Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jan 1.
Published in final edited form as: Immunity. 2009 Jan;30(1):120–129. doi: 10.1016/j.immuni.2008.11.008

A T cell-dependent mechanism for the induction of human mucosal homing IgA-secreting plasmablasts

Melissa Dullaers 1, Dapeng Li 1, Yaming Xue 1, Ling Ni 1, Ingrid Gayet 1, Rimpei Morita 1, Hideki Ueno 1, Karolina Anna Palucka 1, Jacques Banchereau 1,*, SangKon Oh 1,*
PMCID: PMC2659635  NIHMSID: NIHMS92321  PMID: 19144318

Summary

Mucosal IgA secreted by local plasma cells (PCs) is a critical component of mucosal immunity. Although IgA class switching can occur at mucosal sites, high-affinity PCs are optimally generated in germinal centers (GCs) in a T cell-dependent fashion. However, the mechanism of how CD4+ helper T cells induce mucosal-homing IgA-PCs remains unclear. We show here that TGFβ1 and IL-21, produced by follicular helper T cells (TFH), synergize to generate abundant IgA-plasmablasts (PBs). In the presence of IL-21, TGFβ1 promotes naive B cell proliferation and differentiation, and it overrides IL-21-induced IgG class switching in favor of IgA. Furthermore, in combination with IL-21, TGFβ1 downregulates CXCR5 while upregulating CCR10 on PBs, enabling their exit from GCs and migration towards local mucosa. This is supported by the presence of CCR10+IgA+PBs in tonsil GCs. These findings show that TFH contribute to mucosal IgA. Thus, mucosal vaccines should aim to induce robust TFH responses.

Introduction

Mucosal surfaces are the most frequent port of entry for micro-organisms (Brandtzaeg and Johansen, 2005; Fagarasan and Honjo, 2003). IgA, the predominant antibody isotype in mucosal secretions, is of paramount importance in the immune defense of these surfaces. The main function of IgA is the neutralization of pathogens and toxins without causing inflammation since it does not activate complement (Cerutti, 2008; Fagarasan and Honjo, 2003; Macpherson and Slack, 2007). Unlike IgA1, IgA2 is resistant to bacterial proteases. This makes it of particular importance on mucosal surfaces that are highly colonized by bacteria, such as the lower gastro-intestinal tract (He et al., 2007; Kett et al., 1986).

Mucosal IgA-mediated immunity is dependent on the induction of mucosal homing IgA+ plasma cells (IgA-PCs) that secrete antibodies locally. It is not yet completely understood how the abundant IgA-PCs found in the subepithelial regions, especially in gut mucosa, are generated. Recent reports indicate a central role for microbial signals at the epithelial barrier in T cell-independent (TI) induction of IgA-PCs (Fagarasan et al., 2001; He et al., 2007; Macpherson et al., 2000; Uematsu et al., 2008). These innate TI pathways provide an important first line of protection in the time it takes T-dependent (TD) adaptive responses to develop high affinity antibodies and long-term humoral immunity. TD responses to mucosal antigens take place in germinal centers (GCs) of the mucosa associated lymphoid tissues (Hornquist et al., 1995; Lycke et al., 1987) which promote clonal expansion and affinity maturation (Liu and Arpin, 1997; Manser, 2004). The GC microenvironment allows intimate interactions between B cells, CD4+ helper T cells and antigen presenting cells. CD4+ T cells, in particular follicular helper T cells (TFH) are central for GC formation, providing CD40 Ligand (CD40L) and multiple cytokines, such as IL-2, IL-4, IL-10 and IL-21 (Breitfeld et al., 2000; King et al., 2008; Moser et al., 2002; Vogelzang et al., 2008). These signals promote B cell proliferation, class switch recombination (CSR) and somatic hypermutation, resulting in highly specific, class switched plasma cells and long-lived memory B cells (Liu and Arpin, 1997; MacLennan, 1994). IL-21 particularly induces terminal differentiation of naive B cells and also mediates class switching to IgG1 and IgG3 (Kuchen et al., 2007; Ozaki et al., 2002; Pene et al., 2004). CD4+ T cells are also a source of TGFβ1 (Li et al., 2006), a known IgA class switching factor (Cazac and Roes, 2000; Coffman et al., 1989; Islam et al., 1991). IL-10 and other cytokines augment TGFβ1-mediated IgA class switching (Defrance et al., 1992; Fayette et al., 1997; Islam et al., 1991). However, since TGFβ1 as an immuno-regulatory cytokine, does not support B cell expansion (Kehrl et al., 1991), this does not explain how GCs can generate abundant IgA-PCs.

For migration into local mucosal areas, PCs need to express mucosal homing receptors. Locally produced vitamin derivatives play a role in the induction of mucosal homing receptors on B cells (Mora et al., 2006; Shirakawa et al., 2008). Mora et al. (Mora et al., 2006) demonstrated that vitamin A can induce CCR9 and α4β7 on B cells, which allows their migration towards the small intestine. A recent study (Shirakawa et al., 2008) showed that CCR10, a common mucosal homing marker, can be imprinted on B cells by vitamin D3. These studies indicate that the microenvironment where B cells undergo differentiation can determine their expression of mucosal homing receptors. It is still unclear, however, how CD4+ T cells contribute to the induction of homing receptors on IgA-PCs.

With the aim of establishing novel human vaccines, we studied the role of TFH in the generation of mucosal homing IgA-PCs. We identified IL-21 and TGFβ1 as important TFH derived cytokines that promote the differentiation of naive B cells into IgA-PBs. When combined with IL-21, TGFβ1 furthermore upregulated CCR10 while downregulating CXCR5, which enables migration of the PBs from the GC towards the mucosal surfaces.

Results

TGFβ1 synergizes uniquely with IL-21 to promote naive B cell proliferation and differentiation

In order to identify T cell-dependent factors involved in IgA-PC differentiation, we mimicked the different steps of a TD B cell response in an in vitro culture system. Naive IgD+CD27− B cells were activated with a combination of anti-IgM (to mimic BCR engagement by antigens), CpG (TLR9 engagement by microbial DNA), anti-CD40 and IL-2 (cognate interactions with CD4+ T cells). These activated B cells underwent significant though limited proliferation, as measured by dilution of CFSE (Figure 1A). As expected, IL-21, a known B cell proliferation/differentiation factor (Bryant et al., 2007; King et al., 2008; Kuchen et al., 2007), induced enhanced proliferation of CD40/BCR/TLR9-activated naive B cells. On the other hand, TGFβ1, an IgA-switching factor (Cazac and Roes, 2000; Coffman et al., 1989), slightly inhibited B cell proliferation (Figure 1A), which is in line with previous reports (Li et al., 2006; Kehrl et al., 1991). Strikingly, when combined with IL-21, TGFβ1 resulted in considerably enhanced B cell proliferation. The majority (≈70%) of cells proliferating with IL-21 and TGFβ1 underwent more than five cycles of cell division, while less than 20% of the cells did in response to IL-21 alone (Figure 1A). Both IL-21R and TGFβRII were upregulated by anti-CD40, anti-BCR, and CpG stimulation (Figure S1).

Figure 1. TGFβ1 synergizes with IL-21 to promote naive B cell proliferation and differentiation.

Figure 1

CFSE-labeled naive B cells were activated with anti-IgM, and then cultured with the indicated cytokines in the presence of anti-CD40, CpG and IL-2. (A) Proliferation was measured by CFSE dilution on day 6. Data presented is one out of six independent experiments showing similar results. (B) Cell cycle analysis was performed using a DNA binding dye on different time points of culture. The proportion of cells in G2+S phase, representing dividing cells are shown for B cells cultured in the indicated conditions. (C) Expression of differentiation markers on day 6 as determined by flow cytometry. (D) The number of CD38+CD20− cells per 1*104 naive B cells input as calculated by (number of cells/1 *104 input)* (%CD38+CD20−) from 8 independent experiments. (E) Total number of cells recovered per 1*104 cells input on day 6.

Cell cycle analysis using a DNA binding dye revealed that naive B cells cultured with IL-21 and TGFβ1 maintained a higher ratio of division over time (Figure 1B). This prolonged division lasted until day six, whereas IL-21-induced B cell division peaked on day two and then decreased steadily. This shows that TGFβ1 prolongs IL-21 induced proliferation of activated naive B cells, allowing the cells to undergo more divisions, as observed in Figure 1A.

Phenotypic analysis showed that a large proportion (30–40%) of the cells cultured with IL-21 and TGFβ1 were CD20−CD38+, a phenotype of plasmablasts/cells, whereas only about 10% of the cells cultured with IL-21 alone were CD20−CD38+ (Figure 1C). The absolute numbers of PBs recovered on day 6 was significantly higher after culture with IL-21 and TGFβ1, when compared to IL-21 or TGFβ1 alone (Figure 1D). The total number of cells recovered on day 6 was comparable between IL-21 alone or IL-21 with TGFβ1 (Figure 1E), suggesting that the combination of IL-21 and TGFβ1 induces enhanced differentiation of naive B cells into PBs. Approximately 25–30% of the cells cultured with IL-21 and TGFβ1 expressed CD27 and CD20 (Figure 1C), reminiscent of a memory B cell phenotype. Of note, we did not observe a similar synergy between TGFβ1 and IL-10 (Defrance et al., 1992; Fayette et al., 1997). When CD40/BCR/TLR9-activated naive B cells were cultured with a combination of TGFβ1 and IL-10 the proliferation was similar to that induced by IL-10 alone (30–40%) (Figure S2A), but lower than that induced by IL-21 or a combination of IL-21 and TGFβ1. The number of PBs induced by IL-10 alone or IL-10 plus TGFβ1 was also not significantly different (Figure S2B). Thus, TGFβ1 synergizes uniquely with IL-21 to promote naive B cell proliferation and PB differentiation.

TGFβ1 skews IL-21 mediated class switching towards IgA1 and IgA2

Naive B cells stimulated through CD40, BCR, and TLR9 expressed low levels of surface IgG (sIgG) and sIgA (Figure 2A). Addition of IL-21 resulted in increased levels of sIgG and sIgA (Figure 2A), as previously described (Kuchen et al., 2007; Ozaki et al., 2002; Pene et al., 2004). The combination of IL-21 and TGFβ1 considerably increased the frequency of sIgA+ B cells (mean 22%), while it decreased sIgG+ B cells (mean 2.5%). Surface IgA induced by IL-21 and TGFβ1 consisted of both IgA1 (mean 17%) and IgA2 (mean 4%), while IL-21 alone induced only sIgA1+ B cells (Figure 2B).

Figure 2. TGFβ1 skews IL-21 mediated class switching towards IgA1 and IgA2.

Figure 2

Naive B cells activated with anti-IgM and anti-CD40 were cultured in the presence of IL-2 and CpG with either IL-21 alone or a combination of IL-21 and TGFβ1. (A, B) On day 6, surface immunoglobulin expression was determined by staining the cells with anti-IgG, IgA, IgA1 and IgA2 antibodies. The left panels show the dot plots. The right panels show the results of multiple experiments with mean. (C, D) On day 12, IgG, IgA, IgA1 and IgA2 secreted in the culture supernatants were measured by ELIS A. (E) IgM secreted in the culture supernatants on day 12 as measured by ELISA.

Activated naive B cells secreted large amounts of IgG (mean 3 μg/ml) and some IgA (mean 1.2 μg/ml) in response to IL-21 alone (Figure 2C). The combination of IL-21 and TGFβ1, however, induced activated naive B cells to secrete high levels of IgA (mean 6 μg/ml), consisting of both IgA1 (mean 4.5μg/ml) and IgA2 (mean 2.0μg/ml), but low amounts of IgG (mean 0.5 μg/ml) (Figures 2C–2D). The amounts of IgM secreted were not different between the different conditions (Figure 2E).

A dose titration of TGFβ1 in naive B cell cultures containing IL-21 showed that the frequency of sIgA1+ and sIgA2+ B cells correlated with TGFβ1 concentration, while the frequency of sIgG+ cells was inversely related to the TGFβ1 dose (Figure 3). Increasing the dose of IL-21 did not affect the proportion of IgA+ cells (Data not shown).

Figure 3. Surface IgA expression is directly related to TGFβ1 concentration.

Figure 3

Naive B cells were activated with anti-IgM, anti-CD40 and CpG and cultured with 20 ng/mL IL-21 and increasing concentrations of TGFβ1. Surface immunoglobulin expression was determined on day 6. Average ±SEM of 3 independent experiments is shown.

The combination of IL-10 with TGFβ1, as previously described (Defrance et al., 1992; Fayette et al., 1997), could also induce sIgA+ B cells (Figure S2C), including IgA1 and IgA2, but to a lower extent compared to IL-21 with TGFβ1. In line with the lower frequency of PBs induced by IL-10 plus TGFβ (Figure S2B), the levels of IgA secretion were relatively low in those cultures (Figure S2D).

To confirm the induction of isotype switching, we measured expression levels of activation-induced cytidine deaminase (AICDA=AID gene), circle transcripts, germline transcripts, and mature transcripts, as illustrated in Figure S3. Quantitative real time RT-PCR data show that activated naive B cells cultured with IL-21 alone or a combination of IL-21 and TGFβ1 upregulated AID (Figure 4A), a hallmark of cells undergoing active class switching (Muramatsu et al., 2000). Figure 4B shows that IL-21 upregulated Iγ3-Cγ3 germline transcription, confirming its role as an IgG3 switch factor (Ozaki et al., 2002; Pene et al., 2004). In addition, IL-21 also moderately increased Iα1-Cα1 and Iα2-Cα2 germline transcription. However, the combination of IL-21 and TGFβ1 more strongly upregulated the transcription of both Iα1-Cα1 and Iα2-Cα2 germlines. On the other hand, B cells cultured with IL-21 alone expressed increased Iγ-Cμ. but not Iα-Cμ switch circle transcripts, while B cells cultured with the combination of IL-21 and TGFβ1 expressed more Iα-Cμ, circle transcripts (Figure 4C). Consistently, IL-21 upregulated VHDJH-CHγ and VHDJH-CHα1 mature transcripts, whereas IL-21 and TGFβ1 together induced increased levels of both VHDJH-CHα1 and -α2 transcripts (Figure 4D). B cells cultured with TGFβ1 alone showed upregulation of both α germlines but not AID, which explains the absence of Iα-Cμ, circle transcripts and mature VHDJH-CHα transcripts (Figure 4A, B, C).

Figure 4. Molecular events in IL-21/TGFβ1 induced IgA class switching.

Figure 4

CD40/BCR/TLR9-activated naive B cells cultured with the indicated cytokines were harvested on day 4. mRNA was isolated and cDNA synthesized. Real time RT-PCR was performed for activation-induced cytidine deaminase (AICDA) (A), germline transcripts Iγ3-Cγ3, Iαγ-Cα1 and Iα-Cα2 (B) and switch circle transcripts Iγ-Cμ. and Iα-Cμ (C). The expression levels of AICDA, Iγ3-Cγ3, Iα1-Cα1 and Iα2-Cα2 were normalized to ACTB expression. Iγ-Cμ, and Iα-μ expression was normalized to Iμ-Cμ expression (He et al., 2007). Below C, agarose gel-electrophoresis of RT-PCR amplified Iγ-Cμ and Iα-μ transcipts compared to Iμ-Cμ, (loading control). Data shown are mean ± SEM of three independent experiments using cells from three different healthy donors. (D) Conventional RT-PCR was used to detect mature Ig transcripts. One out of three similar results is shown. *, P<0.05; **, P<0.01; ***, P<.001.

Taken together, our data indicate that IL-21 alone induces mainly IgG class switching, while the combination of IL-21 and TGFβ1 strongly skews switching towards IgA1 and IgA2.

In combination with IL-21, TGFβ1 upregulates CCR10 but downregulates CXCR5

For migration into local mucosal areas, PBs need to express appropriate mucosal homing receptors. Remarkably, the combination of IL-21 and TGFβ1 could induce 30–50% of activated naive B cells to express CCR10 (Figure 5A, B). This is a common mucosal homing receptor (Brandtzaeg and Johansen, 2005; Fagarasan and Honjo, 2003; Kunkel et al., 2003; Salmi and Jalkanen, 2005) that allows migration towards most mucosal areas, including the intestinal tract and extra-intestinal mucosal sites (Hieshima et al., 2004; Kunkel et al., 2003). The induced CCR10 was functional as the B cells migrated, in a chemotaxis assay, towards the two CCR10 ligands: CCL28 and CCL27 (Figure 5C). There was no upregulation of CCR9 or α4β7, homing receptors for the small intestine (not shown). Consequently, B cells cultured with IL-21 and TGFβ1 did not migrate in response to CCL25, a ligand for CCR9. The combination of IL-21 and TGFβ1, but neither IL-21 nor TGFβ1 alone, down-regulated CXCR5 (Figure 5A), which mediates migration to and retention in the GCs. Thus, upregulation of CCR10 along with downregulation of CXCR5 by IL-21 and TGFβ1 could allow PBs to migrate out of the GCs en route towards most mucosal sites.

Figure 5. In combination with IL-21, TGFβ1 upregulates CCR10 but downregulates CXCR5.

Figure 5

CD40/BCR/TLR9-activated naive B cells were cultured for 6 days with the indicated cytokines. (A) B cells were stained for CCR10 and CXCR5. Histogram overlays are shown with staining of activated B cells cultured without additional cytokines. Data from one out of eight independent experiments is shown. (B) The average % of CCR10+ ±SEM of eight independent experiments is shown. (C) Chemotaxis assay: On day six of culture, B cells were added to the upper wells of transwells containing the indicated concentrations of CCL25, CCL27 and CCL28 in the lower wells. After 2 hours, the number of cells that migrated into the lower wells was determined with flow cytometry using counting beads. Results shown are the mean of three independent experiments.

Tonsil TFH induce IgA+CCR10+ plasma blasts in an IL-21-dependent manner

To determine whether the above findings made with recombinant cytokines reflected TD responses in GCs, BCR/TLR9-activated naive B cells were cocultured with autologous peripheral blood CXCR5+CD4+follicular helper T cells (TFH) (Breitfeld et al., 2000). TFH cells stimulated with PMA and ionomycin secreted high levels of IL-21 (mean 42ng/mL) compared to CXCR5− T cells (3ng/mL). They also produce more TGFβ1 upon activation (mean 230pg/mL) compared to CXCR5− T cells (150pg/mL) (Figure 6A). Intracellular staining shows that all T cells producing IL-21 also make TGFβ1 (Figure 6B). Activated naive B cells proliferated considerably when co-cultured with TFH cells (Figure 6C upper panels). Blocking IL-21 by IL-21R-Fc limited the proliferation beyond five cycles of cell division (Figure 6C lower panels). Only B cells that underwent more than five cycles expressed CD38 and CCR10. Accordingly, blocking IL-21 decreased the frequency of CD38+ and CCR10+ cells. Adding IL-21R-Fc also decreased expression of γ (Iγ-Cμ) as well as α (Iα-Cμ) circle transcripts (Figure 6D, E) and IgA secretion (Figure 6F). IgG secretion could not be determined due to the IgG-Fc domain in the blocking agent. Since TGFβ1 also affects CD4+ T cell development, we could not address the specific effects of TGFβ1 on B cell differentiation by blocking studies. Altogether, CXCR5+CD4+ T cells can stimulate activated naive B cells to become CCR10-expressing IgA-PBs in an IL-21-dependent manner.

Figure 6. Tonsil Tfh induce IgA+CCR10+ plasma blasts in an IL-21-dependent manner.

Figure 6

(A) Sorted peripheral blood CXCR5+ and CXCR5− CD4+ T cells (106/mL) were cultured with PMA + ionomycin. After 48 hours, concentrations of IL-21 and TGFβ1 in the supernatant were measured by Luminex. (B) Total peripheral blood CD4+ T cells were cultured with or without PMA and ionomycin for 20 hours, the last 4 hours in the presence of brefeldin A. Cells were stained for CXCR5, intracellular IL-21 and TGFβ1. Plots shown are gated on CXCR5+ and CXCR5− populations. One out of 2 similar experiments is shown. (C, D, E, F) Naive B cells (5*104) were co-cultured with autologous CXCR5+CD4+ T cells (2*104) in the presence of IL-21R-Fc or control IgGl-Fc. (C) B cell proliferation, CD38 and CCR10 expression were measured on day 8. (D) On day 4, cells were harvested, RNA isolated and cDNA synthesized. Real time RT-PCR was performed for switch circle transcripts Iγ-Cμ, and Iα-Cμ. Expression was normalized to Iμ-Cμ expression. (E) Agarose gel-electrophoresis showing absolute expression levels of Iμ-Cμ, Iγ-Cμ, and Iα-Cμ. (F) On day 8, the supernatants from the cocultures were harvested and IgM and IgA were measured by ELISA. IgA is normalized for IgM secretion by using IgA/IgM ratio.

IgA+CCR10+ cells are present in tonsil GCs

To investigate the presence of CCR10-expressing IgA-PBs in GCs, tonsil sections were stained with anti-IgA and anti-CCR10 antibodies. Figure 7A shows that the majority of IgA+ cells in a GC express CCR10. Figure 7B shows the presence of IgA+ cells in the subepithelial area of the tonsil, that are brighter for CCR10 than the cells found in the GCs. This indicates that after induction in the GCs these IgA+CCR10+ could migrate out of the GCs to populate mucosal surfaces.

Figure 7. IgA+CCR10+ cells are present in tonsil germinal centers.

Figure 7

(A) Fixed frozen tonsil sections were stained with DAPI (Blue), anti-IgA (Green) and anti-CCR10 (Red). The three-color overview picture (10×) shows the presence of IgA+CCR10+ cells in the germinal center (GC). The rectangle indicates the magnified area (40×). (B) Fixed frozen tonsil sections were stained with anti-IgM (Blue), anti-IgA (Green) and anti-CCR10 (Red) showing the presence of IgA+CCR10+ cells in the subepithelial area (Ep) as well as in the GC (10×). (C) Adjacent tonsil sections stained with control antibodies.

Discussion

This study demonstrates that T cell-dependent B cell responses can generate abundant IgA-PBs with mucosal homing properties. We identified TGFβ1 and IL-21 as critical TFH-derived cytokines that synergize on three different levels of B cells development: (1) proliferation and differentiation, (2) IgA class switching and (3) imprinting of homing receptors.

This is the first study that shows a positive effect of TGFβ1 on B cell proliferation and PB differentiation. We found that it prolonged IL-21-induced proliferation and enhanced PB differentiation. The molecular basis of this phenomenon remains to be elucidated. This effect is strictly dependent on the TGFβ1 dose, with an optimal effect between 0.01 and 1 ng/mL. Lower doses do not support proliferation and PB development, whereas higher doses induce apoptosis. Our data support the model by Tangye et al. (Tangye and Hodgkin, 2004), proposing that the likelihood of a B cell to switch to a certain isotype is related to the number of divisions it has undergone. We observed that B cells became IgA+ only after they had undergone 5 divisions or more. Thus the capacity of TGFβ1 to induce IgA class switching could be partly dependent on its ability to drive B cell proliferation in the presence of IL-21.

An extensive body of literature from the 1990’s exists on TD IgA class switching. CD40 ligation is a first essential step for TD IgA switching. This is highlighted by IgA deficiency in mice and patients with defects in CD40 or CD40L (Allen et al., 1993; Kawabe et al., 1994). TGFβ1 cooperates with CD40L to induce IgA switching in vitro (Cerutti et al., 1998; Defrance et al., 1992; Nakamura et al., 1996). In line with that, TGFβ1 responsive elements were identified both in the mouse (Zhang and Derynck, 2000) and human Cα promoters (Pardali et al., 2000). The combination of TGFβ1 with IL-10 in human (Fayette et al., 1997) or LPS in mouse B cells (Coffman et al., 1989) enhances the generation of IgA-PBs. IL-21 was more recently identified as an important TFH derived cytokine promoting B cell proliferation, differentiation (Bryant et al., 2007; Kuchen et al., 2007; Ozaki et al., 2002) and class switching towards IgG1 and IgG3 (Pene et al., 2004). Compared to IL-10 plus TGFβ1, the combination of IL-21 with TGFβ1 showed a more pronounced synergy for generation of IgA PBs. This might be explained by the superior capacity of IL-21 compared to IL-10 to induce AID (M. Dullaers, unpublished observations), needed for class switching, and Blimp-1 (Bryant et al., 2007), essential for PC development. Our observations indicate a dominant role for TGFβ1 in IL-21/TGFβ1-mediated generation of IgA+CCR10+ PBs. Adding TGFβ1 to B cells cultured with IL-21 as much as four days later still resulted in predominant IgA switching and CCR10 upregulation (data not shown). Furthermore, IgA expression was directly related to TGFβ1 but not to IL-21 concentration. However, increased expression of AID and α germline transcripts by IL-21 alone indicate that IL-21 contributes to IgA class-switching. In mice, the importance of IL-21 for IgA CSR is less clear. Ozaki et al. found that specific serum IgA levels after immunization were not much different in IL-21R-KO mice compared to wild type mice, unless they were also deficient for IL-4 (Ozaki et al., 2002). This may reflect an inter-species difference and/or the difference between mucosal and systemic sites of IgA expression. A number of recent studies have provided evidence for the importance of intestinal flora-driven TI IgA class switching in the lower intestinal tract. (Mora et al., 2006; He et al., 2007; Uematsu et al., 2008). The capacity for TI IgA switching may represent a functional specialization in B cells (Cerutti, 2008). Through TI pathways, these B cells can rapidly yield low-affinity poly-reactive antibodies (IgM, IgG and IgA) (Bendelac et al., 2001; Wardemann et al., 2003) that form an important first line of protection against infections. However, these innate antibodies can not completely substitute for antigen-specific high-affinity IgA produced by TD responses in GCs, which also generate memory B cells (McHeyzer-Williams and Ahmed, 1999).

Since mucosal IgA is secreted locally in subepithelial areas, IgA-PCs need to acquire appropriate homing receptors and migrate towards the effector site. CCL28, a ligand for CCR10, is a common mucosal chemo-attractant produced by epithelial cells in the intestinal tract, salivary glands, airways, mammary glands, uterine tract and palatine tonsils (Brandtzaeg and Johansen, 2005; Fagarasan and Honjo, 2003; Kunkel et al., 2003). CCL27, another CCR10 ligand, is produced by epidermal keratinocytes (Reiss et al., 2001). The CCR9 ligand, CCL25, is produced largely in the small intestine (Kunkel et al., 2000). It has been shown that vitamin D (produced locally in the skin) can induce B cells to express CCR10 (Shirakawa et al., 2008) whereas vitamin A (absorbed from food in the small intestine) imprints CCR9 and α4β7 integrin (Mora et al., 2006). We provide here the first evidence that B cell homing capacity can be imprinted by follicular T helper cells. The TFH derived cytokines IL-21 and TGFβ1 induced the concomitant upregulation of CCR10 and downregulation of CXCR5. Together this allows B cells to leave the GCs and migrate towards CCL27 and CCL28 expressing mucosal tissues. The fact that we could find CCR10+IgA+ cells in tonsil GCs supports the imprinting of mucosal homing in a TD fashion.

TGFβ1 is produced in varying levels by TFH and other cells in lymphoid organs, such as stromal cells, DCs and B cells themselves (Li et al., 2006). Thus, IL-21 is likely the critical factor for the generation of large numbers of CCR10 expressing IgA-PBs. Since TFH are the main source of IL-21, we conclude that the induction of potent TFH responses is crucial for a solid IgA-mediated mucosal immunity. Therefore, future vaccines, especially those against mucosal infections, like influenza or HIV, should aim to induce strong antigen specific TFH responses.

Materials and Methods

Cells and cell cultures

Peripheral blood mononuclear cells (PBMC) of healthy volunteers were fractionated by elutriation. B cells were isolated from the lymphocyte-rich fractions using Human B cell Enrichment Set (BD Biosciences, CA). B cells were stained for IgD and CD27 and CD27−IgD+ (naive) and CD27+IgD− (memory) cells were sorted on a FACSAria (BD). The purity of sorted B cells was generally >98%.

Naive B cells were cultured with anti-IgM coated beads for two hours at 4′C (500ng/mL, Immunobead Rabbit Anti-Human IgM; IrvineScientific, CA). Then cells were cultured in complemented RPMI containing 10% FCS at 2×104/200 μL/well in the presence of IL-2 (20 units/mL; R&D Systems, CA), anti-CD40 antibody (500 ng/mL; In House Preparation, clone 12E12) and CpG (50 nM; ODN2006, InVivogen, CA).

Peripheral blood CD4+ T cells were isolated from lymphocyte rich PBMC fractions using EasySep Human CD4+ T cell enrichment kit (StemCell Technologies). For cytokine production, sorted peripheral blood CXCR5+ and CXCR5−CD4+ T cells were cultured at 106/mL in 200 μL in a 96-well U bottom plates with or without PMA (50ng/mL) and ionomycin (1μM). Naive B cells (5×104) were co-cultured with autologous CXCR5+ CD4+ T cells (2×104) in the presence of 20 units/mL IL-2, 50nM CpG and 1μg/mL Staphylococcus enterotoxin B (SEE, Sigma-Aldrich).

Tonsil tissue samples, obtained from patients under 12 years old with tonsillitis, were frozen in OCT for tissue sections.

Reagents and Antibodies

Human recombinant IL-2 (R&D Systems), IL-10 (Peprotech, NJ) and IL-21 (R&D Systems) were used at 20 units/mL, 20 ng/mL and 20 ng/mL, respectively. Human recombinant TGFβ1 (R&D Systems) was used at 0.5 ng/mL or as indicated.

The following fluorochrome labeled antibodies were used for flow cytometry and FACS sorting: anti-CD 19, anti-CD27, anti-CD38 and anti-CD20 (BD BioSciences) and anti-CXCR5 (R&D Systems); anti-Human IgD, IgM, IgG, IgA, IgA1 and IgA2 (Southern Biotech, AL); anti-Human CCR4, CCR6, CCR7, CCR9, CCR10, CXCR4, CXCR5, anti-TGFβRecII and anti-IL-21Rec (R&D Systems). Intracellular staining of CD4+ T cells were performed using PermFix and PermWash (BD Biosciences) and anti-IL-21-AlexaFluor647 (eBioscience) and anti-TGFβ1-PE (R&D Systems).

IL-21R-Fc and IgG1-Fc control (both R&D Systems) were used to block IL-21 in naive B/CD4 cocultures.

ELISAs

Sandwich ELISAs were performed to measure total IgM, IgG, IgA, IgA1 and IgA2 in the culture supernatant. Capturing and detection antibodies were purchased from Southern Biotech (AL). Human reference serum (Bethyl, TX) containing known amounts of the different immunoglobulin isotypes was used as a standard.

Proliferation and Cell Cycle Analysis

Cells were labeled with CFSE (Molecular Probes, CA) and proliferation was monitored by measuring CFSE dilution on a FACSCalibur. Cell cycle analysis was performed using the DNA binding dye Vybrant DyeCycle Orange according to the manufacturer’s instructions (Molecular Probes). The resulting histogram allows for the identification of the different phases of the cell cycle: G0/G1 (one set of paired chromosomes per cell), S (DNA synthesis with variable amount of DNA), G2/M (two sets of paired chromosomes, prior to cell division) and sub-G1 (DNA in digestion, apoptotic cells).

Chemotaxis/Migration Assay

Chemotaxis assays were performed with B cells on day 6 after stimulation. Transwell inserts (5 μM pores, Corning Costar, MA) containing 2 to 5 × 105 B cells in 100 μL were placed in the wells of 24-well plates in contact with 600 μL medium (complemented RPMI + 0.5% BSA) containing the indicated concentration of chemokines. CCL25 (CCR9 ligand), CCL27 and CCL28 (both CCR10 ligands) were purchased from Peprotech. The cells were left to migrate at 37°C for 2 hours and subsequently enumerated using Invitrogen Countbright Beads on a FacsCalibur.

Conventional and quantitative Real-time PCRs

RNA was isolated from stimulated B cells on day 4 using Trizol (Invitrogen) and cDNA was synthesized with Reverse Transcription System (Promega, CA). Conventional RT-PCR was performed for mature immunoglobulin transcripts VHDJH-CH μVHDJH-CHγVHDJH-CHα1 and VHDJH-CHα2 using the following primers:

  • Framework 3 (FR3) forward GACACGGCTGTGTATTACTGTGCG,

  • CHμ reverse CCGAATTCAGACGAGGGGGAAAAGGGTT,

  • CHγ reverse TTGTGTCACCAAGTGGGGTTTTGAGC,

  • CHα1 reverse GGGTGGCGGTTAGCGGGGTCTTGG and

  • CHα2 reverse TGTTGGCGGTTAGTGGGGTCTTGCA.

Germ line transcripts Iγ3-Cγ3, Iα1-Cα1, Iα2-Cα2 and switch circle transcripts Iμ-Cμ, Iγ-Cμ, Iα-Cμ and AICDA (AID gene) were quantified through real-time RT-PCR using the following primers:

  • Iγ3 forward GCCATGGGGTGATGCCAGGATGGGCAT,

  • Cγ3 reverse GAAGACCGATGGGCCCTTGGTGGA,

  • Iα2 forward CTCAGCACTGCGGGCCCTCCA,

  • Cα2 reverse GTTCCCATCTTGGGGGGTGCTGTC,

  • Iα1 forward CTCAGCACTGCGGGCCCTCCA,

  • Cα1 reverse GTTCCCATCTGGCTGGGTGCTGCA,

  • Iμ forward GTGATTAAGGAGAAACACTTTGAT,

  • Cμ, reverse AGACGAGGGGGAAAAGGGTT,

  • Iγ forward GGGCTTCCAAGCCAACAGGGCAGGACA,

  • Iα forward CAGCAGCCCTCTTGGCAGGCAGCCAG,

  • AICDA forward: AGAGGCGTGACAGTGCTACA,

  • AICDA reverse: TGTAGCGGAGGAAGAGCAAT.

Real time RT-PCR was performed on a Lightcycler 480 machine (Roche Applied Bioscience) using SYBR Green master mix (Roche). Iγ3-Cγ3, Iα1-Cα1 and Iα2-Cα2 expression were normalized to the amount of ACTB (β-actin) mRNA and Iγ-Cμ and Iα-Cμ were normalized to Iμ-Cμ expression. The relative expression (RE) of a target gene was calculated using the following formula: REn= 2−(ΔCtn−ΔCt1), where ΔCtn (change in cycle threshold) is the cycle threshold of the test gene minus the cycle threshold of the reference gene (ACTB or Iμ-Cμ); n is a specific sample and 1 is the non-treatment sample. Switch circle transcript Iμ-Cμ, Iγ-Cμ, and Iα-Cμ, PCR products were run on an agarose gel to confirm up/down regulation.

Cytokine Multiplex Analysis

Cell culture supernatants were analyzed for TGF-β1 using the BeadLyte cytokine assay kit (Upstate) as per manufacturer’s protocol. Anti-IL-21 capture and detector antibodies were generated by the Hybridoma core facility at BIIR. Levels of IL-21 were measured using an anti-IL-21 capture antibody conjugated to seroMAP beads (Luminex Corp. Austin TX) and detected using a second biotinylated anti-IL-21 antibody according to the manufacturer’s protocol. Fluorescence was analyzed with a Bio-Plex Luminex 100 XYP instrument and cytokine concentrations were calculated using Bio-Plex Manager 4.1 software with a 5 parameter curve fitting algorithm applied for standard curve calculations.

Tissue Sections and Immunofluorescence

Frozen tissue was cut into 6 μm thick sections that were fixed with paraformaldehyde before staining. The following antibodies were used for staining: rabbit-anti-human CCR10 (Imgenex, CA), goat-anti-rabbit IgG-AF568 (Molecular Probes, CA), goat-anti-human IgM-FITC and goat-anti-human IgA-AF647 (In house conjugation with Molecular Probes Alexa Fluor kit) both from Southern Biotech. DAPI (Molecular Probes) was used to counter stain the nuclei. Slides were analyzed with an Olympus BX51 microscope using Metamorph 6 software (Universal Imaging Corporation).

Statistical Analysis

All bar graphs represent mean ±SEM. Data were analyzed using GraphPad Prism 4 software. The significance of difference between experimental variables was determined using the Student’s t-test and significance was set at P<0.05.

Supplementary Material

01

Acknowledgments

We thank Elizabeth Kowalski and Sebastien Coquery in the FACS Core at BIIR and Dan Su in the Tissue Bank at Baylor hospital. We thank Dr. Warren Leonard (NIH) and Dr. Jason Skinner (BIIR) for critical reading of this manuscript. We also thank Drs. Michael Ramsay and William Duncan for supporting this study. This study was supported by a pilot project (SO) in U19 AI057234 (JB), RO1CA78846 (JB), and BHCS Foundation (SO & JB).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Allen RC, Armitage RJ, Conley ME, Rosenblatt H, Jenkins NA, Copeland NG, Bedell MA, Edelhoff S, Disteche CM, Simoneaux OK, et al. CD40 ligand gene defects responsible for X-linked hyper-IgM syndrome. Science. 1993;259:990–993. doi: 10.1126/science.7679801. [DOI] [PubMed] [Google Scholar]
  2. Avery DT, Bryant VL, Ma CS, de Waal Malefyt R, Tangye SG. IL-21-induced isotype switching to IgG and IgA by human naive B cells is differentially regulated by IL-4. J Immunol. 2008;181:1767–1779. doi: 10.4049/jimmunol.181.3.1767. [DOI] [PubMed] [Google Scholar]
  3. Bendelac A, Bonneville M, Kearney JF. Autoreactivity by design: innate B and T lymphocytes. Nat Rev Immunol. 2001;1:177–186. doi: 10.1038/35105052. [DOI] [PubMed] [Google Scholar]
  4. Brandtzaeg P, Johansen FE. Mucosal B cells: phenotypic characteristics, transcriptional regulation, and homing properties. Immunol Rev. 2005;206:32–63. doi: 10.1111/j.0105-2896.2005.00283.x. [DOI] [PubMed] [Google Scholar]
  5. Breitfeld D, Ohl L, Kremmer E, Ellwart J, Sallusto F, Lipp M, Forster R. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J Exp Med. 2000;192:1545–1552. doi: 10.1084/jem.192.11.1545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bryant VL, Ma CS, Avery DT, Li Y, Good KL, Corcoran LM, de Waal Malefyt R, Tangye SG. Cytokine-mediated regulation of human B cell differentiation into Ig-secreting cells: predominant role of IL-21 produced by CXCR5+ T follicular helper cells. J Immunol. 2007;179:8180–8190. doi: 10.4049/jimmunol.179.12.8180. [DOI] [PubMed] [Google Scholar]
  7. Cazac BB, Roes J. TGF-beta receptor controls B cell responsiveness and induction of IgA in vivo. Immunity. 2000;13:443–451. doi: 10.1016/s1074-7613(00)00044-3. [DOI] [PubMed] [Google Scholar]
  8. Cerutti A. The regulation of IgA class switching. Nat Rev Immunol. 2008;8:421–434. doi: 10.1038/nri2322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cerutti A, Zan H, Schaffer A, Bergsagel L, Harindranath N, Max EE, Casali P. CD40 ligand and appropriate cytokines induce switching to IgG, IgA, and IgE and coordinated germinal center and plasmacytoid phenotypic differentiation in a human monoclonal IgM+IgD+ B cell line. J Immunol. 1998;160:2145–2157. [PMC free article] [PubMed] [Google Scholar]
  10. Coffman RL, Lebman DA, Shrader B. Transforming growth factor beta specifically enhances IgA production by lipopolysaccharide-stimulated murine B lymphocytes. J Exp Med. 1989;170:1039–1044. doi: 10.1084/jem.170.3.1039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Defrance T, Vanbervliet B, Briere F, Durand I, Rousset F, Banchereau J. Interleukin 10 and transforming growth factor beta cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J Exp Med. 1992;175:671–682. doi: 10.1084/jem.175.3.671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fagarasan S, Honjo T. Intestinal IgA synthesis: regulation of front-line body defences. Nat Rev Immunol. 2003;3:63–72. doi: 10.1038/nri982. [DOI] [PubMed] [Google Scholar]
  13. Fagarasan S, Kinoshita K, Muramatsu M, Ikuta K, Honjo T. In situ class switching and differentiation to IgA-producing cells in the gut lamina propria. Nature. 2001;413:639–643. doi: 10.1038/35098100. [DOI] [PubMed] [Google Scholar]
  14. Fayette J, Dubois B, Vandenabeele S, Bridon JM, Vanbervliet B, Durand I, Banchereau J, Caux C, Briere F. Human dendritic cells skew isotype switching of CD40-activated naive B cells towards IgA1 and IgA2. J Exp Med. 1997;185:1909–1918. doi: 10.1084/jem.185.11.1909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. He B, Xu W, Santini PA, Polydorides AD, Chiu A, Estrella J, Shan M, Chadburn A, Villanacci V, Plebani A, et al. Intestinal bacteria trigger T cell-independent immunoglobulin A(2) class switching by inducing epithelial-cell secretion of the cytokine APRIL. Immunity. 2007;26:812–826. doi: 10.1016/j.immuni.2007.04.014. [DOI] [PubMed] [Google Scholar]
  16. Hieshima K, Kawasaki Y, Hanamoto H, Nakayama T, Nagakubo D, Kanamaru A, Yoshie O. CC chemokine ligands 25 and 28 play essential roles in intestinal extravasation of IgA antibody-secreting cells. J Immunol. 2004;173:3668–3675. doi: 10.4049/jimmunol.173.6.3668. [DOI] [PubMed] [Google Scholar]
  17. Hornquist CE, Ekman L, Grdic KD, Schon K, Lycke NY. Paradoxical IgA immunity in CD4-deficient mice. Lack of cholera toxin-specific protective immunity despite normal gut mucosal IgA differentiation. J Immunol. 1995;155:2877–2887. [PubMed] [Google Scholar]
  18. Islam KB, Nilsson L, Sideras P, Hammarstrom L, Smith CI. TGF-beta 1 induces germ-line transcripts of both IgA subclasses in human B lymphocytes. Int Immunol. 1991;3:1099–1106. doi: 10.1093/intimm/3.11.1099. [DOI] [PubMed] [Google Scholar]
  19. Kawabe T, Naka T, Yoshida K, Tanaka T, Fujiwara H, Suematsu S, Yoshida N, Kishimoto T, Kikutani H. The immune responses in CD40-deficient mice: impaired immunoglobulin class switching and germinal center formation. Immunity. 1994;1:167–178. doi: 10.1016/1074-7613(94)90095-7. [DOI] [PubMed] [Google Scholar]
  20. Kehrl JH, Thevenin C, Rieckmann P, Fauci AS. Transforming growth factor-beta suppresses human B lymphocyte Ig production by inhibiting synthesis and the switch from the membrane form to the secreted form of Ig mRNA. J Immunol. 1991;146:4016–4023. [PubMed] [Google Scholar]
  21. Kett K, Brandtzaeg P, Radl J, Haaijman JJ. Different subclass distribution of IgA-producing cells in human lymphoid organs and various secretory tissues. J Immunol. 1986;136:3631–3635. [PubMed] [Google Scholar]
  22. King C, Tangye SG, Mackay CR. T Follicular Helper (T(FH)) Cells in Normal and Dysregulated Immune Responses. Annu Rev Immunol. 2008 doi: 10.1146/annurev.immunol.26.021607.090344. [DOI] [PubMed] [Google Scholar]
  23. Kuchen S, Robbins R, Sims GP, Sheng C, Phillips TM, Lipsky PE, Ettinger R. Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 2007;179:5886–5896. doi: 10.4049/jimmunol.179.9.5886. [DOI] [PubMed] [Google Scholar]
  24. Kunkel EJ, Campbell JJ, Haraldsen G, Pan J, Boisvert J, Roberts AI, Ebert EG, Vierra MA, Goodman SB, Genovese MC, et al. Lymphocyte CC chemokine receptor 9 and epithelial thymus-expressed chemokine (TECK) expression distinguish the small intestinal immune compartment: Epithelial expression of tissue-specific chemokines as an organizing principle in regional immunity. J Exp Med. 2000;192:761–68. doi: 10.1084/jem.192.5.761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kunkel EJ, Kim CH, Lazarus NH, Vierra MA, Soler D, Bowman EP, Butcher EG. CCR10 expression is a common feature of circulating and mucosal epithelial tissue IgA Ab-secreting cells. J Clin Invest. 2003;111:1001–1010. doi: 10.1172/JCI17244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA. Transforming growth factor-beta regulation of immune responses. Annu Rev Immunol. 2006;24:99–146. doi: 10.1146/annurev.immunol.24.021605.090737. [DOI] [PubMed] [Google Scholar]
  27. Liu YJ, Arpin C. Germinal center development. Immunol Rev. 1997;156:111–126. doi: 10.1111/j.1600-065x.1997.tb00963.x. [DOI] [PubMed] [Google Scholar]
  28. Lycke N, Eriksen L, Holmgren J. Protection against cholera toxin after oral immunization is thymus-dependent and associated with intestinal production of neutralizing IgA antitoxin. Scand J Immunol. 1987;25:413–419. doi: 10.1111/j.1365-3083.1987.tb02208.x. [DOI] [PubMed] [Google Scholar]
  29. MacLennan IC. Germinal centers. Annu Rev Immunol. 1994;12:117–139. doi: 10.1146/annurev.iy.12.040194.001001. [DOI] [PubMed] [Google Scholar]
  30. Macpherson AJ, Gatto D, Sainsbury E, Harriman GR, Hengartner H, Zinkernagel RM. A primitive T cell-independent mechanism of intestinal mucosal IgA responses to commensal bacteria. Science. 2000;288:2222–2226. doi: 10.1126/science.288.5474.2222. [DOI] [PubMed] [Google Scholar]
  31. Macpherson AJ, Slack E. The functional interactions of commensal bacteria with intestinal secretory IgA. Curr Opin Gastroenterol. 2007;23:673–678. doi: 10.1097/MOG.0b013e3282f0d012. [DOI] [PubMed] [Google Scholar]
  32. Manser T. Textbook germinal centers? J Immunol. 2004;172:3369–3375. doi: 10.4049/jimmunol.172.6.3369. [DOI] [PubMed] [Google Scholar]
  33. McHeyzer-Williams MG, Ahmed R. B cell memory and the long-lived plasma cell. Curr Opin Immunol. 1999;11:172–179. doi: 10.1016/s0952-7915(99)80029-6. [DOI] [PubMed] [Google Scholar]
  34. Mora JR, Iwata M, Eksteen B, Song SY, Junt T, Senman B, Otipoby KL, Yokota A, Takeuchi H, Ricciardi-Castagnoli P, et al. Generation of guthoming IgA-secreting B cells by intestinal dendritic cells. Science. 2006;314:1157–1160. doi: 10.1126/science.1132742. [DOI] [PubMed] [Google Scholar]
  35. Moser B, Schaerli P, Loetscher P. CXCR5(+) T cells: follicular homing takes center stage in T-helper-cell responses. Trends Immunol. 2002;23:250–254. doi: 10.1016/s1471-4906(02)02218-4. [DOI] [PubMed] [Google Scholar]
  36. Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (ADD), a potential RNA editing enzyme. Cell. 2000;102:553–563. doi: 10.1016/s0092-8674(00)00078-7. [DOI] [PubMed] [Google Scholar]
  37. Nakamura M, Kondo S, Sugai M, Nazarea M, Imamura S, Honjo T. High frequency class switching of an IgM+ B lymphoma clone CH12F3 to IgA+ cells. Int Immunol. 1996;8:193–201. doi: 10.1093/intimm/8.2.193. [DOI] [PubMed] [Google Scholar]
  38. Ozaki K, Spolski R, Feng CG, Qi CF, Cheng I, Sher A, Morse HC, 3rd, Liu C, Schwartzberg PL, Leonard WJ. A critical role for IL-21 in regulating immunoglobulin production. Science. 2002;298:1630–1634. doi: 10.1126/science.1077002. [DOI] [PubMed] [Google Scholar]
  39. Pardali E, Xie XQ, Tsapogas P, Itoh S, Arvanitidis K, Heldin CH, ten Dijke P, Grundstrom T, Sideras P. Smad and AML proteins synergistically confer transforming growth factor betal responsiveness to human germ-line IgA genes. J Biol Chem. 2000;275:3552–3560. doi: 10.1074/jbc.275.5.3552. [DOI] [PubMed] [Google Scholar]
  40. Pene J, Gauchat JF, Lecart S, Drouet E, Guglielmi P, Boulay V, Delwail A, Foster D, Lecron JC, Yssel H. Cutting edge: IL-21 is a switch factor for the production of IgG1 and IgG3 by human B cells. J Immunol. 2004;172:5154–5157. doi: 10.4049/jimmunol.172.9.5154. [DOI] [PubMed] [Google Scholar]
  41. Reiss Y, Proudfoot AE, Power CA, Campbell JJ, Butcher EC. CC chemokine receptor (CCR)4 and the CCR10 ligand cutaneous T cell-attracting chemokine (CTACK) in lymphocyte trafficking to inflamed skin. J Exp Med. 2001;194:1541–1547. doi: 10.1084/jem.194.10.1541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Salmi M, Jalkanen S. Lymphocyte homing to the gut: attraction, adhesion, and commitment. Immunol Rev. 2005;206:100–113. doi: 10.1111/j.0105-2896.2005.00285.x. [DOI] [PubMed] [Google Scholar]
  43. Shirakawa AK, Nagakubo D, Hieshima K, Nakayama T, Jin Z, Yoshie O. 1,25-Dihydroxyvitamin D3 Induces CCR10 Expression in Terminally Differentiating Human B Cells. J Immunol. 2008;180:2786–2795. doi: 10.4049/jimmunol.180.5.2786. [DOI] [PubMed] [Google Scholar]
  44. Tangye SG, Hodgkin PD. Divide and conquer: the importance of cell division in regulating B-cell responses. Immunology. 2004;112:509–520. doi: 10.1111/j.1365-2567.2004.01950.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Uematsu S, Fujimoto K, Jang MH, Yang EG, Jung YJ, Nishiyama M, Sato S, Tsujimura T, Yamamoto M, Yokota Y, et al. Regulation of humoral and cellular gut immunity by lamina propria dendritic cells expressing Toll-like receptor 5. Nat Immunol. 2008;9:769–776. doi: 10.1038/ni.1622. [DOI] [PubMed] [Google Scholar]
  46. Vogelzang A, McGuire HM, Yu D, Sprent J, Mackay CR, King C. A Fundamental Role for Interleukin-21 in the Generation of T Follicular Helper Cells. Immunity. 2008 doi: 10.1016/j.immuni.2008.06.001. [DOI] [PubMed] [Google Scholar]
  47. Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. Predominant autoantibody production by early human B cell precursors. Science. 2003;301:1374–1377. doi: 10.1126/science.1086907. [DOI] [PubMed] [Google Scholar]
  48. Zhang Y, Derynck R. Transcriptional regulation of the transforming growth factor-beta -inducible mouse germ line Ig alpha constant region gene by functional cooperation of Smad, CREB, and AML family members. J Biol Chem. 2000;275:16979–16985. doi: 10.1074/jbc.M001526200. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

RESOURCES