Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Nov 1.
Published in final edited form as: Mech Dev. 2008 Aug 28;125(11-12):1009–1019. doi: 10.1016/j.mod.2008.08.003

Transcription rate of noncoding roX1 RNA controls local spreading of the Drosophila MSL chromatin remodeling complex

Richard L Kelley 1,2,3,5, Ok-Kyung Lee 1,4, Yoon-Kyung Shim 1
PMCID: PMC2659721  NIHMSID: NIHMS88944  PMID: 18793722

Abstract

The dosage compensation complex in Drosophila is composed of at least five MSL proteins and two noncoding roX RNAs that bind hundreds of sites along the single male X chromosome. The roX RNAs are transcribed from X-linked genes and their RNA products “paint” the male X. The roX RNAs and bound MSL proteins can spread in cis from sites of roX transcription, but the mechanism controlling spreading is unknown. Here we find that cis spreading from autosomal roX1 transgenes is coupled to the level of roX transcription. Low to moderate transcription favors, and vigorous transcription abolishes local spreading. We constructed a roX1 minigene one third the size of wild type as a starting point for mutagenesis. This allowed us to test which evolutionarily conserved motifs were required for activity. One short repeat element shared between roX1 and roX2 was found to be particularly important. When all copies were deleted, the RNA was inactive and unstable, while extra copies seem to promote local spreading of the MSL complex from sites of roX1 synthesis. We propose that assembly of the MSL proteins onto the extreme 3′region of elongating roX1 transcripts determines whether the MSL complex spreads in cis.

Keywords: MSL complex, dosage compensation, spreading, roX RNA, Drosophila

Introduction

Altered chromatin architecture is thought to sometimes spread along a chromosome causing epigenetic changes to the genes located in the affected region (Wutz 2003; Talbert and Henikoff 2006; Schuettengruber et al. 2007; Wakimoto, 1997). The mechanism of spreading chromatin modifications over short (kb) distances has been well worked out in the case of yeast mating type silencing (Moazed et al. 2004). However, less is known about how different chromatin states are propagated in cis over large (Mbp) domains. In a few cases noncoding RNAs have been implicated to play a poorly understood role in chromatin modifications (Brown et al. 1992; Sleutels et al. 2002; Verdel et al. 2004). The MSL (male-specific lethal) dosage compensation complex in Drosophila displays the ability to spread along a chromosome under certain conditions. The MSL complex binds to hundreds of sites along the single male X chromosome where it directs site-specific acetylation of the histone tails of nucleosomes (Bone et al. 1994; Smith et al. 2000). This causes an approximately two-fold hypertranscription of most X-linked genes to match the output from the two X chromosomes in females (Belote and Lucchesi 1980; Hamada et al. 2005; Straub et al. 2005). In addition to the MSL proteins, the dosage compensation complex contains noncoding roX RNAs (Amrein and Axel 1997; Meller et al. 1997). The two roX genes are located on the X and their RNA products paint the X in the same pattern as the MSL proteins (Meller et al. 2000). When both roX genes are deleted from the X, males die because of failed dosage compensation (Deng and Meller 2006). Male viability can be restored by providing roX RNA from an autosomal transgene demonstrating that the MSL complex can locate the X in trans (Meller and Rattner 2002). This shows that sites of roX RNA synthesis cannot be the primary MSL targeting factor on the X chromosome. However, in addition to painting the X, the MSL complex in these males also spreads ectopically from sites of autosomal roX transcription (Park et al. 2002; Oh et al. 2003). This suggests that roX RNA transcription can nucleate MSL binding to the neighboring genes. Such spreading can extend from a transgenic autosome to its synapsed homolog lacking a roX gene arguing against a strictly processive spreading mechanism (Kelley et al. 1999). The MSL banding pattern along the male X is clearly discontinuous at the level of polytene chromosomes, consistent with recent findings that the MSL complex binds to the entire body of actively transcribed genes, but very little MSL complex is found at silent genes or intergenic regions of the X (Smith et al. 2001; Alekseyenko et al. 2006; Gilfillan et al. 2006). When the MSL complex spreads from ectopic autosomal sites of roX RNA synthesis, precisely the same pattern of MSL binding is seen over transcriptionally active genes arguing that this occurs by a mechanism similar to what happens on the X (Larschan et al. 2007).

The two roX RNAs differ greatly in size (3.7 kb vs. 600 nt) and share very little primary sequence similarity (Amrein and Axel 1997; Franke and Baker 1999). Despite these gross differences, they are functionally interchangeable (Meller and Rattner 2002). Recent evolutionary analysis has pointed to short repeated elements at the 3′ ends of roX1 and roX2 regulating the histone acetyltransferase activity of the MSL complex (Park et al. 2007).

Except during early embryogenesis, the roX RNAs are rapidly degraded in the absence of MSL proteins (Meller et al. 2000, Meller, 2003) suggesting that assembly into MSL complexes stabilizes the RNA. There is some reason to suspect that assembly might begin on nascent roX transcripts as they emerge from RNA polymerase. These ideas have lead to a model postulating that local spreading of the MSL complex is controlled by the efficiency of protein subunit assembly onto nascent roX transcripts (Oh et al. 2003). Here we tested this model and found that local spreading is highly sensitive to the rate at which roX RNA is transcribed. We also found that a roX1 minigene only one third the normal size retains function, but apparently removes redundant elements so that deletion analysis within the minigene reveals clear phenotypes. This allowed us to identify short sequence motifs at the extreme 3′ end of roX1 that are essential to MSL function and seem to promote local spreading.

Results

Altering rates of roX1 transcription controls local MSL spreading

The idea that a high ratio of MSL protein subunits to roX RNA promotes local spreading from sites of roX transcription arose from experiments where the level of MSL subunits or the number of roX genes was altered (Park et al. 2002; Oh et al. 2003). We asked whether the rate of roX transcription might also affect local spreading. We noticed a large difference in the cis spreading behavior of two different roX1 transgenes. GMroX1 carries the complete roX1 gene transcribed from its native promoter and supports robust local spreading when placed on an autosome (Kelley et al. 1999; Park et al. 2002). By contrast, H83roX1 does not support local spreading (Fig. 1A B). It is composed of a nearly full-length 3.4 kb roX1 cDNA transcribed from a strong, constitutive hsp83 promoter (Meller et al. 2000; Stuckenholz et al. 2003). The starkly different spreading behaviors of these two transgenes might be due to sequences at the 5′ end of roX1 RNA, splicing of the tiny intron, a tightly linked spreading initiation site outside the transcription unit, differences between the roX1 and hsp83 promoters, or chance juxtaposition with novel sequences flanking the transgene insertion sites.

Figure 1.

Figure 1

Local spreading does not require sequences outside the roX1 transcription unit. A. The GMroX1 transgene carries 4.9 kb of genomic DNA including the native roX1 promoter. This transgene supports robust local MSL spreading when inserted on autosomes (Park et al. 2002). The H83roX1 transgene is a 3.4 kb cDNA transcribed by the hsp83 promoter (black box) (Stuckenholz et al. 2003). The UASroX1 transgene carries the same 3.4 kb roX1 cDNA transcribed from the UAS promoter (blue box). B. Polytene chromosomes from transgenic roX1 roX2 double mutant males were stained with anti-MSL1 antibodies (red) and DAPI (blue). The arrow indicates the location of the autosomal transgene and “X” indicates the X chromosome. Abundant roX1 transcription from H83roX1-87B restores MSL complex to the X chromosome and male viability, but does not support local MSL spreading around the autosomal transgenes (arrow). C. When the same roX1 cDNA is transcribed from UASroX1-29A, insufficient MSL complex is produce to paint the X chromosome leading to a collapsed morphology and weak MSL1 staining. However, small amount of MSL complex produce preferentially spreads > 1Mb along the autosome from the sites of roX1 transcription.

We tested these possibilities by moving the roX1 cDNA into a plasmid where it is transcribed from a minimal promoter linked to UAS binding sites for the yeast GAL4 transcription factor (Fig. 1A) (Brand and Perrimon 1993). Males carrying this UASroX1 construct at random autosomal sites were crossed to roX1 roX2 double mutant females (Meller and Rattner 2002) so that the only source of roX RNA for the sons came from the UASroX1 transgenes. All such males had poor viability suggesting that the amount of roX RNA produced was inadequate to support dosage compensation (Table 1). When the polytene chromosomes of these dying males were examined, the X chromosome had a collapsed morphology and very low levels of MSL proteins bound (Fig. 1C) similar to that seen in roX1 roX2 double mutants (Meller and Rattner 2002). However, the autosomal region around the transgene insertion site (within 1-2 Mbp) was heavily coated with MSL complex in all nuclei (Fig. 1C). The same result was obtained for thirteen different insertion sites assayed (data not shown). This demonstrated that no sequence outside the roX1 transcription unit was needed to promote local spreading. We conclude that under conditions of normal MSL protein levels, but exceptionally low roX1 transcription, the small amount of mature MSL complex assembled is predominantly sequestered near the site of roX transcription with little reaching the X chromosome.

Table 1.

GAL4 induction of roX1 transcription rescues male viability. roX1 roX2 virgins were mated to y w/Y; [w+ UASroX1] males that either did (right) or did not (left) also carry a [w+ GAL4] transgene linked on the same chromosome. The leftmost column indicates which transgenic insert line was tested. Male viability is expressed as the percentage of surviving transgenic sons/transgenic daughters with the number of daughters recovered in the cross given in parentheses.

Insert % male viability %male viability
no GAL4 +GAL4
2 0.9 (108) 55 (102)
7.2 0 (175) 102 (115)
12 1.6 (125) 87 (61)
20 1.2 (259) 70 (86)
22.1 1.7 (290) 70 (77)
24 1.9 (209) 106 (86)
25.2 9.6 (146) 97 (110)
28 2.9 (172) 62 (92)
29 0 (217) 46 (117)
30.2 1.8 (221) 39 (87)
33 0 (136) 93 (92)

We next introduced a source of GAL4 into the UASroX1 stocks. This dramatically increased male viability (Table 1) and roX1 transcription (Fig. 2H). Increased roX1 transcription had a profound effect on the distribution of MSL complex. The X chromosome was painted with MSL complex similar to what is seen in wild type males (Fig. 2B). The most striking observation was that introducing GAL4 abolished local MSL spreading near the autosomal UASroX1 transgene in all eight lines tested (Fig. 2A B and data not shown). This indicates that vigorous roX1 transcription prevents local spreading of the MSL complex. The fact that a single UASroX1 transgene can both support local MSL spreading or not shows that the strength of roX1 transcription is the critical factor controlling MSL spreading. High constitutive transcription from the hsp83 promoter most likely explains why the H83roX1 transgene failed to support local MSL spreading even when assayed at multiple locations.

Figure 2.

Figure 2

Vigorous roX1 transcription abolishes local MSL spreading. Polytene chromosomes from male larvae were stained with antibodies to MSL1 (red) and DAPI (blue). The roX genotype of the X chromosome is given at left, and arrows indicate the location of the roX1 transgene. A. Extensive local spreading is seen in roX1 roX2 /Y; [w+ UASroX1-66B]/+. Little MSL complex reaches the X chromosome. B. GAL4 induced roX1 transcription abolishes local spreading in roX1 roX2 /Y; [w+ UASroX1-66B] [w+ actin5C-GAL4]/+. All MSL complex is instead exported to the X. Note that no MSL complex is detectable at the autosomal roX1 transgene. C. Local MSL spreading is abolished by endogenous roX2+ transcription in y w roX1ex6 /Y; [w+ UASroX1-66B]/+, but MSL complex is bound to the roX1 transgene under conditions of low transcription. D. y w roX1ex6 /Y; [w+ UASroX1-66A] [w+ actin5C-GALl4]/+ shows that GAL4 induced roX1 transcription prevents MSL complex binding to transgene. E. Under low transcription conditions, paired polytene chromosomes have normal banding morphology around transgene in y w roX1ex6 /Y; [w+ UASroX1-55C]/+. F. In y w roX1ex6 /Y; [w+ UASroX1-55C] [w+ hs-GAL4]/+ males, GAL4 induces a new puff at the insertion site of the paternal transgenic homolog, but not on the snyapsed nontransgenic maternal homolog. G. w /Y; [w+ H83roX1-87B]/[w+ actin5C-GAL4] male showing that GAL4 does not inhibit MSL complex binding to a roX1 transgene lacking the UAS promoter. H. roX1 Northern. Total RNA from adults was hybridized with probes for roX1 and rp49 as a loading control. The genotypes of each sample are: Lane 1, wild type male; 2, wild type female; 3, roX1ex6 male; lanes 4-9 are roX1ex6 males carrying the UASroX1 transgene located at 55C (4 and 5), 28D (6 and 7), or 30C (8 and 9). The males in lanes 4, 6, and 8 lack GAL4 while the males in lanes 5, 7, and 9 express GAL4 from a weakly constitutive heat shock promoter. Lanes 1, 2, 3, 4, 6, and 8 were loaded with 10 μg total RNA. Lanes 5, 7, and 9 were loaded with 1 μg total RNA.

One puzzling observation was the complete absence of MSL complex bound to the autosomal UASroX1 gene under conditions of abnormally high transcription (Fig. 2B). The MSL proteins bind a well-defined region within both the roX1 and roX2 genes that form male-specific DNase I hypersensitive sites (DHS) (Kageyama et al. 2001; Park et al. 2003). These act as complex enhancers that stimulate transcription in males (when MSL is bound), and silence the roX genes in females (no MSL bound) (Bai et al. 2004). We tested whether there was any binding defect in the DHS sequence of the UASroX1 transgene by crossing it into a roX1ex6 roX2+ stock that does not allow local MSL spreading from autosomal roX transgenes (Park et al. 2002). A single MSL band was seen at the site of the transgene, demonstrating that the DHS was competent to bind MSL in the absence of GAL4 (Fig. 2C). The important result was that introduction of GAL4 resulted in loss of the MSL signal from the autosomal UASroX1 transgene (Fig. 2D). We asked if the GAL4 protein had some unanticipated ability to interfere with DHS-MSL interaction. We easily detected a band at the roX1 transgene in H83roX1 males expressing of GAL4 (Fig. 2G). In several UASroX1 transgenic lines we noticed that when GAL4 was present, the banded polytene chromosome displays a distinctively puffed morphology surrounding the transgene (Fig. 2E, F) consistent with the very high levels of transcription detected by Northerns (Fig. 2H). We conclude that GAL4 does not interact with either the DHS sequence or the MSL complex, but rather it is unusually high levels of transcription across roX1 that block the DHS-MSL interaction.

We examined how stable the ectopic autosomal MSL pattern was to changes in local roX1 transcription. We constructed flies that carried three transgenes on the same chromosome; UASroX1, actin-GAL4, and actin-GAL80ts. At 18° the GAL80 binds and inactivates GAL4 bound to the UAS resulting in very low UASroX1 transcription (Fig. 3A lane 6) (Lue et al. 1987; McGuire et al. 2003). Under these conditions, MSL complex spreads extensively from the roX1 transgene again demonstrating that GAL4 bound to the transgene does not affect MSL binding or spreading as long as transcription remains low. At the nonpermissive temperature of 30° the GAL80 releases GAL4 to turn up roX1 transcription (Fig. 3A lanes 7-10). We observed that the newly synthesized roX1 RNA rapidly delivered MSL complex to the X chromosome in trans, at the same time that local MSL spreading around the UASroX1 transgene collapsed (Fig. 3B-E). We conclude that autosomal cis MSL spreading requires continuous replenishment from locally assembled MSL complex. It seemed unlikely that the heat treatment alone could account for the loss of MSL binding around the autosomal roX1 transgene because binding to the X was not hindered. To directly test this alternative, we heat shocked roX1 roX2/Y;[w+ GMroX1}/+ males and found that the local spreading around the roX1 transgene was unaltered (Fig. 3F). This confirms that the loss of local MSL spreading seen in the UASroX1 GAL4 GAL80ts flies was due to increase in roX1 transcription, not the temperature shift.

Figure 3.

Figure 3

Autosomal MSL complex is lost soon after roX1 induction. A. A Northern of roX1 transcripts produced from UASroX1 following induction by heat inactivation of GAL80ts. Lane 1, wild type male, Lane 2, wild type female, Lanes 3-10 y w roX1ex6 males carrying no transgene (3), only the UASroX1 transgene (4), both the UASroX1 and actin5C-GAL4 transgenes (5), or the UASroX1, actin5C-GAL4, and GAL80ts transgenes (6-10). These animals were shifted from 18° to 30° for the time (hrs) shown prior to isolation of RNA. B-E, polytene chromosome spreads of roX1 roX2 /Y; [w+ UASroX1-66B], [w+ actin5C-GAL4], and [w+ GAL80ts]/+ males stained with antibodies to MSL1 (red). B. A male grown at 18° shows very little MSL staining on the X, but robust spreading around the autosomal UASroX1-66B transgene (arrow). C. After 3 hrs. at 30° the X begins to show moderate MSL painting while the staining around the UASroX transgene is still strong. D. By 6 hrs at 30° the X as acquired a nearly normal MSL binding pattern, but the staining at the transgene is weak or undetectable (arrow). E. After 14 hrs at 30° all nuclei have fully painted X chromosomes and no MSL bound near the UASroX1 transgene. F. A roX1 roX2 /Y; [w+ GMroX1-98A]/+ male shifted to 30° for 26 hours showing that extensive spreading around an autosomal roX transgene is resistant to temperature when transcribed from its native promoter.

A 1.2 kb roX1 minigene retains function

Finding that local spreading was an intrinsic property of the MSL complex that did not require any flanking DNA sequences, we set out to test whether any specific region of roX1 RNA might contribute to MSL activity or localization. Although previous analysis showed that the central region of roX1 was not essential for dosage compensation, there were indications that functionally redundant elements might be present that obscured the phenotypes of deletion mutants (Stuckenholz et al. 2003). We constructed a 1.2 kb H83roX1Δ39 minigene (Fig. 4B) modeled after roX1ex40A (Deng et al. 2005) in an effort to remove potential redundant motifs. This H83roX1Δ39 minigene rescued roX1 roX2 double mutant male viability when transcribed from the Hsp83 promoter and supported strong MSL painting of the X when it was the only source of roX RNA (Fig. 4C and E). No MSL complex was ever seen bound to this transgene, presumably because it lacked the DHS element. More importantly, we never saw any MSL spreading around the transgene insertion sites (Fig.4E and 5B). Vigorous transcription is most likely responsible as described above for the H83roX1 and UASroX1 transgenes. The possibility that the Δ39 minigene is instead missing an RNA domain required for spreading will be addressed below. The 1.2 kb Δ39 RNA accumulated in males but not females (Fig. 4D lanes 4-7) despite being transcribed from a constitutive promoter. The same male-specific accumulation has been reported for full-length roX1 RNA and attributed to rapid turnover of female transcripts that fail to assemble into complexes with the MSL proteins (Meller et al. 2000).

Figure 4.

Figure 4

Mutational analysis of conserved sequences at the end of roX1. A. A hypothetical RNA secondary structure of the 3′ end of roX1 based on sequences conserved across Drosophila species. B. The structure of the wild type 3.7 kb rox1 RNA is shown in light gray with the 5′ and 3′ segments retained in roX1Δ39 shown in black. C. The transgenes used to assay function of deletion mutants are indicated with the structural domains shown in A listed above the constructs. Each transgene was inserted at the same ϕC31 attP site (VK11 located at 40E), and all RNAs were transcribed from the Hsp83 promoter. The male rescue was calculated in three replicate crosses as the fraction of transgenic sons/transgenic daughters in a cross where the transgene provides the only source of roX RNA. The complete rescue data set is presented in Table S1. The extent of each deletion is indicated by the gaps bounded by ( ). The –RB123 mutant carries multiple nucleotide substitutions in RB1 and deletions of RB2 and RB3. The H83Δ39pseudo construct replaces the last 600 nt of melanogaster sequence with the corresponding region of D. pseudoobscura roX1 carrying six copies of RB. D. roX1 Northern with rp49 as a loading control. Lane 1, wild type male; 2, wild type female. Lanes 3-11 are in a y w roX1ex6 background. Lane 3, nontransgenic male; lanes 4-6, three different random P inserted transgenic males carrying [roX1Δ39] at different locations; lane 7, a female carrying roX1Δ39; lanes 8-10, males carrying [roX1Δ39-3RB] at three different insertion sites; lane 11, a female carrying the same transgene. Lane 12, wild type male; lane13, roX1ex6 male, lane 14, roX1ex6 roX252/Y;[VK11 H83roX1Δ39]; lane 15, roX1ex6 roX252/Y;[VK11 H83roX1Δ39pseudo]. E. Polytene chromosomes from a roX1 roX2/Y; [w+ H83roX1Δ39]/+ male showing that the 1.2 kb RNA supports normal MSL painting (red) along the X chromosome.

Figure 5.

Figure 5

The roX1pseudoobscura minigene supports normal MSL painting along the male X and local spreading around the transgene insertion site. A. A roX1 roX2 /Y; [y+ attP VK11 w+ H83roX1Δ39p]/+ male displays a normal distribution of MSL1 (red) along the X when the only source of roX RNA is from the pseudoobscura hybrid minigene. B. A male carrying a similar transgene, roX1Δ39, except that the sequence is entirely derived from D. melanogaster. The view near the chromocenter (CC) shows the proximal regions of chromosome arms 2L and 2R with no MSL1 staining detectable at the location of the roX1Δ39 transgene (40E, arrow). C and D. When [H83roX1Δ39p] is assayed at the same integration site, a small cluster of MSL bands spreading from the site of roX transcription is visible. The arrow indicates the transgene site and the arrowhead an additional band. E. A second [H83roX1Δ39p] transgenic stock with an insertion at 48C (Arrow) again displaying local autosomal MSL spreading.

Deletion mutagenesis of the extreme 3′ end of roX1

The genomes of twelve Drosophila species covering approximately 40 Myr of evolution have been sequenced (Clark et al. 2007). We found that each contains a homolog of roX1 and roX2 as has been independently reported (Park et al. 2007). A simple BLAST search failed in more distantly related species forcing us to search with adjacent protein coding gene sequences in the hope that the roX genes had remained in the same syntenic arrangement over time. A combination of computational and manual methods produced a tentative alignment (Fig. S1 and S2). Being free of the constraints of a translational reading frame, the roX genes have accumulated a huge number of indels (insertions/deletions) in addition to simple nucleotide substitutions. This, along with simple repeats and extensive runs of polyA (below) partially defeated computational alignment methods necessitating manual inspection to identify meaningful islands of homology separated by variable spans of seemingly unrelated sequence.

We focused on the 600 nucleotides at the 3′ end of roX1 that previous analysis indicated was important (Stuckenholz et al. 2003). Several features were apparent from the species alignment (Fig. 4A). First, the large stem-loop (SL1) analyzed earlier was well conserved in most species except virilis, mojavensis, and grimshawi. A second predicted stem loop (SL2) followed shortly afterwards, which shows better base pairing potential in non-melanogaster species. We noticed that rather than the single copy of the “roXbox” element (RB) previously described (Franke and Baker 1999; Stuckenholz et al. 2003) we found three imperfect copies and a fourth in the inverse orientation in all species (Fig. 4A S1). Any of the three RBs could potentially base pair with the upstream inverted copy to form three alternative dsRNA stems with loops of variable length, although RB1 is closest in both proximity and sequence complemenarity. The genomic sequence suggests that pseudoobscura and persimilis both have four additional copies of the RB (Fig. 4A S1 S3). After these sequences are accounted for, the remainder of the region is remarkably rich in runs of (A)n although the exact length and locations of these varies widely from one species to another (Fig. S1). We next turned to the much smaller roX2 sequences. Again, we noticed that rather than one copy of the RB noted earlier (Franke and Baker 1999), three copies were present in all species with additional copies in a few species (Fig. S2 and S4). We also found inverted copies lying near some RBs suggesting that these might fold into dsRNA stem-loops (Fig. S4). Again, once the RBs and inverse RB sequences were set aside, the remainder of the sequence was poorly conserved and full of short runs of (A)n.

We deleted each of these elements as well as one upstream region (Region 1) from the H83roX1Δ39 minigene and assayed their ability to support dosage compensation transgenic male flies. Our initial analysis using standard P element transformation provided suggestive results, but the wide variation from one random insertion site to another made direct comparisons between mutants difficult. Therefore we inserted all of our deletion mutants into the same genomic location using the ϕC31 site-specific integration system (Bischof et al. 2007). After sampling several attB integration sites, we chose VK11 located at 40E at the base of chromosome 2L (Venken et al. 2006) because a nearly full-length 3.4 kb roX1 cDNA at this site gave almost complete male rescue and the 1.2 kb H83roX1Δ39 minigene rescued 47% male viability when the transgenes provided the only source of roX RNA (Fig. 4C). When all the other deletion mutants were integrated at the same site most continued to rescue male viability near 50%. However, removing SL1 nearly destroyed function, and loss of SL2 reduced activity to a lesser degree (Fig. 4C). Loss of the very A rich region also reduced activity. Surprisingly, removing any one copy of the RB element or the complementary IRB had no effect on activity. However, removal of all three RB copies or the entire interval containing them completely destroyed activity. Northern analysis showed that roX1 RNAs lacking any RB element were unstable (Fig. 4D lanes 8-10).

The D. pseudoobscura roX1 sequence supports enhanced local MSL spreading

We constructed a hybrid roX1 minigene, H83roX1Δ39pseudo, in which the first 600 nt were derived from the 5′ end of the D. melanogaster roX1 gene and the last 600 nt were derived from the 3′ end of the D. pseudoobscura roX1 gene (Fig. 4C). Despite the overall poor conservation of primary sequence, many indels between the two distantly related species, and a weak SL2-like element, the hybrid minigene rescued roX1 roX2 male viability to the same degree as the all melanogaster construct (Fig. 4C), and produced abundant RNA (Fig. 4D lane 15). The MSL complex containing only the hybrid H83roX1Δ39pseudo RNA painted the male X in a normal pattern demonstrating that the many sequence differences were inconsequential (Fig. 5A). However, we did notice a striking difference between the melanogaster Δ39 minigene and the pseudoobscura hybrid. The latter supported MSL spreading around the autosomal insertion sites tested despite being driven by the strong hsp83 promoter (Fig. 5C-E) while none of the melanogaster constructs did (Fig. 5B). We cannot be certain which of the many sequence differences are responsible for this enhanced spreading behavior, but the most obvious difference is that the pseudoobscura sequence used here carries six copies of RB at its 3′ end rather than three.

Discussion

The MSL complex is able to spread long distances over a chromosome from ectopic sites of roX RNA synthesis at autosomal transgenes (Kelley et al. 1999; Park et al. 2002). This local spreading may also take place on the X (Oh et al. 2003; Bai et al. 2007), but the extent to which cis spreading contributes to X-specific MSL binding in wild type males remains controversial (Fagegaltier and Baker 2004). A major shortcoming is that nothing is understood about the mechanism of local spreading. Here we have shown that only sequences within the roX1 RNA are needed. No special spreading initiation sites flank the roX1 gene, and the local chromatin environment surrounding the roX1 transgene is of little importance. We showed whether or not MSL complex spreads from sites of roX1 transcription depends upon how vigorously the roX1 gene is transcribed. Weak to moderate roX1 transcription favors local spreading of MSL complex surrounding the roX1 gene, but strong transcription favors release of soluble RNA that eventually locates the X in trans. Our results are most consistent with a model postulating that MSL subunits begin assembling onto nascent roX transcripts as they emerge from RNA polymerase (Fig. 6). The ratio of free MSL protein subunits relative to nascent transcripts strongly influences the final destination of mature complex (Oh et al. 2003). This “Race to Assemble” model was formulated to explain the unexpected MSL distribution pattern seen when the number of roX genes was manipulated in males or when the abundance of MSL subunits was altered. Here we varied the amount of transcription from a roX1 transgene and came to the same conclusion. Spreading might require efficient assembly of a mature, functional complex while the nascent roX1 transcript is still tethered to the RNA polymerase. We propose that the failure to spread under conditions of abundant roX1 RNA synthesis is because earlier RNA molecules consumed the pool of free MSL subunits available for assembling later roX transcripts. Furthermore, the dense cloud of elongating transcripts may sterically interfere with efficient recruitment of MSL subunits. Consequently, most transcripts are released with an incomplete set of subunits and only finish assembly while diffusing away from the site of transcription.

Figure 6.

Figure 6

Model of cotranscriptional assembly of MSL complex. A. The MSL proteins appear to stimulate roX1 transcription in males by binding to the internal DHS element (Bai et al. 2004). Very high levels of transcription across the DHS displaces the MSL proteins, perhaps limiting the levels of roX1 RNA synthesis. Black rectangle=roX1 gene, gray ball=RNA polymerase. The boxed region is enlarged in B to show how the individual protein subunits; MSL1 (1), MSL2 (2), MSL3 (3), MOF (F), and the MLE helicase might recognize RNA elements emerging from RNA polymerase (RNP). MLE is the only helicase in Drosophila to contain two dsRNA binding motifs at its N-terminus which might recognized secondary structures found at the extreme 3′ end of roX1 transcripts. The success or failure of the protein subunits to assemble onto nascent transcripts while still tethered to the RNA polymerase is postulated to determine whether or not local spreading of the MSL complex occurs. Stem Loop 1 and 2 are drawn as base-paired regions, IRB is shown as a white rectangle, and the RB repeats are shown as three black rectangles.

We are not certain what biological purpose is served by linking MSL spreading to roX1 transcription. Transcriptional control of roX1 varies during development (Meller et al. 1997; Meller 2003) but the details remain controversial (Bai et al. 2004; Rattner and Meller 2004). Perhaps this linkage is useful during early embryogenesis as dosage compensation is being established. Additionally, we can imagine that production of MSL complex might experience a burst during DNA replication much like histone synthesis. The roX1 gene may need to adjust either its own output or the distribution of mature complexes in order to reestablish the proper level of dosage compensation.

An earlier report concluded that local RNA synthesis was not necessary for MSL complex to spread from a promoterless roX1 cDNA (Kageyama et al. 2001). However, in that study the two transgene insertion sites that supported MSL spreading were found to make low levels of roX1 RNA presumably due to flanking promoter read-through (Kageyama et al. 2001). This is compatible with our current view that low roX transcription favors local spreading.

A second key finding is that when MSL complex spreads into flanking autosomal chromatin, it remains dependent upon constant replenishment from the nearby roX1 locus. Shifting from low to high roX1 transcription caused loss of bound MSL complex surrounding an autosomal transgene after a few hours. This seems counterintuitive because one might have expected that abundant production of roX RNA would have increased the opportunity for newly assembled MSL complex to bind nearby chromatin. Although indirect, we believe that this observation is the strongest evidence to date in favor of the idea that MSL complex assembly begins cotranscriptionally, and mature complexes are completed near the roX1 locus only under conditions of moderate to low roX1 RNA synthesis.

Dosage compensation is normally established around the onset of gastrulation (Rastelli et al. 1995; Franke et al. 1996). One might imagine that the pattern of target genes bound by the MSL complex is set up once and remains stable over the life of the male (Legube et al. 2006), or dosage compensation might respond to changes as gene are utilized in different tissues and times of development (Sass et al. 2003; Alekseyenko et al. 2006; Kind and Akhtar 2007). Our observation that a nearly “naked” X can acquire a normal MSL pattern within a few hours of inducing roX RNA synthesis argues against any strict requirement for establishing MSL binding during embryonic development. However, we cannot exclude the possibility that the very low levels of MSL complex made early may have somehow prepared the X for later robust binding.

MSL binding to DNaseI hypersensitive site

A sequence of approximately 220 bp forms a male-specific DNase I hypersensitive site (DHS) near the middle of the roX1 gene which is the primary site bound by the MSL complex (Kageyama et al. 2001; Park et al. 2003). This site appears to act as a complex transcriptional control element causing silencing in females and activation in males (Bai et al. 2004; Bai et al. 2007). MSL complex clearly binds the DHS sequence in vivo when the gene is not transcribed (Kageyama et al. 2001; Park et al. 2002; Park et al. 2003), during very low transcription (Fig. 1C), and even when transcribed from the hsp83 promoter (Fig. 1B). However, we could not detect the MSL complex bound to the UASroX1 transgene when GAL4 drives transcription much higher than the wild type rate (Fig. 2B and D). This might reveal a negative feedback mechanism that places an upper limit on roX1 expression. In wild type males, as MSL proteins successfully stimulate roX transcription, they might reach a point where they are ejected from the roX gene by a high density of RNA polymerase molecules transiting the DHS. This would ensure that the MSL proteins could drive roX transcription to the correct level, but no higher. This might explain why the MSL-dependent enhancer in located inside the roX1 transcription unit. Although this arrangement results in the DHS sequence being carried along in the mature roX1 RNA, it seems to have no function at the RNA level (Stuckenholz et al. 2003). In our artificial situation roX transcription no longer depends upon MSL proteins, so extraordinarily high roX1 synthesis continues unabated.

Short repeats at the 3′ end of both roX genes

Although an initial comparison between roX1 and roX2 failed to detect any obvious similarities at the primary sequence level (Amrein and Axel 1997), later inspection revealed a single 30 nt element (here called the roXbox, RB) at the 3′ ends of both roX1 and roX2 (Franke and Baker 1999). Deletion of this element did not result in any significant phenotype (Stuckenholz et al. 2003). The availability of 12 sequenced Drosophila species genomes allowed us to determine which segments of roX1 were best conserved and potentially functionally important. The resulting sequence alignment revealed that the RB was actually present in at least three to seven copies in the roX1 gene of different species, and at least three copies were also present at the 3′ end of roX2 (Fig. S1-4). Bolstering the notion that these elements are significant, additional conserved copies were found in the inverse orientation that might form dsRNA secondary structures (this work and Park et al 2007).

Removing the central 70% of the 3.7 kb roX1 sequence only reduces in vivo activity by half, and is fully consistent with prior work (Stuckenholz et al. 2003; Deng et al. 2005). Deletion analysis of the mammalian Xist gene came to a similar conclusion (Wutz et al. 2002). Small deletions in the 1.2 kb H83roX1Δ39 minigene display more drastic phenotypes than reported for larger deletions in the full length gene (Stuckenholz et al. 2003). This is most likely due to the removal of partially redundant domains in the middle of roX1 and our use of a single chromosomal integration site to assay all mutants. Using this system showed that removing any one copy of RB had little effect. However, removing the interval containing all three copies produced an unstable RNA that could no longer support male viability. A similar loss of activity was found when just the three RB elements were deleted precisely. The predicted base pairing between IRB and any copy of RB is not essential for dosage compensation. However, its conservation over time suggests IRB plays some role not measured in this assay or another unidentified sequence can substitute for it.

One might have imagined that the extensive divergence of roX1 primary sequence has been accompanied by equally dramatic coevolution of the MSL subunits. Indeed, while MOF, MSL3 and MLE are very similar across fly species, MSL1 and MSL2 have diverged extensively outside small domains known to contact other protein subunits (unpublished observations). This might result in incompatible protein:RNA combinations if components from different species were mixed. We constructed a hybrid roX1 minigene whose first 600 nt came from the 5′ end of the D. melanogaster homolog and the last 600 nt from highly diverged D. pseudoobscura gene. This supported dosage compensation in transgenic D. melanogaster males whose endogenous roX1 and roX2 genes had been deleted. This argues that roX1 RNAs from pseudoobscura and melanogaster share a core structure despite the divergence in sequence. However, the much more striking result was that the hybrid RNA promoted local MSL spreading around the sites of the autosomal transgenes (Fig. 5). In contrast, the fully melanogaster minigene did not support any MSL binding at or around the transgene. The latter result is easily understood because loss of the DHS sequence from the Δ39 minigene removes the primary MSL binding site within the roX1 gene, and transcription from the strong hsp83 promoter inhibits local spreading of even a full-length roX1 cDNA for reasons discussed above. We speculate that increasing the number of RBs from three to six somehow tips the balance towards local spreading in spite of vigorous transcription from the hsp83 promoter. The fact that the much smaller H83roX1 Δ39pseudo minigene is still capable of supporting local spreading argues that the 2.4 kb of internal sequence removed was not essential for this aspect of roX1 function, but might somehow enhance it.

If complex assembly does begin cotranscriptionally, then the functionally important sequences studied here at the very end of the transcript might link MSL subunit binding to 3′ processing and release the transcript from RNA polymerase. This might then influence how the newly formed complex is distributed locally or to more distant targets (Fig. 6). Removing all RBs may abort assembly leading to destruction of the defective RNA. Conversely, expanding the number of RB copies may enhance some aspect of assembly required for local spreading.

Materials and Methods

Fly genetics

All fly mutants have been previously described (Meller et al. 2000; Meller and Rattner 2002). The double mutant, y w roX1ex6 Df(1) roX252 [w+ cos4Δ], is referred to as simply roX1 roX2 throughout. Transgenic flies were created by P element transformation using pCaSpeR based vectors injected into y w host flies (Rubin and Spradling 1982; Pirrotta 1988; Robertson et al. 1988). Site specific integration was carried out using the ϕC31 system (Bischof et al. 2007) at attP sites on the second chromosome (Venken et al. 2006). Male viability measurements were made by crossing roX1 roX2 virgins to the appropriate transgenic father and comparing the ratio of transgenic sons to daughters. The UASroX1 transgene carries the 3.4 kb roX1 cDNA20 inserted into pUAST (Brand and Perrimon 1993). The sources of GAL4 came from either an hsp70GAL4 transgene on the second chromosome that produced adequate GAL4 without heat shock, or tubulinGAL4 or actin5CGAL4 transgenes each located on the third chromosome. In every case the UASroX1 was recombined onto the same chromosome as the GAL4 source. Although both transgenes carried w+ as the visible marker, the recombinants often had darker orange eye color. In each case the recombinant was scored for high rescue of male viability of roX1 roX2 double mutant males to confirm the desired recombinant had been recovered. For the time course using GAL80ts, we started with a stock that carried both UASroX1-66B and tubulinGAL4, and recombined it with a tubulinGAL80ts transgene that also mapped to the third chromosome (McGuire et al. 2003). Rare recombinants with very dark red eyes were tested for the presence of all three transgenes by genomic Southerns hybridized to a white probe and finding the unique junction fragment specific to each of the three starting transgenes.

Northerns

Either adults or third instar larvae were sorted by sex and homogenized in Trizol reagent (Invitrogen) according to the manufacturer's instructions. In most cases 10μg of total RNA was run on 1.0% agarose formaldehyde gels, transferred to Hybond N+ membranes in 50 mM NaOH. For the time course shown in Fig. 3, larvae were grown at 18° until reaching third instar (about 10 days) then shifted to 30°. Male larvae were harvested at 2, 4, 8, or 12 hours after the shift and homogenized in Trizol.

Polytene chromosome staining

Transgenic male larvae were generated by mating either y w roX1ex6 virgins or roX1 roX2 virgins to males that were homozygous for the roX1 transgene of interest. The resulting sons were harvested as third instar and their polytene chromosomes were stained with anti MSL1 antibodies as described (Lyman et al. 1997).

Mutations of roX1

The roX1Δ39 minigene was assembled from the 5′ half of roX1Δ3 ligated to the 3′ portion of roX1Δ9 using the NheI site placed at the deletion point (Stuckenholz et al. 2003). All of the small deletions were generated by PCR mediated cloning using primers that spanned the desired deletion. The final sequence flanking each deletion is given below with <nt> indicating the number of nucleotides removed. A MluI restriction site placed at each junction (except –inverse roXbox) is underlined.

  • -Region 1: CTAATTAACTTCCACGCGT<87>CCATACTATTCCTATA

  • -SL1: TATTCCTATATAAACGCGT<63>ACATTTAAACAATAT

  • -IRB: TTAAACAATATTTT<15>AATAAATGGAACGG

  • -SL2: GTAAAACGAATAAATACGCGT<38>AGAAGTATAACTA

  • -A bulge: CATTACGGTTCACGCGT<83>CGTTCTACGCAGT

  • -RB1: TAAAAACTTGCTGATCAAACGCGT<11>GTTCTTAAAAAGA

  • -RB2: CAAAGCAAGTAAAAATGTACGCGT<22>CACCAAGTGCCCAAA

  • -RB3: CAAACTATAAAAAGAAAATACGCGT<14>GCCTGAGCCGATT

  • -3RB: AACTTGCTGATCAAACGCGT <126>GCCTGAGCCGAT

  • -RB123: RB2 and RB3 were deleted as above, RB1 was changed to TCAACAAACGAATCGGT where the underlined nucleotides are mutant.

The pseudoobscura hybrid minigene was made by PCR amplification of the appropriate genomic DNA. The primers were 5′ CACGCTAGCGCGCCACACCACAGTCCCCA3′ and 5′ CACGCGGCCGCGCGCCAGTAAGTACGTATAACGTTACCAAATC 3′ where the underlines sequences are artificial NheI and NotI sites incorporated to allow ligation into the hybrid gene vector. All of the small deletions and the pseudoobscura hybrid genes were sequenced after construction to check for PCR induced mutations.

Sequence Analysis

The roX genes could be readily obtained for species up to pseudoobscura by simple BLAST searches with the melanogaster starting sequences. Beyond that we relied on recovering better conserved protein coding genes adjacent to roX and then intensively searching the surrounding region for diverged roX genes. The closely related sequences were aligned using ClustalW (http://www.ebi.ac.uk/Tools/clustalw/index.html), but we resorted to manual alignment for the more distant species in order to deal with the many indels. These were guided by local BLAST searches of short regions and Dot Plot analysis to search for forward and inverted repeats (http://www.vivo.colostate.edu/molkit/dnadot/).

Supplementary Material

01

Figure S1. Sequence alignment of the last 600 nt of roX1 across the genus Drosophila. The locations of elements removed in the deletion mutants of Fig. 4 are indicated above the sequence. Additional copies of RB are found at the end of pseudoobscura.

02

Figure S2. Sequence alignment of the roX2 gene across the genus Drosophila.

03

Figure S3. Alignment of all RB elements from both roX1 and roX2 from different species. The originally identified RB sequence is shown at top (Franke and Baker, 1999). The RB sequence is highlighted in red with a second less-well conserved downstream element colored blue. The labels at left of each copy indicate gene/species/copy. For instance, 1m3 is the third RB from the melanogaster roX1 gene. The species shown are: m melanogaster, e erecta, a ananassae, p pseudoobscura, v virilis, j mojavensis, g grimshawi. Not shown are simulans, sechellia, or yakuba because they are highly similar to melanogaster outside this region. Also not show is persimilis which is very closely related to the pseudoobscura sequence. The bottom group shows an imperfect RB from an internal region of roX1 present in the full-length RNA, but not the Δ39 minigene.

04

Figure S4. The 3′ end of roX2 contains multiple forward and reverse copies of the RB element. The roX2 sequence contains at least three copies of the RB element in the forward orientation with two reverse copies that might form dsRNA stems shown at right. D. virilis and D. grimshawi have an additional upstream copy and D. mojavensis has two (gray arrows).

05

Table S1 Dosage compensation activity of roX1Δ39 minigenes carrying deletions in conserved elements. Dosage compensation is expressed as the ability of each transgene inserted at the VK11 attP integration site to restore viability to males whose endogenous roX1 and roX2 genes have been deleted. Most crosses were done three times independently with the combined total shown in Figure 4C. The parents were roX1 roX2 virgins mated to y w/Y; [y+ VK11 attP w+ roX]/+ males.

Acknowledgments

Mitzi Kuroda generously supplied space in her lab for the initial phase of this project, shared unpublished data, and provided valuable comments on an early draft of this manuscript. Yongkyu Park generously shared data prior to publication. Greg Roman and Koen Venken provided fly stocks, Peihou Zhang provided technical assistance, and Jessica Leonnardi helped with counting flies. I would like to thank Maha Prabhakaran critical comments on the manuscript. This work was supported by grant 5RO1GM71538 from NIH to R.L.K.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Literature cited

  1. Alekseyenko AA, Larschan E, Lai WR, Park PJ, Kuroda MI. High-resolution ChIP-chip analysis reveals that the Drosophila MSL complex selectively identifies active genes on the male X chromosome. Genes Dev. 2006;20:848–57. doi: 10.1101/gad.1400206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amrein H, Axel R. Genes expressed in neurons of adult male Drosophila. Cell. 1997;88:459–69. doi: 10.1016/s0092-8674(00)81886-3. [DOI] [PubMed] [Google Scholar]
  3. Bai X, Alekseyenko AA, Kuroda MI. Sequence-specific targeting of MSL complex regulates transcription of the roX RNA genes. Embo J. 2004;23:2853–61. doi: 10.1038/sj.emboj.7600299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bai X, Larschan E, Kwon SY, Badenhorst P, Kuroda MI. Regional control of chromatin organization by noncoding roX RNAs and the NURF remodeling complex in Drosophila melanogaster. Genetics. 2007;176:1491–9. doi: 10.1534/genetics.107.071571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Belote JM, Lucchesi JC. Control of X chromosome transcription by the maleless gene in Drosophila. Nature. 1980;285:573–5. doi: 10.1038/285573a0. [DOI] [PubMed] [Google Scholar]
  6. Bischof J, Maeda RK, Hediger M, Karch F, Basler K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A. 2007;104:3312–7. doi: 10.1073/pnas.0611511104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bone JR, Lavender J, Richman R, Palmer MJ, Turner BM, Kuroda MI. Acetylated histone H4 on the male X chromosome is associated with dosage compensation in Drosophila. Genes Dev. 1994;8:96–104. doi: 10.1101/gad.8.1.96. [DOI] [PubMed] [Google Scholar]
  8. Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993;118:401–15. doi: 10.1242/dev.118.2.401. [DOI] [PubMed] [Google Scholar]
  9. Brown CJ, Hendrich BD, Rupert JL, Lafreniere RG, Xing Y, Lawrence J, Willard HF. The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell. 1992;71:527–42. doi: 10.1016/0092-8674(92)90520-m. [DOI] [PubMed] [Google Scholar]
  10. Clark AG, et al. Evolution of genes and genomes on the Drosophila phylogeny. Nature. 2007;450:203–18. doi: 10.1038/nature06341. [DOI] [PubMed] [Google Scholar]
  11. Deng X, Meller VH. roX RNAs are required for increased expression of X-linked genes in Drosophila melanogaster males. Genetics. 2006;174:1859–66. doi: 10.1534/genetics.106.064568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Deng X, Rattner BP, Souter S, Meller VH. The severity of roX1 mutations is predicted by MSL localization on the X chromosome. Mech Dev. 2005;122:1094–105. doi: 10.1016/j.mod.2005.06.004. [DOI] [PubMed] [Google Scholar]
  13. Fagegaltier D, Baker BS. X Chromosome Sites Autonomously Recruit the Dosage Compensation Complex in Drosophila Males. PLoS Biol. 2004;2:e341. doi: 10.1371/journal.pbio.0020341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Franke A, Baker BS. The rox1 and rox2 RNAs are essential components of the compensasome, which mediates dosage compensation in Drosophila. Mol Cell. 1999;4:117–22. doi: 10.1016/s1097-2765(00)80193-8. [DOI] [PubMed] [Google Scholar]
  15. Franke A, Dernburg A, Bashaw GJ, Baker BS. Evidence that MSL-mediated dosage compensation in Drosophila begins at blastoderm. Development. 1996;122:2751–60. doi: 10.1242/dev.122.9.2751. [DOI] [PubMed] [Google Scholar]
  16. Gilfillan GD, Straub T, de Wit E, Greil F, Lamm R, van Steensel B, Becker PB. Chromosome-wide gene-specific targeting of the Drosophila dosage compensation complex. Genes Dev. 2006;20:858–70. doi: 10.1101/gad.1399406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hamada FN, Park PJ, Gordadze PR, Kuroda MI. Global regulation of X chromosomal genes by the MSL complex in Drosophila melanogaster. Genes Dev. 2005;19:2289–94. doi: 10.1101/gad.1343705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kageyama Y, Mengus G, Gilfillan G, Kennedy HG, Stuckenholz C, Kelley RL, Becker PB, Kuroda MI. Association and spreading of the Drosophila dosage compensation complex from a discrete roX1 chromatin entry site. Embo J. 2001;20:2236–45. doi: 10.1093/emboj/20.9.2236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kelley RL, Meller VH, Gordadze PR, Roman G, Davis RL, Kuroda MI. Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell. 1999;98:513–22. doi: 10.1016/s0092-8674(00)81979-0. [DOI] [PubMed] [Google Scholar]
  20. Kind J, Akhtar A. Cotranscriptional recruitment of the dosage compensation complex to X-linked target genes. Genes Dev. 2007;21:2030–40. doi: 10.1101/gad.430807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Larschan E, Alekseyenko AA, Gortchakov AA, Peng S, Li B, Yang P, Workman JL, Park PJ, Kuroda MI. MSL Complex Is Attracted to Genes Marked by H3K36 Trimethylation Using a Sequence-Independent Mechanism. Mol Cell. 2007;28:121–133. doi: 10.1016/j.molcel.2007.08.011. [DOI] [PubMed] [Google Scholar]
  22. Legube G, McWeeney SK, Lercher MJ, Akhtar A. X-chromosome-wide profiling of MSL-1 distribution and dosage compensation in Drosophila. Genes Dev. 2006;20:871–83. doi: 10.1101/gad.377506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lue NF, Chasman DI, Buchman AR, Kornberg RD. Interaction of GAL4 and GAL80 gene regulatory proteins in vitro. Mol Cell Biol. 1987;7:3446–51. doi: 10.1128/mcb.7.10.3446-3451.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lyman LM, Copps K, Rastelli L, Kelley RL, Kuroda MI. Drosophila male-specific lethal-2 protein: structure/function analysis and dependence on MSL-1 for chromosome association. Genetics. 1997;147:1743–53. doi: 10.1093/genetics/147.4.1743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal rescue of memory dysfunction in Drosophila. Science. 2003;302:1765–8. doi: 10.1126/science.1089035. [DOI] [PubMed] [Google Scholar]
  26. Meller VH. Initiation of dosage compensation in Drosophila embryos depends on expression of the roX RNAs. Mech Dev. 2003;120:759–67. doi: 10.1016/s0925-4773(03)00157-6. [DOI] [PubMed] [Google Scholar]
  27. Meller VH, Gordadze PR, Park Y, Chu X, Stuckenholz C, Kelley RL, Kuroda MI. Ordered assembly of roX RNAs into MSL complexes on the dosage-compensated X chromosome in Drosophila. Curr Biol. 2000;10:136–43. doi: 10.1016/s0960-9822(00)00311-0. [DOI] [PubMed] [Google Scholar]
  28. Meller VH, Rattner BP. The roX genes encode redundant male-specific lethal transcripts required for targeting of the MSL complex. Embo J. 2002;21:1084–91. doi: 10.1093/emboj/21.5.1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Meller VH, Wu KH, Roman G, Kuroda MI, Davis RL. roX1 RNA paints the X chromosome of male Drosophila and is regulated by the dosage compensation system. Cell. 1997;88:445–57. doi: 10.1016/s0092-8674(00)81885-1. [DOI] [PubMed] [Google Scholar]
  30. Moazed D, Rudner AD, Huang J, Hoppe GJ, Tanny JC. A model for step-wise assembly of heterochromatin in yeast. Novartis Found Symp. 2004;259:48–56. 163–9. discussion 56-62. [PubMed] [Google Scholar]
  31. Oh H, Park Y, Kuroda MI. Local spreading of MSL complexes from roX genes on the Drosophila X chromosome. Genes Dev. 2003;17:1334–9. doi: 10.1101/gad.1082003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Park SW, Kang Y, Sypula JG, Choi J, Oh H, Park Y. An evolutionarily conserved domain of roX2 RNA is sufficient for induction of H4-Lys16 acetylation on the Drosophila X chromosome. Genetics. 2007;177:1429–37. doi: 10.1534/genetics.107.071001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Park Y, Kelley RL, Oh H, Kuroda MI, Meller VH. Extent of chromatin spreading determined by roX RNA recruitment of MSL proteins. Science. 2002;298:1620–3. doi: 10.1126/science.1076686. [DOI] [PubMed] [Google Scholar]
  34. Park Y, Mengus G, Bai X, Kageyama Y, Meller VH, Becker PB, Kuroda MI. Sequence-specific targeting of Drosophila roX genes by the MSL dosage compensation complex. Mol Cell. 2003;11:977–86. doi: 10.1016/s1097-2765(03)00147-3. [DOI] [PubMed] [Google Scholar]
  35. Pirrotta V. Vectors for P-mediated transformation in Drosophila. Biotechnology. 1988;10:437–56. doi: 10.1016/b978-0-409-90042-2.50028-3. [DOI] [PubMed] [Google Scholar]
  36. Rastelli L, Richman R, Kuroda MI. The dosage compensation regulators MLE, MSL-1 and MSL-2 are interdependent since early embryogenesis in Drosophila. Mech Dev. 1995;53:223–33. doi: 10.1016/0925-4773(95)00438-7. [DOI] [PubMed] [Google Scholar]
  37. Rattner BP, Meller VH. Drosophila male-specific lethal 2 protein controls sex-specific expression of the roX genes. Genetics. 2004;166:1825–32. doi: 10.1534/genetics.166.4.1825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Robertson HM, Preston CR, Phillis RW, Johnson-Schlitz DM, Benz WK, Engels WR. A stable genomic source of P element transposase in Drosophila melanogaster. Genetics. 1988;118:461–70. doi: 10.1093/genetics/118.3.461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rubin GM, Spradling AC. Genetic transformation of Drosophila with transposable element vectors. Science. 1982;218:348–53. doi: 10.1126/science.6289436. [DOI] [PubMed] [Google Scholar]
  40. Sass GL, Pannuti A, Lucchesi JC. Male-specific lethal complex of Drosophila targets activated regions of the X chromosome for chromatin remodeling. Proc Natl Acad Sci U S A. 2003;100:8287–91. doi: 10.1073/pnas.1332749100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schuettengruber B, Chourrout D, Vervoort M, Leblanc B, Cavalli G. Genome regulation by polycomb and trithorax proteins. Cell. 2007;128:735–45. doi: 10.1016/j.cell.2007.02.009. [DOI] [PubMed] [Google Scholar]
  42. Sleutels F, Zwart R, Barlow DP. The non-coding Air RNA is required for silencing autosomal imprinted genes. Nature. 2002;415:810–3. doi: 10.1038/415810a. [DOI] [PubMed] [Google Scholar]
  43. Smith ER, Allis CD, Lucchesi JC. Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J Biol Chem. 2001;276:31483–6. doi: 10.1074/jbc.C100351200. [DOI] [PubMed] [Google Scholar]
  44. Smith ER, Pannuti A, Gu W, Steurnagel A, Cook RG, Allis CD, Lucchesi JC. The Drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation. Mol Cell Biol. 2000;20:312–8. doi: 10.1128/mcb.20.1.312-318.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Straub T, Gilfillan GD, Maier VK, Becker PB. The Drosophila MSL complex activates the transcription of target genes. Genes Dev. 2005;19:2284–8. doi: 10.1101/gad.1343105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Stuckenholz C, Meller VH, Kuroda MI. Functional redundancy within roX1, a noncoding RNA involved in dosage compensation in Drosophila melanogaster. Genetics. 2003;164:1003–14. doi: 10.1093/genetics/164.3.1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Talbert PB, Henikoff S. Spreading of silent chromatin: inaction at a distance. Nat Rev Genet. 2006;7:793–803. doi: 10.1038/nrg1920. [DOI] [PubMed] [Google Scholar]
  48. Venken KJ, He Y, Hoskins RA, Bellen HJ. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science. 2006;314:1747–51. doi: 10.1126/science.1134426. [DOI] [PubMed] [Google Scholar]
  49. Verdel A, Jia S, Gerber S, Sugiyama T, Gygi S, Grewal SI, Moazed D. RNAi-mediated Targeting of Heterochromatin by the RITS Complex. Science. 2004 doi: 10.1126/science.1093686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wakimoto B. The spreading influence of heterochromatin. Trends Genet. 1997;13:349. doi: 10.1016/s0168-9525(97)01243-2. [DOI] [PubMed] [Google Scholar]
  51. Wutz A. RNAs templating chromatin structure for dosage compensation in animals. Bioessays. 2003;25:434–42. doi: 10.1002/bies.10274. [DOI] [PubMed] [Google Scholar]
  52. Wutz A, Rasmussen TP, Jaenisch R. Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat Genet. 2002;30:167–74. doi: 10.1038/ng820. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Figure S1. Sequence alignment of the last 600 nt of roX1 across the genus Drosophila. The locations of elements removed in the deletion mutants of Fig. 4 are indicated above the sequence. Additional copies of RB are found at the end of pseudoobscura.

02

Figure S2. Sequence alignment of the roX2 gene across the genus Drosophila.

03

Figure S3. Alignment of all RB elements from both roX1 and roX2 from different species. The originally identified RB sequence is shown at top (Franke and Baker, 1999). The RB sequence is highlighted in red with a second less-well conserved downstream element colored blue. The labels at left of each copy indicate gene/species/copy. For instance, 1m3 is the third RB from the melanogaster roX1 gene. The species shown are: m melanogaster, e erecta, a ananassae, p pseudoobscura, v virilis, j mojavensis, g grimshawi. Not shown are simulans, sechellia, or yakuba because they are highly similar to melanogaster outside this region. Also not show is persimilis which is very closely related to the pseudoobscura sequence. The bottom group shows an imperfect RB from an internal region of roX1 present in the full-length RNA, but not the Δ39 minigene.

04

Figure S4. The 3′ end of roX2 contains multiple forward and reverse copies of the RB element. The roX2 sequence contains at least three copies of the RB element in the forward orientation with two reverse copies that might form dsRNA stems shown at right. D. virilis and D. grimshawi have an additional upstream copy and D. mojavensis has two (gray arrows).

05

Table S1 Dosage compensation activity of roX1Δ39 minigenes carrying deletions in conserved elements. Dosage compensation is expressed as the ability of each transgene inserted at the VK11 attP integration site to restore viability to males whose endogenous roX1 and roX2 genes have been deleted. Most crosses were done three times independently with the combined total shown in Figure 4C. The parents were roX1 roX2 virgins mated to y w/Y; [y+ VK11 attP w+ roX]/+ males.

RESOURCES