Temporal Appearance of Plasmid-Mediated Quinolone Resistance Genes

Abstract

One hundred fifty AAC(6′)-Ib-positive gram-negative isolates collected between 1981 and 1991 were examined by PCR for the presence of the aac(6′)-Ib-cr variant and other plasmid-mediated quinolone resistance (PMQR) genes. None had the aac(6′)-Ib-cr variant, qnrA, qnrS, qnrC, or qepA, but two strains collected in 1988 had qnrB alleles, making these the earliest known PMQR genes.

Plasmid-mediated aminoglycoside 6′-N-acetyltransferase, AAC(6′)-Ib, conferring resistance to amikacin, kanamycin, and tobramycin, was described in the 1980s (19, 20, 24) and found to be broadly distributed geographically and present in many clinically important gram-negative rods (3, 21). A variant, AAC(6′)-Ib-cr, with the surprising additional property of acetylating and inactivating fluoroquinolones with an accessible amino nitrogen on the piperazine ring, was described in 2006 (15), encoded by a plasmid isolated in 2000-2001 from Shanghai (23). AAC(6′)-Ib-cr differs from AAC(6′)-Ib by only two amino acid substitutions, both of which are required for the enhanced substrate recognition (9, 15, 22). The “cr” variant was subsequently found to be widely distributed around the world (1, 2, 4, 5, 10-12, 14, 17), suggesting an earlier origin to allow for such broad dissemination.

Fluoroquinolones modified by AAC(6′)-Ib-cr were approved for clinical use in the United States in 1986 (norfloxacin) and 1987 (ciprofloxacin). Hence, we hypothesized that if a historical collection of strains were available for examination, the cr variant would first be found after this time. Such a collection was begun at Schering-Plough in the 1980s and consists of more than 1,100 strains of gram-negative bacilli collected between 1981 and 1991, all of which were characterized as making AAC(6′)-Ib based on DNA hybridization probes (16). One hundred fifty-six of these strains were revived from storage, including 44 Klebsiella pneumoniae strains, 29 Escherichia coli strains, 20 Enterobacter cloacae strains, 19 Acinetobacter calcoaceticus strains, 8 Enterobacter aerogenes strains, 7 Pseudomonas aeruginosa strains, 5 Proteus mirabilis strains, 5 Serratia marcescens strains, 3 Citrobacter freundii strains, 3 Klebsiella oxytoca strains, 3 Providencia stuartii strains, 3 Salmonella enterica strains, 2 Enterobacter sakazakii strains, and 1 strain (each) of Citrobacter diversus, Enterobacter agglomerans, Providencia rettgeri, Pseudomonas sp., and Stenotrophomonas maltophilia. Fifty-seven strains came from Europe (Greece, 37; Belgium, 12; France, 3; Italy, 3; and Portugal, 2), 50 from South America (Argentina, 46; Chile, 2; Uruguay, 1; and Venezuela, 1), 47 from the United States, and 2 from the Far East (Japan and Taiwan). They were collected in 1981 (1 strain), 1982 (1 strain), 1983 (2 strains), 1984 (6 strains), 1985 (9 strains), 1986 (1 strain), 1987 (20 strains), 1988 (74 strains), 1989 (17 strains), 1990 (24 strains), and 1991 (1 strain).

The presence of aac(6′)-Ib was determined by PCR utilizing primers and conditions that amplify all known aac(6′)-Ib variants (11). The amplification products were digested with the restriction enzyme BtsCI (New England Biolabs, Ibswich, MA), which cleaves the wild-type gene but not the cr variant. Strains were also assayed by PCR for qnrA, qnrB, qnrC, qnrS, and qepA, the other currently known plasmid-mediated quinolone resistance genes, as described elsewhere (6), using the primers listed in Table 1.

TABLE 1.

PCR primers

Gene	Primer sequences (5′→3′)	Product size (bp)	Reference
qnrA	ATTTCTCACGCCAGGATTTG	468	This study
	TGCCAGGCACAGATCTTGAC
qnrB	CGACCTKAGCGGCACTGAAT	513	This study
	GAGCAACGAYGCCTGGTAGYTG
qnrC	GGGTTGTACATTTATTGAATCG	307	6
	CACCTACCCATTTATTTTCA
qnrS	ACTGCAAGTTCATTGAACAG	431	This study
	GATCTAAACCGTCGAGTTCG
aac(6′)-Ib	TTGCGATGCTCTATGAGTGGCTA	482	11
	CTCGAATGCCTGGCGTGTTT
qepA	AACTGCTTGAGCCCGTAGAT
	GTCTACGCCATGGACCTCAC	596	6

One hundred fifty of the 156 strains were still positive by PCR for AAC(6′)-Ib, with 6 strains having lost the aac(6′)-Ib gene in storage. None contained the cr variant, confirming the expectation that more than a few years of exposure to potential quinolone substrates would be necessary for the enzyme to evolve to bifunctionality. None of the 156 strains was positive by PCR for qnrA, qnrC, or qnrS, genes that code for pentapeptide-repeat proteins that protect quinolone targets, or for qepA, a gene for a quinolone efflux pump. Two strains from 1988, however, were positive for qnrB alleles, including a qnrB8-like gene in a C. freundii isolate from Brooklyn, NY, and a qnrB9-like gene in a K. pneumoniae isolate from Cordoba, Argentina. Neither allele was transferred to azide-resistant E. coli J53 by mating and selection for nonquinolone resistances, suggesting possible chromosomal locations. It is interesting to note that strains from Argentina isolated in 2005 were the source of the QnrB10 variant, which differs from QnrB9 in five amino acids, and that aac(6′)-Ib-cr was found there in isolates from 2006 (14).

These 1988 strains are currently the earliest known to carry qnr alleles, the previous record holders having been the original qnrA1 strain from the United States, isolated in 1994 (8), and an unspecified qnr allele from the same year found in Israel (18). Recent screening of E. coli bloodstream isolates collected between 1991 and 2005 in Israel found that the earliest strain positive for aac(6′)-Ib-cr came from 2000 (7). Detection of qnr-mediated resistance in gram-negative pathogens thus preceded detection of aac(6′)-Ib-cr by more than a decade. Faced with the lethal challenge of fluoroquinolones, mobilization of qnr alleles from commensal bacteria (13) appears to have been accomplished more quickly than modification of an existing enzymatic mechanism.