein levels. Small interfering RNA-mediated c-Myb knockdown impaired the PRL-induced mRNA expression of five Stat5-responsive genes. DNA binding-defective mutants of c-Myb, incapable of activating expression from a c-Myb-responsive reporter, maintained their ability to enhance a Stat5a-responsive reporter. At a cellular level, ectopic expression of c-Myb resulted in an increase in T47D proliferation. Taken together, these results indicate that c-Myb potentiates Stat5a-driven gene expression, possibly functioning as a Stat5a coactivator, in human breast cancer.

c-Myb inducibly associates with Stat5 and Stat5-responsive promoters, while alteration of c-Myb levels results in altered Stat5-responsive gene expression and breast cancer proliferation.

Binding of prolactin (PRL), a 23-kDa peptide to its receptor (PRLr) triggers signaling networks that stimulate the proliferation/survival (1,2), motility (3), and terminal maturation of mammary epithelial cells and tissues (4). PRL binding to the predimerized PRLr results in the rapid phosphorylation of the PRLr signaling domains and the activation of PRLr-associated signaling cascades such as Janus kinase 2 (Jak2)/signal transducer and activator of transcription 5 (Stat5) (5,6,7), which results in the transactivation of PRL-responsive gene loci involved in proliferation (Bcl2, C/EBPβ, c-Myc, and cyclin D1) and the differentiated mammary phenotype (i.e. β-casein) (8,9,10,11). Given the contribution of PRL to breast cancer pathogenesis and the observation that PRL antagonists have been shown to inhibit the in vitro growth of breast cancer, PRL-triggered signaling pathways are relevant targets for potential pharmaceutical intervention (12).

STATs are a family of transcriptional factors that regulate cell growth and differentiation. Originally identified as transcriptional factors mediating interferon transduction (13), members of the Stat family are now recognized to contribute integrally to mammary gland differentiation and breast cancer pathogenesis (14). Stat5 has been demonstrated to be a coordinate regulator of breast cancer cell invasion and migration (15) and stimulates the transcriptional activity of the cyclin D1 locus (9). Stat5 is phosphorylated on a C-terminal tyrosine residue by receptor-associated Jak kinase (16), resulting in its dimerization/multimerization and nuclear retrotranslocation. Within the nucleus, Stat5 engages its cognate DNA-binding sequence, resulting in promoter transactivation (13,17). In addition to the effects of tyrosine and serine phosphorylation, Stat5 activity is regulated by its interactions with other proteins including 1) suppressors of cytokine signaling/cytokine-inducible SH2-containing protein (CISH), 2) phosphatases such as Src homology protein 2, 3) family members of the peptide inhibitors of activated Stats (PIAS) (18), and 4) other transcription factors/coactivators such as CCAAT/enhancer-binding protein-β (C/EBPβ) (19), Nmi (20), GH receptor (21), and the glucocorticoid receptor (22). Suppressors of cytokine signaling/CISH proteins regulate Stat5 activity by blocking Jak2-mediated phosphorylation of Stat5 and/or Stat5 association with receptor (23,24). Alternatively, the PIAS family of proteins has been found to bind Stat5 family members and block their binding to DNA and/or transcriptional activity (25,26,27). The activity of Stat5 has been shown to be up-regulated by its interaction with transcription factors/coactivators including C/EBPβ (19). Although the association of some of these proteins with Stat5 is thought to be rate limiting for transactivation, the precise function of these proteins with respect to Stat5 activity in the context of breast cancer and the engagement of the transcriptional apparatus proper remains unclear (18).

c-Myb is a 75-kDa transcriptional factor that is classically associated with hematopoietic differentiation and survival (28,29). It consists of three broad domains: an N-terminal DNA-binding domain containing the critical Myb repeat motifs, a central transactivating domain, and a C-terminal negative regulatory domain, thought to block c-Myb function by intramolecular interaction with the N terminus (29). The functional effects of c-Myb are modulated by alternative RNA splicing (30), cyclin D1, cyclin-dependent kinase, p27 Kip1 (31), and C/EBPβ (32). Many of the signaling networks activated during PRLr transduction are also associated with c-Myb activation. Specifically, both serine phosphorylation (33), as mediated by PRL-activated MAPK (34), Pim1 (35), and the activity of cyclophilin family members (36) serve to regulate the activity of c-Myb. Furthermore, c-Myb function is also regulated by its association with other transcription factors/cell cycle proteins, including cAMP response element-binding protein-binding protein (CBP), C/EBPβ, c-Myc, and cyclin D1 (11,37,38,39,40,41). Accumulating literature has resulted in the appreciation of a function for c-Myb in human breast cancer. The c-Myb amplification has been reported to occur in primary breast cancers with BRCA1 mutation (42). Another recent study has found that c-Myb expression is increased in preneoplastic mammary lesions (hyperplastic enlarged lobular units) (43). Evaluation of human tissues with anti-c-Myb immunohistochemistry revealed increased levels of c-Myb protein in in situ and invasive breast cancers compared with normal tissues (44). In an investigation of c-Myb expression in a panel of breast cancer cell lines, c-Myb was found to correlate with estrogen receptor (ER) status (45). These and other studies have found that c-Myb is transcriptionally and posttranscriptionally regulated by estrogen and may contribute to the biology of ER-positive breast cancer cells (45,46,47).

To further characterize the mechanisms of Stat5a regulation, a novel technology termed transcription factor-transcription factor (TF-TF) array analysis was used to identify previously unrecognized Stat5a coregulators. These analyses led us to investigate whether the protooncogene c-Myb binds to and regulates Stat5a. Our findings indicate that the PRL-induced interaction between c-Myb and Stat5a is associated with an up-regulation of Stat5a function in human breast cancer cells.

Materials and Methods

Cell lines, vectors, and reagents

The PRLr-positive and ER-positive human breast cancer cell lines T47D and MCF7 cells were obtained from American Type Culture Collection (Manassas, VA) and cultured as described before (48). The vectors used here included firefly luciferase reporter pGL4-CISH (48), pGL4-LHRE (cloning description below), pGL4.10, pGL2-promoter, renilla luciferase reporter pGL4.73 (Promega, Madison, WI), pGL410-SV40 (cloning description below), LHRE-Tk-luc (49), β-casein-344 (50), pΔ3-Luc c-Myb reporter (containing three copies of the mim1 c-Myb binding site upstream of a minimal promoter), pTracer-EF/V5-His A (Invitrogen, Carlsbad, CA), and pTracer-cMyb and its mutants (cloning description below). Human recombinant PRL was a gift from Dr. Anthony Kossiakoff, University of Chicago (Chicago, IL). The antibodies used in this study were anti-Stat5a (Zymed, San Francisco, CA; 71-2400), anti-c-Myb (Santa Cruz Biotechnology, Santa Cruz, CA; H-141, sc-7874), anti-RNA polymerase II (Upstate, Charlottesville, VA; 05-623B), anti-GAPDH (Zymed, 39-8600), anti-CISH (Santa Cruz; H-80, sc-15344), V5 (Invitrogen; 46-0705), anti Myc-tag (Cell Signaling Technology, Beverly, MA; 2276), anti-His (Santa Cruz; sc-803), antirabbit IgG (Sigma Chemical Co., St. Louis, MO; I5006), antimouse IgG (Upstate; 12-371B), and anti-HA (Zymed; 71-5500). Protein agarose A beads (Invitrogen; 15918014) and G beads (Invitrogen; 15920010) were used for co-immunoprecipitation (co-IP).

Vector construction

The SV40 minimal promoter (∼200 bp) from pGL2-promoter vector was digested with BglII and HindIII, and cloned into BglII- and HindIII-digested pGL4.10 vector. This vector was named as pGL410-SV40. The new pGL4.10 vector was used in these studies because its previous versions (pGL2 and pGL3) were found to have numerous transcription factor binding sites in the backbone of the vector that influenced expression from these vectors in a cell-dependent manner. The pGL4.10 vector was specifically engineered to be virtually free of transcription factor binding sites, and the empty reporter was not responsive to c-Myb overexpression (data not shown). pGL410-SV40 was digested with EcoRV and XhoI, and Klenow polymerase was used to generate blunt ends. LHRE-TK-Luc (49) was digested with SbfI and SphI, and T4 DNA polymerase was used to generate blunt ends. The 250 bp of LHRE DNA fragment was ligated upstream of the SV40 basic promoter in pGL410-SV40, and the new vector with the correct orientation was termed as pGL4-LHRE. The full-length cDNA of c-Myb was digested with KpnI and XbaI from pCDNA3.1-FL-c-Myb (51) and cloned into the KpnI- and XbaI-digested vector pTracer-EF/V5-His A (Invitrogen). The new vector was termed as pTracer-c-Myb. Based on the DNA-binding domain of the N terminus of c-Myb (∼50–200 bp) (51), two single-point mutations have been introduced into this domain that abolished DNA binding activity (N179A and N183A) (52). Point mutants of pTracer-c-Myb of N179A and N183A were constructed with the QuikChange kit (Stratagene, La Jolla, CA). The rat Stat5a was PCR amplified, digested with EcoRI and HindIII, and cloned onto EcoRI- and HindIII-digested pCMV-Tag 3B expression vector (Strategene). The new vector was termed as pCMV-wtStat5a. Therefore, pTracer-c-Myb is fused with His and V5 tag, and pCMV-wtStat5a fused with Myc tag.

TF-TF array

The TF-TF Interaction Array I (catalog no. MA5010) was obtained from Panomics (Fremont, CA). T47D cells were maintained in DMEM with 10% FBS and arrested for 24 h in phenol-free medium without FBS. Cells were then treated with or without 100 ng/ml PRL for 30 min, harvested, and lysed for IP with anti-Stat5a antibody. Anti-Stat5a immunoprecipitates were then mixed with a cocktail of biotinylated, double-stranded, cognate DNA-binding sequences for 104 differing transcription factors. After gel filtration to remove unbound probes, the retained probes were hybridized to a spotted array containing complementary sequences to each probe. Hybridized probes were then detected by avidin-immunoperoxidase-chromogen-based detection as described in the Panomics literature. The map of transcription factors on the array is listed on the Panomics web site.

Co-IP

Cells were grown in 150-cm2 dishes until 70% confluency followed by arrest for 24 h before PRL treatment (100 ng/ml). Cells were lysed in RIPA buffer and co-IP with antibodies (2 μg) overnight followed by 1 h incubation with protein agarose A+G beads. The bound proteins were recovered in 2× Laemmli buffer and run on a 10% SDS-PAGE gel for Western blot (53).

Luciferase assay

Dual luciferase assay was conducted according to Fang et al. (48). The firefly luciferase reporters (100 ng/well), renilla luciferase control vectors (1 ng/well), and other vectors with c-Myb constructs (400 ng/well) were transiently transfected into cells (T47D using Lipofectamine 2000 and MCF7 cells using Fugene HD) for luciferase assay (48).

RT-PCR and real-time PCR

Total RNA was isolated using TRIzol (Invitrogen). Two micrograms of RNA in 20 μl reaction volume were used for cDNA synthesis using Superscript III first-strand synthesis kit (Invitrogen), and cDNA was diluted to 2.5 ng/μl (corresponding to RNA concentration). Four microliters cDNA, 1 μl primers (2 μm each), and 5 μl 2× Power SYBR MasterMix was used for real-time PCR in 10 μl reaction volume performed in a 384-well plate. Real-time PCR was conducted on an ABI 7900HT thermocycler (Applied Biosystems, Foster City, CA). All real-time PCR were run in triplicate. For RT-PCR, data were normalized to 18S rRNA. Fold change for RT-PCR is represented as 2−ΔΔCt(2−(Cttarget−Ct18SrRNA)PRL−(Cttarget−Ct18SrRNA)control).

Chromatin IP (ChIP) assay

ChIP assay was conducted according to protocols of EZ ChIP kit from Upstate. Cells were arrested in phenol-free medium for 24 h before PRL treatment (200 ng/ml). Anti-c-Myb and anti-RNA polymerase antibodies (2 μg) were used for ChIP pulldown. The pulldown DNA and input DNA were used as template for real-time PCR analysis. The fold change was normalized to non-PRL treatment control using the ratio of antibody pulldown DNA to input DNA.

Small interfering RNA (siRNA) knockdown

After comparing the efficiency of c-Myb knockdown by siRNA (47,54,55,56), the Stealth siRNA (primer name MYBHSS106819, UAUAGUGUCUCUGAAUGGCUGCGGC) from Invitrogen (catalog no. 127985B05) was selected in this work due to the high knockdown efficiency published by Lahortiga et al. (55). The siRNA transfection was conducted using RNAiMAX according to the manufacturer's protocol (Invitrogen).

Cell proliferation assay

T47D cells were transiently transfected with pTracer-c-Myb in the growth medium overnight followed by 24 h arrest before PRL treatment (100 ng/ml) for 72 h. Each well was pulsed with 0.5 μCi [3H]thymidine (Amersham Pharmacia Biotech, Piscataway, NJ) for 4 h. Cells were harvested onto the membrane with Filtermate Harvester (PerkinElmer, Waltham, MA) before reading on a MicroBeta TriLux scintillation counter (PerkinElmer). All samples were assayed in six replicates and repeated three times.

Statistical analysis

All experiments described here for statistic analysis were performed at least twice. Statistical analysis was performed using one-way or two-way ANOVA on GraphPad Prism 4 (La Jolla, CA). The results are shown as the means with error bars depicting ± sem. P < 0.05 is considered as statistically significant.

Results

Interaction between c-Myb and Stat5a induced by PRL

To examine novel mechanisms of Stat5a coregulation, TF-TF array analysis was used to screen for coregulators previously unrecognized to interact with Stat5a. Anti-Stat5a immunoprecipitates were obtained from unstimulated and PRL-stimulated T47D breast cancer cells. This line was used because it has a high level of PRLr expression and demonstrates excellent responsiveness to PRL at the signal transduction and gene expression levels (57). Transcription factors were then identified by their ability to bind differentially to biotinylated oligonucleotides representing the cognate DNA binding sequences for 104 differing transcription factors. Binding of specific labeled oligonucleotides by the Stat5a-associated transcription factors enabled their separation from unbound oligonucleotides via gel filtration. Retained oligonucleotides were then identified by denaturing and application to a spotted array of cDNA binding site sequences. Analysis of the TF-TF array revealed a ligand-induced interaction of Stat5a with itself. Using this as a positive control that established a semiquantitative threshold for identifying other PRL-induced Stat5a interactors, other PRL-induced interactors found bound to the following cognate TF binding sites included c-Myb, NFATC2, Sp1, Ap-2, E2F1, GRE (official gene name is GR or NR3C1), PPAR, ERE (ER), USF-1, MEF-1, MEF-2, Stat5, and Stat6 (Fig. 1, A–C). Given precedent literature that has suggested a role for c-Myb in the pathogenesis of breast cancer, we hypothesized that c-Myb could regulate PRL-driven breast cancer biology and represents the focus of this manuscript. Other novel interactors identified by this screen will be published in a separate manuscript (in preparation).

Figure 1.

Figure 1

Open in a new tab

TF-TF array analysis detects a PRL-induced interaction between c-Myb and Stat5a. A and B, Unstimulated (A) and PRL-stimulated (B; 100 ng/ml) T47D lysates were immunoprecipitated with anti-Stat5a antibody. Proteins present within these immunocomplexes were subject to TF-TF array analysis. The map of transcription factors on the array is listed on the Panomics website (catalog item MA5010). C, Enlarged view of the PRL-induced c-Myb interaction as detected by TF-TF array analysis. D and E, Co-IP analysis with anti-Stat5 antibody using unstimulated and PRL-stimulated breast cancer cell lysates confirms the PRL-induced interaction between c-Myb and Stat5a in T47D cells (D) and MCF7 cells (E).

To confirm the interaction between Stat5a and c-Myb detected by TF-TF array analysis, T47D and MCF7 cells were stimulated as a function of time with PRL and subject to IP with an anti-Stat5a antibody followed by immunoblot (IB) analysis of these immunoprecipitates with an anti-c-Myb antibody (IP with Stat5a and IB with c-Myb). These analyses revealed that PRL induced a rapid interaction of Stat5a and c-Myb within 10 min of PRL treatment in both T47D and MCF7 cells (Fig. 1, D and E). The anti-Stat5a antibody used for IP was generated against the synthetic peptide derived from the specific C-terminal sequence of Stat5a (cannot recognize Stat5b). Reciprocal co-IP (IP with c-Myb and IB with Stat5a) was also repeated several times; however, a successful co-IP was not achieved (data not shown) and may represent steric hindrance to antibody recognition secondary to the interaction of these proteins. However, successful co-IP of c-Myb and Stat5a was achieved through overexpression of epitope-tagged forms of each (see Fig. 4B).

Figure 4.

Figure 4

Open in a new tab

Loss of the ability of c-Myb to bind DNA does not inhibit its potentiation of Stat5-driven gene expression. A, Diagram of c-Myb with three functional domains with arrows designating the c-Myb mutants used in these studies. B, Co-IP analysis with anti-His antibody (for c-Myb) and IB with anti-Myc antibody (for Stat5a) using unstimulated and PRL-stimulated breast cancer cell lysates for the interaction between c-Myb-N179A mutant and Stat5a in T47D cells. Cells were cotransfected with pCMV-Stat5a with pTracer-c-Myb or pTracer-c-Myb-N179A for co-IP. C, DNA-binding defective c-Myb mutants poorly activate the c-Myb-driven pΔ3-Luc luciferase reporter. T47D cells were cotransfected with pΔ3-Luc luciferase reporter, cultured for 24 h, before luciferase analysis. D, DNA-binding defective c-Myb mutants activate the Stat5-driven CISH reporter to levels comparable to those observed with wild-type (wt) c-Myb poorly activate the c-DNA. T47D cells were cotransfected with c-Myb expression vectors and pGL4-CISH reporter and arrested in defined medium for 24 h followed by 24 h PRL stimulation (10 ng/ml) before luminescence assay. For both C and D, Western blot with both V5 and GAPDH controls demonstrated the equivalent loadings (not shown).

Ectopic expression of c-Myb potentiates responsiveness of Stat5a-driven reporters

Given the PRL-induced interaction between Stat5a and c-Myb (Fig. 1) and the recently reported up-regulation of c-Myb in breast cancer (45,46,47), the effect of c-Myb ectopic expression on Stat5a-driven reporter expression was examined. Recently, our lab generated the highly PRL-responsive pGL4-CISH reporter, which contains the proximal 1-kb promoter region upstream of the CISH gene with four Stat5a DNA-binding sequences (48). The CISH gene product has been reported to be overexpressed in leukemia (58) and breast cancer, an event that could contribute to the pathogenesis of these malignancies (59). Thus, the pGL4-CISH reporter was cotransfected with the c-Myb expression construct into T47D cells. As seen in Fig. 2A, c-Myb ectopic expression induced a significant increase in both basal and PRL-induced expression of this reporter in T47D cells. A similar effect was observed in MCF7 cells (Fig. 2B).

Figure 2.

Figure 2

Open in a new tab

Ectopic expression of c-Myb enhances the PRL-stimulated expression from Stat5-responsive reporters, mRNA, and proteins. A–D, The effect of PRL and c-Myb on pGL4-CISH reporter in T47D cells (A) and MCF7 cells (B) and β-casein-344 reporter (C) and pGL4-LHRE reporter (D) in T47D transfectants. T47D cotransfectants expressing reporters were arrested in defined medium for 24 h followed by 24 h PRL stimulation (100 ng/ml except 10 ng/ml for A) before luminescence assay. The lower panels are Western blots demonstrating the c-Myb ectopic expression level obtained with the various transfectants. E, PRL-stimulated (100 ng/ml) T47D cells were analyzed for CISH mRNA levels as a function of time by real-time PCR. F and G, CISH (F) and cyclin D1 (G) mRNA levels were measured by real-time PCR in resting and PRL-stimulated empty vector and c-Myb transfectants. After arrest in defined medium for 24 h, the cells were stimulated with PRL (100 ng/ml) for 2 h before harvest and analysis. H, The time course of CISH protein expression. T47D cells were stimulated with PRL (100 ng/ml) and analyzed for CISH protein expression by anti-CISH antibody. I, Similar to H above, T47D transfectants were stimulated with PRL (100 ng/ml) for 2 h and analyzed for CISH protein expression by anti-CISH antibody. Loading and expression controls are, respectively, demonstrated by reprobing the stripped blot with anti-GAPDH. Results are shown as the means with error bars depicting ± sem. *, P < 0.05; **, P < 0.01; ***, P < 0.001 as compared with control without PRL stimulation alone. Statistical analysis was performed using two-way ANOVA. RLU, Relative luciferase units.

Luciferase reporter constructs containing either the composite β-casein promoter (β-casein-344) or a synthetic lactogenic hormone response element (pGL4-LHRE) were transfected into T47D cells to confirm the effects of c-Myb. Luciferase assay revealed that ectopic c-Myb expression increased both basal and PRL-induced gene expression (Fig. 2, C and D). The expression from this purely Stat5a-responsive pGL4-LHRE reporter, as well as the composite β-casein-344 reporter, both demonstrated additional increases in activity after PRL stimulation. It is noteworthy that expression from the pGL4-LHRE reporter, a minimal synthetic reporter consisting of only six tandem consensus Stat5a DNA-binding elements and devoid of other transcription factor binding sites, was stimulated in resting c-Myb transfectants to a level comparable to that observed in PRL-stimulated controls. This may be due to the effects of ectopic c-Myb expression and the basal phosphorylated Stat5a activity in the cells. Alternatively, the requirement of the transfectants to be placed into FBS-containing medium after transfection (before resting and luciferase assay) may contribute to the basal activation of these reporters (given the long half-life of luciferase). Indeed, c-Myb overexpression had no stimulatory effect on pGL4-LHRE luciferase reporter when cotransfected with c-Myb into the PRLr-deficient HEK293 cells (data not shown).

One mechanism through which PRL could be enhancing the expression from the reporters is through direct stimulation of c-Myb-responsive genes by c-Myb itself, which in turn augment PRL-induced gene expression. Microarray results showed that PRL did not induce c-Myb mRNA in T47D cells (data not shown). In addition, a c-Myb-specific reporter construct (pΔ3-Luc, containing three copies of the mim1 c-Myb binding site upstream of a minimal promoter) was cotransfected into T47D cells. Ectopic expression of c-Myb resulted in 270-fold increase in expression from the pΔ3-Luc reporter; however, PRL treatment of either the empty vector control, or c-Myb ectopic expression transfectant, did not result in an increase in expression over that observed in unstimulated transfectants (data not shown). Although not definitive, these findings would suggest that PRL stimulation has minimal effects on c-Myb-responsive promoters.

PRL and c-Myb stimulate CISH mRNA and protein expression

PRL has been demonstrated to up-regulate the expression from the endogenous CISH gene (60,61), in a manner similar to that observed with the pGL4-CISH luciferase reporter (48). The CISH protein is overexpressed in primary human breast cancers (59) and functions in tumor pathogenesis by positively regulating cell proliferation (62), suggesting that PRL-induced CISH expression may facilitate the pathogenesis of breast cancer by enhancing cell proliferation. To examine whether c-Myb ectopic expression altered the endogenous CISH mRNA in T47D cells, real-time PCR was used to quantitate the PRL-induced CISH mRNA expression as a function of time. These studies revealed that CISH mRNA levels peak approximately 1 h after PRL treatment with a subsequent slow and partial decrease afterward (Fig. 2E). Real-time PCR was then conducted to examine the effect of ectopic c-Myb expression and PRL stimulation on endogenous CISH mRNA expression (Fig. 2F). Unlike the luciferase reporter constructs used above, c-Myb ectopic expression by itself had a modest effect on basal CISH mRNA levels. PRL stimulation alone resulted in a 3-fold increase in CISH mRNA, whereas PRL stimulation of c-Myb transfectants resulted in nearly a 5-fold increase in expression of this gene over unstimulated controls. A similar phenomenon was observed for cyclin D1 mRNA (Fig. 2G). Comparable results were obtained when Western blots were employed to examine CISH protein levels as a function of time (Fig. 2H). In PRL-stimulated T47D transfectants overexpressing c-Myb, both c-Myb ectopic expression and PRL stimulation increased CISH protein expression (Fig. 2I). Nearly a 6-fold increase in CISH expression was noted in the PRL-stimulated, T47D c-Myb transfectants, as opposed to the 1.7-fold increase in unstimulated c-Myb transfectants or the 2.4-fold increase noted in PRL-stimulated empty vector controls. These observations, in part, may explain the increased expression of CISH recently reported in breast cancer (59).

PRL stimulation induces c-Myb binding to the Stat5a-responsive CISH promoter chromatin

Given the PRL-induced co-IP of c-Myb with Stat5a, it was hypothesized that c-Myb could directly interact with the chromatin of an endogenous, Stat5a-responsive promoter, such as CISH. Analysis of the CISH promoter revealed both cognate Stat5a and c-Myb DNA binding sites (Fig. 3C). To test whether c-Myb could interact with the endogenous CISH promoter, ChIP on T47D cells treated with PRL as a function of time was performed with an anti-c-Myb antibody. Semiquantitative PCR showed that c-Myb binds to the CISH promoter (Fig. 3A). Real-time PCR analyses revealed that PRL stimulation enhanced the association of c-Myb with the CISH promoter in a time-dependent manner after PRL treatment (Fig. 3B). To better delineate the site of c-Myb interaction within the CISH promoter, real-time PCR primer sets were generated to interrogate various regions of this promoter (Fig. 3C). Because sonication of the chromatin before ChIP assay resulted in majority of chromatin fragments with sizes from 200–1000 bp, the four ChIP primer sets used were distributed over the extent of the 2-kb CISH promoter. For primer D set (Fig. 3C), the amplicon using these primers olg108 and olg109 (Table 1) contains two Stat5a binding sites and are very close to other Stat5a binding site. Real-time PCR with these primer sets revealed an enhanced binding of c-Myb to the proximal CISH promoter after PRL treatment (Fig. 3D), a region that is relatively enriched in Stat5a binding sites.

Figure 3.

Figure 3

Open in a new tab

PRL stimulation induces the binding of c-Myb to the chromatin of the proximal CISH promoter. Lysates from T47D cells were subject to ChIP with antibodies. A, Semiquantitative PCR analysis with 35 cycles using GoTaq (Promega) demonstrates that PRL stimulates c-Myb association with the chromatin of the CISH promoter. Control IgG antibody pulldown DNA, RNA polymerase II pulldown DNA, and input DNA were used as negative and positive controls. Real-time PCR has been conducted with the CISH-D primer set defined in C using the same DNA to show the Ct value (IgG pulled down DNA, 38; input DNA, 28; and 30-min PRL-treated sample then pulled down by c-Myb DNA, 32). B, Real-time PCR on the anti-c-Myb ChIP (using the CISH-D primer set defined in C) from PRL-stimulated T47D lysates was performed and normalized to input DNA. C, Diagram of the CISH promoter locus; C represents putative c-Myb binding sites, S represents putative Stat5 binding sites, as identified by TFsearch program analysis (http://www.cbrc.jp/research/db/TFSEARCH.html). Regions spanned by the primer sets used for PCR analysis are indicated by A–D. D, Mapping of the chromatin region within the CISH promoter bound by c-Myb as defined by ChIP primer sets that span the CISH promoter. Primer sets used for this selective anti-c-Myb ChIP are defined in C and in Table 1. *, P < 0.05.

Table 1.

Primers used for real-time PCR

Gene name Primer sequences (5′–3′) Starts Ends RNA accession no.
For RT-PCR (all RT-PCR primers are located inside the coding sequence)
 18S rRNA olg200 CCCCATGAACGAGGGAATT 1626 1686 NR_003286
olg201 GGGACTTAATCAACGCAAGCTT
 GAPDH olg74 CATGAGAAGTATGACAACAGCCT 511 623 NM_002046
olg75 AGTCCTTCCACGATACCAAAGT
 BCL2 olg353 ATGTGTGTGGAGAGCGTCAA 962 1097 NM_000633
olg354 ACAGTTCCACAAAGGCATCC
 c-Myb olg80 GCCAATTATCTCCCGAATCGAA 337 507 NM_005375
olg81 ACATTGTTTTCCAATTCTCCCCT
 Cyclin D1 (BCL1) olg310 CCGTCCATGCGGAAGATC 369 443 NM_053056
olg311 GAAGACCTCCTCCTCGCACTT
 C/EBPβ olg284 AGAACGAGCGGCTGCAGAAGA 1121 1185 NM_005194
olg285 CAAGTTCCGCAGGGTGCTGA-3
 CISH olg133 AGAGGAGGATCTGCTGTGCAT 311 380 NM_145071
olg134 GGAACCCCAATACCAGCCAG
 c-Myc olg314 GGATTTTTTTCGGGTAGTGGAA 527 601 NM_002467
olg315 TTCCTGTTGGTGAAGCTAACGTT
For ChIP
 CISH A olg100 GCAAATTGCTGAGAGTGCTTGA −1971 −1904 NM_145071
olg101 CTTCTTCCCCCTCACCATGAC
 CISH B olg102 CAGAGCAAACTGAGCCCTGTCT −1498 −1432 NM_145071
olg103 AGACCCCTGGCCTTGTTGA
 CISH C olg104 CCGCCCCAACCTCTATCA −1034 −972 NM_145071
olg105 GAGTCCTGCAACTCAAAACATAGG
 CISH D olg108 AGCCCGCGGTTCTAGGAA −140 −68 NM_145071
olg109 AGCTGCTGCCTAATCCTTTGTC
Open in a new tab

Primer sequences were obtained using Primer Express 3.1 software or from Primerbank (72) (http://pga.mgh.harvard.edu/primerbank/). RT-PCR primer pairs span two exons, except the intronless 18S rRNA and CEBPβ or BCL2. Primers were tested by dissociation curve analysis to assure only single amplicons. The base pairs that the forward primer starts and reverse primer ends are based on mRNA sequence or 18S rRNA. Number for CISH A, B, C, and D primers is represented as primer position upstream of CISH transcriptional start point (+1). 

Loss of DNA binding ability does not impair the effect of c-Myb on Stat5a-induced gene expression

To further address the mechanism of c-Myb action on Stat5a-driven gene expression, the effects of overexpressing DNA-binding defective mutants of c-Myb were examined. Two DNA-binding defective replacement mutants of c-Myb were generated (N179A and N183A, Fig. 4A). Co-IP analysis revealed that the DNA-binding defective mutant N179A did not lose the ability to bind to Stat5a (Fig. 4B). To confirm the inability of these mutants to drive c-Myb-induced gene expression in breast cancer cells, these mutants were cotransfected into T47D cells with the c-Myb-responsive pΔ3-Luc luciferase reporter. These experiments revealed that both the N179A and N183A mutants were impaired in their ability to stimulate this reporter, confirming that a functional DNA-binding domain is required for canonical c-Myb-driven gene expression (Fig. 4C). Interestingly, when both of these mutants were coexpressed in T47D cells with the Stat5a-responsive pGL4-CISH reporter, the increases in both basal and PRL-induced reporter expression were observed comparable to those noted in wild-type c-Myb transfectants (Fig. 4D). Consistent with these observations was the finding in T47D cells that coexpression of the tyrosine phosphorylation Stat5a mutant (Y694F) with c-Myb significantly ablated PRL-induced expression of the Stat5-responsive luciferase reporter (data not shown). These data, coupled with the ability of c-Myb to potentiate pGL4-LHRE reporter expression (the reporter devoid of c-Myb binding sites), would argue that the potentiation of Stat5a-driven gene expression is not dependent on the ability of c-Myb to directly bind DNA or induce canonical c-Myb-driven gene expression and may instead relate to a functional interaction between c-Myb and Stat5a at the promoter level.

Knockdown of c-Myb impairs the PRL-induced gene expression

To further confirm the hypothesis that the PRL-induced interaction of c-Myb and Stat5a stimulate the endogenous gene expression, siRNA down-regulation of c-Myb was conducted in T47D cells. The siRNA used in the study has been validated and had a significant knockdown on c-Myb expression (55). Results showed that the endogenous c-Myb mRNA was decreased significantly in si-c-Myb transfectants (Fig. 5A). The effect of c-Myb knockdown on endogenous genes whose promoters contain binding sites for both c-Myb and Stat5, namely BCL2 (63), C/EBPβ (64), and c-Myc (65), as well as genes whose promoters contain binding sites for Stat5a only, namely cyclin D1 and CISH, were examined (Fig. 5, B–F). These analyses revealed that c-Myb knockdown resulted in significant reductions in the PRL-induced expression of all of these genes. Not only do these studies further corroborate the overexpression studies presented earlier, but they also again suggest that the actions of c-Myb on Stat5a function are indirect.

Figure 5.

Figure 5

Open in a new tab

Real-time PCR validated the impairment of PRL-induced gene expression by si-c-Myb knockdown. A, c-Myb; B, BCL2; C, C/EBPβ; D, CISH; E, c-Myc; F, cyclin D1. The y-axis labeled fold change is defined in Materials and Methods. Results are shown as the means with error bars depicting ± sem. ***, P < 0.001 as compared with control without PRL stimulation alone. Statistical analysis was performed using two-way ANOVA.

c-Myb overexpression enhanced PRL-stimulated T47D cell proliferation

PRL stimulation and c-Myb overexpression have been demonstrated to stimulate Bcl2, C/EBPβ, c-Myc, and cyclin D1 gene expression (8,9,10,11,64,66). Coupled with our previous observation that the c-Myb protein is overexpressed in breast cancer (44), these observations suggest that a coregulatory relationship between these transcription factors could influence the pathobiology of breast cancer. To test this hypothesis, T47D transfectants, expressing c-Myb (or empty GFP vector control, all showing GFP after 5 d) were stimulated with PRL, and proliferation assessed by [3H]thymidine incorporation (Fig. 6). These studies showed that either PRL or c-Myb ectopic expression alone could enhance T47D proliferation; however, the combination of both induced the highest levels of cell proliferation. As such, these findings would suggest that c-Myb potentiate the biologically relevant actions of PRL in human breast cancer.

Figure 6.

Figure 6

Open in a new tab

C-Myb potentiates PRL-driven T47D proliferation. T47D cells were transfected with c-Myb as described in Materials and Methods. Cells were stimulated with PRL (100 ng/ml) in defined medium for 72 h before incubation with [3H]thymidine, harvesting, and scintigraphy. The transfection efficiency of these experiments was 40% as measured by GFP fluorescence, which was retained during the course of these experiments. Results are shown as the means with error bars depicting ± sem. *, P < 0.05; **, P < 0.01; ***, P < 0.001 as compared with control without PRL stimulation alone. Statistical analysis was performed using two-way ANOVA.

Discussion

The role of Stat5a in the pathogenesis of mammary cancer is complex. On one hand, data from the Stat5a knockout mouse have demonstrated that hemizygous loss of Stat5a is sufficient to significantly reduce mammary tumor number, size, and progression when crossed with the WAP-T-antigen mouse model of mammary tumorigenesis (37). However, two studies using human clinical material have noted that high levels of phosphorylated Stat5a are observed in breast cancer and are correlated with breast cancer demonstrating favorable histology and outcome (38,39). Interestingly, although PRL stimulates breast cancer motility, invasion, and soft agar outgrowth (3) (Clevenger unpublished observations), activated Stat5a enhances E-cadherin expression and cell clustering (15). One mechanism that could explain these disparate activities of Stat5a during the pathogenesis of breast cancer is that its function is significantly modulated by coregulators it interacts with in the nucleus. To explore this hypothesis, TF-TF array analysis was used to identify several novel transcription factors that interact with Stat5a (unpublished data); from these analyses, the proto-oncogene c-Myb was the first candidate to be validated and subject to further characterization. These follow-on studies have revealed a PRL-inducible association between c-Myb and the chromatin of the Stat5a-responsive CISH promoter region.

Overexpression of c-Myb in breast cancer cells resulted in enhanced expression from three Stat5a-responsive luciferase promoter-reporter constructs and the endogenous CISH gene. Two c-Myb DNA-binding domain mutants, with markedly reduced canonical c-Myb-driven gene expression, were capable of potentiating CISH expression to a level observed with the wild-type c-Myb. In addition, significant reduction in PRL-induced expression from Stat5a-driven endogenous promoters was observed after knockdown of c-Myb mediated by specific siRNA. Given that c-Myb was capable of potentiating expression from a synthetic promoter-reporter construct (pGL4-LHRE) that consists only of multimerized Stat5a binding sites, these studies would indicate that the activation of PRL-triggered, Stat5a-driven promoters by c-Myb is most likely indirect and not a consequence of its direct engagement of DNA.

The indirect activation of Stat5a-driven gene expression by c-Myb could occur by distinct mechanisms or combinations thereof. Certainly, genes induced by c-Myb could indirectly impact Stat5a function by modulating its activity, levels, or localization. However, we view this possibility as unlikely, because PRL stimulation had little effect on a c-Myb-responsive promoter. Coregulatory mechanisms therefore are the most likely means through which c-Myb potentiates Stat5a-driven gene expression. Although this could occur by the potentiation of expression of secondary coregulators by c-Myb, which in turn could activate Stat5a, this possibility is viewed as less likely. Instead, a direct coregulatory role for c-Myb during Stat5a function is favored given the temporal and spatial associations of both of these transcription factors. Precedence for this modality of c-Myb action has been noted for the promoter for vascular endothelial growth factor (VEGF) (40). This study revealed that c-Myb activation of a VEGF reporter construct was not substantially affected by the loss of c-Myb DNA binding (as a consequence of mutagenesis to either the c-Myb protein or its DNA binding site) but instead most probably was related to the engagement of c-Myb through presumed binding to the specificity protein 1 (SP1) transcription factor (40).

The regulation of Stat5 activity within the nucleus has been observed after its interaction with several other intranuclear proteins including cAMP response element-binding protein-binding protein (CBP)/p300 (41), Nmi (20), the glucocorticoid receptor (67), BRCA1/2 (68), MAPK1 (69), PIAS3 (27), and C/EBPβ (19). Of note, C/EBPβ has been found to bind to both Stat5 (19) and Myb (66), and its expression is enhanced after PRL stimulation (11). How the functional consequences of the interaction of Stat5a with these various coregulators at a mechanistic level, however, has remained largely unresolved. Studies underway in our lab are currently seeking to identify whether the c-Myb/Stat5a interaction alters the interaction/stability of Stat5a with various elements of the transcriptional apparatus on PRL-responsive chromatin. Alternatively, c-Myb could directly enhance the chromatin engagement and/or transcriptional activity of nonphosphorylated Stat5a (70).

Previous studies have shown that the expression of both c-Myb RNA (45) and protein (44) are up-regulated in human breast cancer. The regulation of c-Myb expression appears in part to be controlled by the actions of the ER, because a tight association between c-Myb RNA expression and ER positivity within breast cancer has been noted. The regulation of c-Myb expression by the ER appears to occur at both transcriptional (47) and posttranscriptional mechanisms (46). Despite these data, no studies previously have examined the functional consequences of c-Myb overexpression in human breast cancer. Our studies clearly indicate that c-Myb can enhance PRL-induced proliferation in the ER-positive breast cancer cell line T47D, and ongoing work in our lab seeks to further characterize the effects of such overexpression on the cell biology of breast cancer. Interestingly, as noted above, increased c-Myb expression and Stat5a phosphorylation are both associated with a favorable prognosis in breast cancer. This may be secondary to the summated independent activity of c-Myb and Stat5a on coresponsive promoters of relevance in breast cancer including BCL2, C/EBPβ, c-Myc, and cyclin D1; these three genes [BCL2 (63), C/EBPβ (64), and c-Myc (65)] are also the direct target genes of the protooncogene c-Myb. Alternatively, as we suggest here, the enhanced expression of these gene products may be the result of the direct interaction of c-Myb with Stat5a, thus representing a novel mechanism through which the ER can modulate Stat5a activity via its regulation of c-Myb expression. Because each of these transcription factors has been considered as or is a pharmacological target (18,71), further study of their interactions may provide additional sites for therapeutic intervention in breast cancer.

Acknowledgments

We gratefully acknowledge the technical assistance of Dr. Lisa Haubein, Dr. Gianni Antico, and Ann Shim. We thank Linda Wolff (National Institutes of Health) providing vector pCDNA3.1-FL-c-Myb. We also thank lab members for constructive discussion.

Footnotes

This work was supported by National Institutes of Health (RO1CA-102682), the Avon and Lynn Sage Foundations, and the Zell Scholar's Fund.

Disclosure Summary: The authors have nothing to disclose.

First Published Online November 26, 2008

Abbreviations: C/EBPβ, CCAAT/enhancer-binding protein-β; ChIP, chromatin immunoprecipitation; CISH, cytokine-inducible SH2-containing protein; co-IP, co-immunoprecipitation; ER, estrogen receptor; IB, immunoblot; Jak2, Janus kinase 2; PIAS, peptide inhibitors of activated Stats; PRL, prolactin; PRLr, prolactin receptor; siRNA, small interfering RNA; Stat5, signal transducer and activator of transcription 5; TF-TF, transcription factor-transcription factor.

References

  1. Clevenger CV, Plank TL 1997 Prolactin as an autocrine/paracrine factor in breast tissue. J Mammary Gland Biol Neoplasia 2:59–68 [DOI] [PubMed] [Google Scholar]
  2. Perks CM, Keith AJ, Goodhew KL, Savage PB, Winters ZE, Holly JM 2004 Prolactin acts as a potent survival factor for human breast cancer cell lines. Br J Cancer 91:305–311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Maus MV, Reilly SC, Clevenger CV 1999 Prolactin as a chemoattractant for human breast carcinoma. Endocrinology 140:5447–5450 [DOI] [PubMed] [Google Scholar]
  4. Horseman ND 1999 Prolactin and mammary gland development. J Mammary Gland Biol Neoplasia 4:79–88 [DOI] [PubMed] [Google Scholar]
  5. Campbell GS, Argetsinger LS, Ihle JN, Kelly PA, Rillema JA, Carter-Su C 1994 Activation of JAK2 tyrosine kinase by prolactin receptors in Nb2 cells and mouse mammary gland explants. Proc Natl Acad Sci USA 91:5232–5236 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Rui H, Lebrun JJ, Kirken RA, Kelly PA, Farrar WL 1994 JAK2 activation and cell proliferation induced by antibody-mediated prolactin receptor dimerization. Endocrinology 135:1299–1306 [DOI] [PubMed] [Google Scholar]
  7. Gadd SL, Clevenger CV 2006 Ligand-independent dimerization of the human prolactin receptor isoforms: functional implications. Mol Endocrinol 20:2734–2746 [DOI] [PubMed] [Google Scholar]
  8. Beck MT, Peirce SK, Chen WY 2002 Regulation of bcl-2 gene expression in human breast cancer cells by prolactin and its antagonist, hPRL-G129R. Oncogene 21:5047–5055 [DOI] [PubMed] [Google Scholar]
  9. Brockman JL, Schroeder MD, Schuler LA 2002 PRL activates the cyclin D1 promoter via the Jak2/Stat pathway. Mol Endocrinol 16:774–784 [DOI] [PubMed] [Google Scholar]
  10. Dominguez-Caceres MA, Garcia-Martinez JM, Calcabrini A, Gonzalez L, Porque PG, Leon J, Martin-Perez J 2004 Prolactin induces c-Myc expression and cell survival through activation of Src/Akt pathway in lymphoid cells. Oncogene 23:7378–7390 [DOI] [PubMed] [Google Scholar]
  11. Nanbu-Wakao R, Fujitani Y, Masuho Y, Muramatu M, Wakao H 2000 Prolactin enhances CCAAT enhancer-binding protein-β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ) messenger RNA expression and stimulates adipogenic conversion of NIH-3T3 cells. Mol Endocrinol 14:307–316 [DOI] [PubMed] [Google Scholar]
  12. Clevenger CV, Zheng J, Jablonski EM, Galbaugh TL, Fang F 2008 From bench to bedside: future potential for the translation of prolactin inhibitors as breast cancer therapeutics. J Mammary Gland Biol Neoplasia 13:147–156 [DOI] [PubMed] [Google Scholar]
  13. Darnell Jr JE, Kerr IM, Stark GR 1994 Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415–1421 [DOI] [PubMed] [Google Scholar]
  14. Wagner KU, Rui H 2008 Jak2/Stat5 signaling in mammogenesis, breast cancer initiation and progression. J Mammary Gland Biol Neoplasia 13:93–103 [DOI] [PubMed] [Google Scholar]
  15. Sultan AS, Xie J, LeBaron MJ, Ealley EL, Nevalainen MT, Rui H 2005 Stat5 promotes homotypic adhesion and inhibits invasive characteristics of human breast cancer cells. Oncogene 24:746–760 [DOI] [PubMed] [Google Scholar]
  16. Parganas E, Wang D, Stravopodis D, Topham DJ, Marine JC, Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen JM, Grosveld G, Ihle JN 1998 Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93:385–395 [DOI] [PubMed] [Google Scholar]
  17. Darnell Jr JE 1996 Reflections on STAT3, STAT5, and STAT6 as fat STATs. Proc Natl Acad Sci USA 93:6221–6224 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Clevenger CV 2004 Roles and regulation of stat family transcription factors in human breast cancer. Am J Pathol 165:1449–1460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Wyszomierski SL, Rosen JM 2001 Cooperative effects of STAT5 (signal transducer and activator of transcription 5) and C/EBPβ (CCAAT/enhancer-binding protein-β) on β-casein gene transcription are mediated by the glucocorticoid receptor. Mol Endocrinol 15:228–240 [DOI] [PubMed] [Google Scholar]
  20. Zhu M, John S, Berg M, Leonard WJ 1999 Functional association of Nmi with Stat5 and Stat1 in IL-2- and IFNγ-mediated signaling. Cell 96:121–130 [DOI] [PubMed] [Google Scholar]
  21. Xu BC, Wang X, Darus CJ, Kopchick JJ 1996 Growth hormone promotes the association of transcription factor STAT5 with the growth hormone receptor. J Biol Chem 271:19768–19773 [PubMed] [Google Scholar]
  22. Cella N, Groner B, Hynes NE 1998 Characterization of Stat5a and Stat5b homodimers and heterodimers and their association with the glucocorticoid receptor in mammary cells. Mol Cell Biol 18:1783–1792 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hilton DJ 1999 Negative regulators of cytokine signal transduction. Cell Mol Life Sci 55:1568–1577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Starr R, Hilton DJ 1998 SOCS: suppressors of cytokine signalling. Int J Biochem Cell Biol 30:1081–1085 [DOI] [PubMed] [Google Scholar]
  25. Shuai K 2000 Modulation of STAT signaling by STAT-interacting proteins. Oncogene 19:2638–2644 [DOI] [PubMed] [Google Scholar]
  26. Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, Shuai K 1998 Inhibition of Stat1-mediated gene activation by PIAS1. Proc Natl Acad Sci USA 95:10626–10631 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Rycyzyn MA, Clevenger CV 2002 The intranuclear prolactin/cyclophilin B complex as a transcriptional inducer. Proc Natl Acad Sci USA 99:6790–6795 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Weston K 1999 Reassessing the role of C-MYB in tumorigenesis. Oncogene 18:3034–3038 [DOI] [PubMed] [Google Scholar]
  29. Ness SA 1999 Myb binding proteins: regulators and cohorts in transformation. Oncogene 18:3039–3046 [DOI] [PubMed] [Google Scholar]
  30. O'Rourke JP, Ness SA 2008 Alternative RNA splicing produces multiple forms of c-Myb with unique transcriptional activities. Mol Cell Biol 28:2091–2101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lei W, Liu F, Ness SA 2005 Positive and negative regulation of c-Myb by cyclin D1, cyclin-dependent kinases, and p27 Kip1. Blood 105:3855–3861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Tahirov TH, Sato K, Ichikawa-Iwata E, Sasaki M, Inoue-Bungo T, Shiina M, Kimura K, Takata S, Fujikawa A, Morii H, Kumasaka T, Yamamoto M, Ishii S, Ogata K 2002 Mechanism of c-Myb-C/EBPβ cooperation from separated sites on a promoter. Cell 108:57–70 [DOI] [PubMed] [Google Scholar]
  33. Andersson KB, Kowenz-Leutz E, Brendeford EM, Tygsett AH, Leutz A, Gabrielsen OS 2003 Phosphorylation-dependent down-regulation of c-Myb DNA binding is abrogated by a point mutation in the v-myb oncogene. J Biol Chem 278:3816–3824 [DOI] [PubMed] [Google Scholar]
  34. Goupille O, Barnier JV, Guibert B, Paly J, Djiane J 2000 Effect of PRL on MAPK activation: negative regulatory role of the C-terminal part of the PRL receptor. Mol Cell Endocrinol 159:133–146 [DOI] [PubMed] [Google Scholar]
  35. Buckley AR, Buckley DJ, Leff MA, Hoover DS, Magnuson NS 1995 Rapid induction of pim-1 expression by prolactin and interleukin-2 in rat Nb2 lymphoma cells. Endocrinology 136:5252–5259 [DOI] [PubMed] [Google Scholar]
  36. Leverson JD, Ness SA 1998 Point mutations in v-Myb disrupt a cyclophilin-catalyzed negative regulatory mechanism. Mol Cell 1:203–211 [DOI] [PubMed] [Google Scholar]
  37. Ren S, Cai HR, Li M, Furth PA 2002 Loss of Stat5a delays mammary cancer progression in a mouse model. Oncogene 21:4335–4339 [DOI] [PubMed] [Google Scholar]
  38. Nevalainen MT, Xie J, Torhorst J, Bubendorf L, Haas P, Kononen J, Sauter G, Rui H 2004 Signal transducer and activator of transcription-5 activation and breast cancer prognosis. J Clin Oncol 22:2053–2060 [DOI] [PubMed] [Google Scholar]
  39. Cotarla I, Ren S, Zhang Y, Gehan E, Singh B, Furth PA 2004 Stat5a is tyrosine phosphorylated and nuclear localized in a high proportion of human breast cancers. Int J Cancer 108:665–671 [DOI] [PubMed] [Google Scholar]
  40. Lutwyche JK, Keough RA, Hunter J, Coles LS, Gonda TJ 2006 DNA binding-independent transcriptional activation of the vascular endothelial growth factor gene (VEGF) by the Myb oncoprotein. Biochem Biophys Res Commun 344:1300–1307 [DOI] [PubMed] [Google Scholar]
  41. Pfitzner E, Jahne R, Wissler M, Stoecklin E, Groner B 1998 p300/CREB-binding protein enhances the prolactin-mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat5-mediated suppression of the glucocorticoid response. Mol Endocrinol 12:1582–1593 [DOI] [PubMed] [Google Scholar]
  42. Kauraniemi P, Hedenfalk I, Persson K, Duggan DJ, Tanner M, Johannsson O, Olsson H, Trent JM, Isola J, Borg A 2000 MYB oncogene amplification in hereditary BRCA1 breast cancer. Cancer Res 60:5323–5328 [PubMed] [Google Scholar]
  43. Lee S, Medina D, Tsimelzon A, Mohsin SK, Mao S, Wu Y, Allred DC 2007 Alterations of gene expression in the development of early hyperplastic precursors of breast cancer. Am J Pathol 171:252–262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. McHale K, Tomaszewski JE, Puthiyaveettil R, Livolsi VA, Clevenger CV 2008 Altered expression of prolactin receptor-associated signaling proteins in human breast carcinoma. Mod Pathol 21:565–571 [DOI] [PubMed] [Google Scholar]
  45. Guerin M, Sheng ZM, Andrieu N, Riou G 1990 Strong association between c-myb and oestrogen-receptor expression in human breast cancer. Oncogene 5:131–135 [PubMed] [Google Scholar]
  46. Gudas JM, Klein RC, Oka M, Cowan KH 1995 Posttranscriptional regulation of the c-myb proto-oncogene in estrogen receptor-positive breast cancer cells. Clin Cancer Res 1:235–243 [PubMed] [Google Scholar]
  47. Drabsch Y, Hugo H, Zhang R, Dowhan DH, Miao YR, Gewirtz AM, Barry SC, Ramsay RG, Gonda TJ 2007 Mechanism of and requirement for estrogen-regulated MYB expression in estrogen-receptor-positive breast cancer cells. Proc Natl Acad Sci USA 104:13762–13767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Fang F, Antico G, Zheng J, Clevenger CV 2008 Quantification of PRL/Stat5 signaling with a novel pGL4-CISH reporter. BMC Biotechnol 8:11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sotiropoulos A, Moutoussamy S, Renaudie F, Clauss M, Kayser C, Gouilleux F, Kelly PA, Finidori J 1996 Differential activation of Stat3 and Stat5 by distinct regions of the growth hormone receptor. Mol Endocrinol 10:998–1009 [DOI] [PubMed] [Google Scholar]
  50. Gouilleux F, Wakao H, Mundt M, Groner B 1994 Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 13:4361–4369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Bies J, Nazarov V, Wolff L 1999 Identification of protein instability determinants in the carboxy-terminal region of c-Myb removed as a result of retroviral integration in murine monocytic leukemias. J Virol 73:2038–2044 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Schurmann A, Sokolowski R, Haas M, Wolfes H 2001 Characterization of direct readout contacts of the Myb DNA-binding domain. Blood Cells Mol Dis 27:464–469 [DOI] [PubMed] [Google Scholar]
  53. Miller SL, DeMaria JE, Freier DO, Riegel AM, Clevenger CV 2005 Novel association of Vav2 and Nek3 modulates signaling through the human prolactin receptor. Mol Endocrinol 19:939–949 [DOI] [PubMed] [Google Scholar]
  54. Berge T, Matre V, Brendeford EM, Saether T, Luscher B, Gabrielsen OS 2007 Revisiting a selection of target genes for the hematopoietic transcription factor c-Myb using chromatin immunoprecipitation and c-Myb knockdown. Blood Cells Mol Dis 39:278–286 [DOI] [PubMed] [Google Scholar]
  55. Lahortiga I, De Keersmaecker K, Van Vlierberghe P, Graux C, Cauwelier B, Lambert F, Mentens N, Beverloo HB, Pieters R, Speleman F, Odero MD, Bauters M, Froyen G, Marynen P, Vandenberghe P, Wlodarska I, Meijerink JP, Cools J 2007 Duplication of the MYB oncogene in T cell acute lymphoblastic leukemia. Nat Genet 39:593–595 [DOI] [PubMed] [Google Scholar]
  56. Lin YC, Kuo MW, Yu J, Kuo HH, Lin RJ, Lo WL, Yu AL 2008 MiR-150 negatively regulates c-Myb expression, which is evolutionarily conserved and plays an important role in developmental process. Mol Biol Evol 25:2189–2198 [DOI] [PubMed] [Google Scholar]
  57. Shiu RP, Murphy LC, Tsuyuki D, Myal Y, Lee-Wing M, Iwasiow B 1987 Biological actions of prolactin in human breast cancer. Recent Prog Horm Res 43:277–303 [DOI] [PubMed] [Google Scholar]
  58. Cheng J, Zhang D, Zhou C, Marasco WA 2004 Down-regulation of SHP1 and up-regulation of negative regulators of JAK/STAT signaling in HTLV-1 transformed cell lines and freshly transformed human peripheral blood CD4+ T-cells. Leuk Res 28:71–82 [DOI] [PubMed] [Google Scholar]
  59. Raccurt M, Tam SP, Lau P, Mertani HC, Lambert A, Garcia-Caballero T, Li H, Brown RJ, McGuckin MA, Morel G, Waters MJ 2003 Suppressor of cytokine signalling gene expression is elevated in breast carcinoma. Br J Cancer 89:524–532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Utama FE, LeBaron MJ, Neilson LM, Sultan AS, Parlow AF, Wagner KU, Rui H 2006 Human prolactin receptors are insensitive to mouse prolactin: implications for xenotransplant modeling of human breast cancer in mice. J Endocrinol 188:589–601 [DOI] [PubMed] [Google Scholar]
  61. Pezet A, Favre H, Kelly PA, Edery M 1999 Inhibition and restoration of prolactin signal transduction by suppressors of cytokine signaling. J Biol Chem 274:24497–24502 [DOI] [PubMed] [Google Scholar]
  62. Borges S, Moudilou E, Vouyovitch C, Chiesa J, Lobie P, Mertani H, Raccurt M 2008 Involvement of a JAK/STAT pathway inhibitor: cytokine inducible SH2 containing protein in breast cancer. Adv Exp Med Biol 617:321–329 [DOI] [PubMed] [Google Scholar]
  63. Salomoni P, Perrotti D, Martinez R, Franceschi C, Calabretta B 1997 Resistance to apoptosis in CTLL-2 cells constitutively expressing c-Myb is associated with induction of BCL-2 expression and Myb-dependent regulation of bcl-2 promoter activity. Proc Natl Acad Sci USA 94:3296–3301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Liu F, Lei W, O'Rourke JP, Ness SA 2006 Oncogenic mutations cause dramatic, qualitative changes in the transcriptional activity of c-Myb. Oncogene 25:795–805 [DOI] [PubMed] [Google Scholar]
  65. Nakagoshi H, Kanei-Ishii C, Sawazaki T, Mizuguchi G, Ishii S 1992 Transcriptional activation of the c-myc gene by the c-myb and B-myb gene products. Oncogene 7:1233–1240 [PubMed] [Google Scholar]
  66. Mink S, Kerber U, Klempnauer KH 1996 Interaction of C/EBPβ and v-Myb is required for synergistic activation of the mim-1 gene. Mol Cell Biol 16:1316–1325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yu-Lee LY, Luo G, Book ML, Morris SM 1998 Lactogenic hormone signal transduction. Biol Reprod 58:295–301 [DOI] [PubMed] [Google Scholar]
  68. Vidarsson H, Mikaelsdottir EK, Rafnar T, Bertwistle D, Ashworth A, Eyfjord JE, Valgeirsdottir S 2002 BRCA1 and BRCA2 bind Stat5a and suppress its transcriptional activity. FEBS Lett 532:247–252 [DOI] [PubMed] [Google Scholar]
  69. Pircher TJ, Petersen H, Gustafsson JA, Haldosen LA 1999 Extracellular signal-regulated kinase (ERK) interacts with signal transducer and activator of transcription (STAT) 5a. Mol Endocrinol 13:555–565 [DOI] [PubMed] [Google Scholar]
  70. Yang J, Stark GR 2008 Roles of unphosphorylated STATs in signaling. Cell Res 18:443–451 [DOI] [PubMed] [Google Scholar]
  71. Katzenellenbogen BS, Montano MM, Le Goff P, Schodin DJ, Kraus WL, Bhardwaj B, Fujimoto N 1995 Antiestrogens: mechanisms and actions in target cells. J Steroid Biochem Mol Biol 53:387–393 [DOI] [PubMed] [Google Scholar]
  72. Wang X, Seed B 2003 A PCR primer bank for quantitative gene expression analysis. Nucleic Acids Res 31:e154 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES